ID: 1115085747

View in Genome Browser
Species Human (GRCh38)
Location 14:29513014-29513036
Sequence AGGCTGGAGTTGAGTGTCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115085743_1115085747 -5 Left 1115085743 14:29512996-29513018 CCCTCCAGCTGCTTTCACAGGCT 0: 13
1: 148
2: 350
3: 780
4: 1200
Right 1115085747 14:29513014-29513036 AGGCTGGAGTTGAGTGTCCTTGG No data
1115085744_1115085747 -6 Left 1115085744 14:29512997-29513019 CCTCCAGCTGCTTTCACAGGCTG No data
Right 1115085747 14:29513014-29513036 AGGCTGGAGTTGAGTGTCCTTGG No data
1115085739_1115085747 21 Left 1115085739 14:29512970-29512992 CCCTGTGGCTTTGCAGGGTACAG 0: 877
1: 1466
2: 1338
3: 996
4: 796
Right 1115085747 14:29513014-29513036 AGGCTGGAGTTGAGTGTCCTTGG No data
1115085746_1115085747 -9 Left 1115085746 14:29513000-29513022 CCAGCTGCTTTCACAGGCTGGAG No data
Right 1115085747 14:29513014-29513036 AGGCTGGAGTTGAGTGTCCTTGG No data
1115085738_1115085747 22 Left 1115085738 14:29512969-29512991 CCCCTGTGGCTTTGCAGGGTACA 0: 907
1: 1362
2: 1353
3: 919
4: 764
Right 1115085747 14:29513014-29513036 AGGCTGGAGTTGAGTGTCCTTGG No data
1115085740_1115085747 20 Left 1115085740 14:29512971-29512993 CCTGTGGCTTTGCAGGGTACAGC 0: 835
1: 1480
2: 1472
3: 1176
4: 922
Right 1115085747 14:29513014-29513036 AGGCTGGAGTTGAGTGTCCTTGG No data
1115085741_1115085747 -2 Left 1115085741 14:29512993-29513015 CCTCCCTCCAGCTGCTTTCACAG No data
Right 1115085747 14:29513014-29513036 AGGCTGGAGTTGAGTGTCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115085747 Original CRISPR AGGCTGGAGTTGAGTGTCCT TGG Intergenic
No off target data available for this crispr