ID: 1115085746 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 14:29513000-29513022 |
| Sequence | CTCCAGCCTGTGAAAGCAGC TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1115085746_1115085747 | -9 | Left | 1115085746 | 14:29513000-29513022 | CCAGCTGCTTTCACAGGCTGGAG | No data | ||
| Right | 1115085747 | 14:29513014-29513036 | AGGCTGGAGTTGAGTGTCCTTGG | No data | ||||
| 1115085746_1115085748 | 1 | Left | 1115085746 | 14:29513000-29513022 | CCAGCTGCTTTCACAGGCTGGAG | No data | ||
| Right | 1115085748 | 14:29513024-29513046 | TGAGTGTCCTTGGCTTTTCCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1115085746 | Original CRISPR | CTCCAGCCTGTGAAAGCAGC TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||