ID: 1115096842

View in Genome Browser
Species Human (GRCh38)
Location 14:29647870-29647892
Sequence CCTTTTAAGCAGTTTATGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 1, 1: 1, 2: 5, 3: 30, 4: 203}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115096837_1115096842 13 Left 1115096837 14:29647834-29647856 CCTGAAAGACTGAGCACCGGACA 0: 1
1: 0
2: 3
3: 20
4: 132
Right 1115096842 14:29647870-29647892 CCTTTTAAGCAGTTTATGGTGGG 0: 1
1: 1
2: 5
3: 30
4: 203
1115096838_1115096842 -3 Left 1115096838 14:29647850-29647872 CCGGACAAAGAAAACAGATGCCT 0: 1
1: 0
2: 3
3: 28
4: 308
Right 1115096842 14:29647870-29647892 CCTTTTAAGCAGTTTATGGTGGG 0: 1
1: 1
2: 5
3: 30
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115096842 Original CRISPR CCTTTTAAGCAGTTTATGGT GGG Intronic
903083623 1:20834470-20834492 TCTTATAAGCAGCATATGGTTGG - Intronic
903512675 1:23888090-23888112 CCCTTTAAGCATTTTGAGGTGGG - Intronic
905520105 1:38591089-38591111 CCTTCCAAGCAGTTAAAGGTAGG + Intergenic
908958233 1:69662590-69662612 TCTTTTAAGCAGTTTAGGTGTGG + Intronic
910649960 1:89556080-89556102 CCTTTCCAGAAGTTGATGGTGGG - Intronic
910753818 1:90664107-90664129 CTTTGTAAGCAGTATATAGTTGG + Intergenic
911090882 1:94015975-94015997 CTTTTTAAACAGTTCTTGGTTGG + Intronic
911992857 1:104724718-104724740 ATTTCTAACCAGTTTATGGTAGG - Intergenic
911993573 1:104734266-104734288 TCTTTTTAGCAGTATATAGTGGG + Intergenic
912024785 1:105156234-105156256 CCCTTTAAGTAGCATATGGTTGG + Intergenic
913097013 1:115528150-115528172 CCTTTTAAACTCTTTAAGGTGGG + Intergenic
913363826 1:118013326-118013348 CCTGTTTAGCTCTTTATGGTAGG + Intronic
913566206 1:120074936-120074958 TCTTTTAAGCATTTTATGCTAGG + Intergenic
913631925 1:120718618-120718640 TCTTTTAAGCATTTTATGCTAGG - Intergenic
914286794 1:146234292-146234314 TCTTTTAAGCATTTTATGCTAGG + Intergenic
914547825 1:148685032-148685054 TCTTTTAAGCATTTTATGCTAGG + Intergenic
914618685 1:149385316-149385338 TCTTTTAAGCATTTTATGCTAGG - Intergenic
915198691 1:154210024-154210046 CCTTCTAAGCAGTTTTTACTAGG + Intronic
916921474 1:169472425-169472447 CTTTCTTATCAGTTTATGGTAGG - Intronic
917670315 1:177267730-177267752 CCTCTTAAGCAGTCTGTGGGTGG + Intronic
919029153 1:192216981-192217003 TCATTTAACCAGTTTTTGGTTGG + Intergenic
922536364 1:226383947-226383969 CTTTTTAACCAGACTATGGTTGG - Intronic
1063972953 10:11394235-11394257 CCTTTTAAGCTCTTTACGGTGGG - Intergenic
1064401853 10:15028110-15028132 CCTTTTAAGCAGTCAGTGGCTGG - Intergenic
1064966050 10:21016105-21016127 TCTTTGAAGCAGTTCATGCTGGG + Intronic
1065230778 10:23596234-23596256 CATTTAAAGCAGTATGTGGTGGG - Intergenic
1066395220 10:35014014-35014036 AATCTTAAGCAGTTTATGTTTGG + Intronic
1067004122 10:42645428-42645450 CCTTTTAAGCAGTCAGTGGCCGG - Intergenic
1068824670 10:61421900-61421922 CCTTATAAACAGCTTATAGTTGG - Intronic
