ID: 1115085748

View in Genome Browser
Species Human (GRCh38)
Location 14:29513024-29513046
Sequence TGAGTGTCCTTGGCTTTTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115085744_1115085748 4 Left 1115085744 14:29512997-29513019 CCTCCAGCTGCTTTCACAGGCTG No data
Right 1115085748 14:29513024-29513046 TGAGTGTCCTTGGCTTTTCCAGG No data
1115085746_1115085748 1 Left 1115085746 14:29513000-29513022 CCAGCTGCTTTCACAGGCTGGAG No data
Right 1115085748 14:29513024-29513046 TGAGTGTCCTTGGCTTTTCCAGG No data
1115085741_1115085748 8 Left 1115085741 14:29512993-29513015 CCTCCCTCCAGCTGCTTTCACAG No data
Right 1115085748 14:29513024-29513046 TGAGTGTCCTTGGCTTTTCCAGG No data
1115085743_1115085748 5 Left 1115085743 14:29512996-29513018 CCCTCCAGCTGCTTTCACAGGCT 0: 13
1: 148
2: 350
3: 780
4: 1200
Right 1115085748 14:29513024-29513046 TGAGTGTCCTTGGCTTTTCCAGG No data
1115085740_1115085748 30 Left 1115085740 14:29512971-29512993 CCTGTGGCTTTGCAGGGTACAGC 0: 835
1: 1480
2: 1472
3: 1176
4: 922
Right 1115085748 14:29513024-29513046 TGAGTGTCCTTGGCTTTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115085748 Original CRISPR TGAGTGTCCTTGGCTTTTCC AGG Intergenic
No off target data available for this crispr