ID: 1115085740

View in Genome Browser
Species Human (GRCh38)
Location 14:29512971-29512993
Sequence GCTGTACCCTGCAAAGCCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 5885
Summary {0: 835, 1: 1480, 2: 1472, 3: 1176, 4: 922}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115085740_1115085745 4 Left 1115085740 14:29512971-29512993 CCTGTGGCTTTGCAGGGTACAGC 0: 835
1: 1480
2: 1472
3: 1176
4: 922
Right 1115085745 14:29512998-29513020 CTCCAGCTGCTTTCACAGGCTGG No data
1115085740_1115085747 20 Left 1115085740 14:29512971-29512993 CCTGTGGCTTTGCAGGGTACAGC 0: 835
1: 1480
2: 1472
3: 1176
4: 922
Right 1115085747 14:29513014-29513036 AGGCTGGAGTTGAGTGTCCTTGG No data
1115085740_1115085748 30 Left 1115085740 14:29512971-29512993 CCTGTGGCTTTGCAGGGTACAGC 0: 835
1: 1480
2: 1472
3: 1176
4: 922
Right 1115085748 14:29513024-29513046 TGAGTGTCCTTGGCTTTTCCAGG No data
1115085740_1115085742 0 Left 1115085740 14:29512971-29512993 CCTGTGGCTTTGCAGGGTACAGC 0: 835
1: 1480
2: 1472
3: 1176
4: 922
Right 1115085742 14:29512994-29513016 CTCCCTCCAGCTGCTTTCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115085740 Original CRISPR GCTGTACCCTGCAAAGCCAC AGG (reversed) Intergenic
Too many off-targets to display for this crispr