ID: 1115085742

View in Genome Browser
Species Human (GRCh38)
Location 14:29512994-29513016
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115085733_1115085742 23 Left 1115085733 14:29512948-29512970 CCCATGGTCTTGGGCGGCTGACC No data
Right 1115085742 14:29512994-29513016 CTCCCTCCAGCTGCTTTCACAGG No data
1115085734_1115085742 22 Left 1115085734 14:29512949-29512971 CCATGGTCTTGGGCGGCTGACCC No data
Right 1115085742 14:29512994-29513016 CTCCCTCCAGCTGCTTTCACAGG No data
1115085739_1115085742 1 Left 1115085739 14:29512970-29512992 CCCTGTGGCTTTGCAGGGTACAG 0: 877
1: 1466
2: 1338
3: 996
4: 796
Right 1115085742 14:29512994-29513016 CTCCCTCCAGCTGCTTTCACAGG No data
1115085738_1115085742 2 Left 1115085738 14:29512969-29512991 CCCCTGTGGCTTTGCAGGGTACA 0: 907
1: 1362
2: 1353
3: 919
4: 764
Right 1115085742 14:29512994-29513016 CTCCCTCCAGCTGCTTTCACAGG No data
1115085740_1115085742 0 Left 1115085740 14:29512971-29512993 CCTGTGGCTTTGCAGGGTACAGC 0: 835
1: 1480
2: 1472
3: 1176
4: 922
Right 1115085742 14:29512994-29513016 CTCCCTCCAGCTGCTTTCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115085742 Original CRISPR CTCCCTCCAGCTGCTTTCAC AGG Intergenic
No off target data available for this crispr