1069198196 10:65580880-65580902 CCTTTTCAGCATTTTATTCTGGG + Intergenic
1070155908 10:73835231-73835253 CCTTTTAAGGTGTTTACAGTGGG - Intronic
1072056403 10:91761539-91761561 TCTTGTAAGCAGTATTTGGTTGG - Intergenic
1073889129 10:108077586-108077608 ACTTTGAGGAAGTTTATGGTAGG + Intergenic
1073899836 10:108206913-108206935 CATTTATAGCAATTTATGGTGGG - Intergenic
1073945887 10:108750088-108750110 TTTTTTAAGCCGTTTTTGGTTGG - Intergenic
1077759336 11:5074575-5074597 GCTTTTAATCAGTGTGTGGTGGG - Intergenic
1078830797 11:14974456-14974478 GCTTTTCAGCAGTTTAGGCTCGG + Intronic
1083060013 11:59860047-59860069 GCTTAAAAGCAGTTTAGGGTGGG + Intronic
1084111158 11:67014979-67015001 TCTTTTAAGTAGTTTGTGGCGGG - Intronic
1084360640 11:68666871-68666893 CCTTTTAGGCAGTTTACAGGGGG - Intergenic
1086110332 11:83192341-83192363 CCTTTTAAGCAATTTGTGGCGGG - Intergenic
1092195075 12:6544463-6544485 CCTTTTAAGCTATTTTTGGCTGG - Intronic
1092357449 12:7808466-7808488 CCTTTTTAGTTGTTTTTGGTAGG + Intergenic
1092536442 12:9392516-9392538 CCTTTTAAGCATTTCATGGGTGG - Intergenic
1092629578 12:10363666-10363688 CCTTTTAAGCATTTCGTGGGTGG - Intergenic
1093619166 12:21266367-21266389 CCTTTTAATCAGTCTCTGGAAGG - Exonic
1095336876 12:41039129-41039151 CCATTGAACCAGTTTAAGGTGGG + Intronic
1098348190 12:69528171-69528193 CCTTTTAAACATTCTATGGCTGG - Intronic
1099672716 12:85715744-85715766 CTTTTTTAGCTCTTTATGGTTGG + Intergenic
1101109248 12:101469755-101469777 CGCTTTAAGCAGCTTATAGTTGG - Intergenic
1107490278 13:40874888-40874910 CCTTTTAAGCAGTCAGTGGCTGG - Intergenic
1107623125 13:42254043-42254065 CCTCTTAAGATGTTTCTGGTGGG + Intronic
1109272307 13:60268198-60268220 CCTTTTAAACTCTTTAAGGTGGG + Intergenic
1109942372 13:69387212-69387234 TCTTTTAGGCAGTATATAGTTGG - Intergenic
1111805132 13:93031328-93031350 CCTTTTAAACTCTTTAAGGTGGG - Intergenic
1114232834 14:20799711-20799733 CCTTTTAAGCATTTTGAGGCAGG - Intergenic
1114997009 14:28365895-28365917 CCTTTTAAGCTGTACATGCTTGG + Intergenic
1115096842 14:29647870-29647892 CCTTTTAAGCAGTTTATGGTGGG + Intronic
1115097191 14:29650653-29650675 CCTTTTAAGCAGTTTTTGGCAGG + Intronic
1115815245 14:37156509-37156531 TCTTGTAAGCAGTATATAGTTGG - Intronic
1116682981 14:47999021-47999043 CCTTGTAACCAGTTTTTGGGTGG + Intergenic
1117629841 14:57679364-57679386 CATTTAAAGCAGTTTATAGAGGG + Intronic
1119578217 14:75748175-75748197 CTTTTCTAGCTGTTTATGGTAGG + Intronic
1124073405 15:26417639-26417661 TTTCTTAAGCAGTATATGGTTGG - Intergenic
1126444405 15:48726447-48726469 CTGTATAAGCACTTTATGGTTGG - Intronic
1127196673 15:56593491-56593513 TCTTATAGGCAGCTTATGGTTGG - Intergenic
1128981674 15:72192750-72192772 ATTTTTAAGCAGTTTTTGGCTGG - Intronic
1130153595 15:81331182-81331204 CCTTTTAAGCAGTCGGTGGCCGG + Intergenic
1131534290 15:93221690-93221712 CCTTTTAAGCAGTCGGTGGCTGG + Intergenic
