ID: 1115085743

View in Genome Browser
Species Human (GRCh38)
Location 14:29512996-29513018
Sequence AGCCTGTGAAAGCAGCTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2491
Summary {0: 13, 1: 148, 2: 350, 3: 780, 4: 1200}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115085743_1115085747 -5 Left 1115085743 14:29512996-29513018 CCCTCCAGCTGCTTTCACAGGCT 0: 13
1: 148
2: 350
3: 780
4: 1200
Right 1115085747 14:29513014-29513036 AGGCTGGAGTTGAGTGTCCTTGG No data
1115085743_1115085748 5 Left 1115085743 14:29512996-29513018 CCCTCCAGCTGCTTTCACAGGCT 0: 13
1: 148
2: 350
3: 780
4: 1200
Right 1115085748 14:29513024-29513046 TGAGTGTCCTTGGCTTTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115085743 Original CRISPR AGCCTGTGAAAGCAGCTGGA GGG (reversed) Intergenic
Too many off-targets to display for this crispr