ID: 1115085746

View in Genome Browser
Species Human (GRCh38)
Location 14:29513000-29513022
Sequence CTCCAGCCTGTGAAAGCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115085746_1115085747 -9 Left 1115085746 14:29513000-29513022 CCAGCTGCTTTCACAGGCTGGAG No data
Right 1115085747 14:29513014-29513036 AGGCTGGAGTTGAGTGTCCTTGG No data
1115085746_1115085748 1 Left 1115085746 14:29513000-29513022 CCAGCTGCTTTCACAGGCTGGAG No data
Right 1115085748 14:29513024-29513046 TGAGTGTCCTTGGCTTTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115085746 Original CRISPR CTCCAGCCTGTGAAAGCAGC TGG (reversed) Intergenic
No off target data available for this crispr