ID: 1115085772

View in Genome Browser
Species Human (GRCh38)
Location 14:29513171-29513193
Sequence CTCTGCCAGGGCAAGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115085772_1115085778 -9 Left 1115085772 14:29513171-29513193 CCTTCCACCTTGCCCTGGCAGAG No data
Right 1115085778 14:29513185-29513207 CTGGCAGAGCTTCTCCATGAGGG No data
1115085772_1115085782 20 Left 1115085772 14:29513171-29513193 CCTTCCACCTTGCCCTGGCAGAG No data
Right 1115085782 14:29513214-29513236 CCCTGCAGCAGACTTCTGCCTGG 0: 274
1: 1242
2: 1888
3: 1625
4: 1294
1115085772_1115085784 29 Left 1115085772 14:29513171-29513193 CCTTCCACCTTGCCCTGGCAGAG No data
Right 1115085784 14:29513223-29513245 AGACTTCTGCCTGGACACACAGG No data
1115085772_1115085777 -10 Left 1115085772 14:29513171-29513193 CCTTCCACCTTGCCCTGGCAGAG No data
Right 1115085777 14:29513184-29513206 CCTGGCAGAGCTTCTCCATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115085772 Original CRISPR CTCTGCCAGGGCAAGGTGGA AGG (reversed) Intergenic
No off target data available for this crispr