1135227483 16:20674456-20674478 CCTTTTAAGCATTTTGGGGGTGG - Intronic
1138782386 16:59804817-59804839 AATTTTAAGCATTTTATGGCAGG - Intergenic
1144545799 17:16194067-16194089 CTTTTTAAGAAATTGATGGTAGG - Intronic
1147020153 17:37525355-37525377 CCATTGTAGCAGTTTATTGTAGG - Intronic
1147173183 17:38633763-38633785 TCTTTTAAACAGTTTAAGGAAGG - Intergenic
1148676714 17:49449859-49449881 CCTTTGAAGAAGTTTCTGGAAGG - Intronic
1149327157 17:55543821-55543843 GCTTTTAAGCATTTTAAGGTAGG + Intergenic
1156303015 18:35851936-35851958 CCGTTTGAGCAGTTGAGGGTAGG + Intergenic
1156767034 18:40669471-40669493 CTTTTTATGAAGTTTATGTTTGG - Intergenic
1156952302 18:42917089-42917111 CCCTTTAAGCACTTGATGGCCGG + Intronic
1158408613 18:57184363-57184385 TCTTCTAAGCAGTATATAGTTGG + Intergenic
1162664247 19:12195966-12195988 CTTTTTTAGCAGTTTCAGGTCGG + Intergenic
1164003529 19:21129125-21129147 CCCTTTAAGCATTTTGAGGTGGG - Intergenic
1164142372 19:22484250-22484272 ACTTTTAAGCGTTTTGTGGTGGG + Intronic
1166319419 19:42007049-42007071 GCTCTTTAGCTGTTTATGGTGGG - Intronic
1168441263 19:56369155-56369177 TCTTTTAAGCACTGTGTGGTGGG + Intergenic
925646000 2:6037499-6037521 CCTCTCAAGCAGCCTATGGTGGG - Intergenic
926226958 2:10973583-10973605 CCTTTTAAGGAGTTTCTGGGAGG - Intergenic
926388716 2:12364924-12364946 CCTTTTATGCTGTTTAGGTTTGG - Intergenic
929490768 2:42394251-42394273 CCTTTTTAGCAGTTTTTGTTGGG - Intronic
931327852 2:61245900-61245922 CCTTTTATCAAGTTAATGGTTGG - Intronic
936443298 2:112574994-112575016 CATTTTAAGCAGATTGTGGCCGG + Exonic
939453596 2:142403376-142403398 TCTTATAAGTAGCTTATGGTGGG - Intergenic
940348752 2:152657128-152657150 ACTTTCTAGCAGCTTATGGTGGG - Intronic
941826936 2:169909132-169909154 CCTTTTAAGGAATTTGTGGCTGG + Intronic
943600245 2:189909266-189909288 TCTTGTAGGCAGCTTATGGTTGG + Intronic
943856804 2:192805484-192805506 TCTTTTAAACAGCATATGGTTGG - Intergenic
944051648 2:195476700-195476722 CCTTTCCAGCAGTTTCTGGAGGG + Intergenic
944358657 2:198824309-198824331 ACTTTTAATCAGATTATGATGGG - Intergenic
945338000 2:208615733-208615755 CCTTTTAACCATTTTGAGGTGGG + Intronic
945775435 2:214101461-214101483 CATTTTCAGCAGTTAATGATAGG - Intronic
947044524 2:225966198-225966220 CCATTTAAGCAGGTTATACTAGG - Intergenic
948196574 2:236101230-236101252 CCTTTTAATCTGCTTGTGGTGGG - Intronic
1169905581 20:10600096-10600118 CCTTTTTATCATTTTATGGGAGG - Intronic
1170640948 20:18152154-18152176 TCTTTTAAGCTGTGTGTGGTGGG + Intronic
1170905493 20:20512436-20512458 TCTTTTTATCAGTTTGTGGTTGG - Intronic
1172157067 20:32834520-32834542 CCTTTTAAGCCATTTTTGGGGGG + Intronic
1175178749 20:57130091-57130113 CCTCTTATCCTGTTTATGGTGGG + Intergenic
1176346111 21:5749296-5749318 CCTTTTAAGCATTTCATGGGTGG + Intergenic
1176352925 21:5869880-5869902 CCTTTTAAGCATTTCATGGGTGG + Intergenic
1176498716 21:7575159-7575181 CCTTTTAAGCATTTCATGGGTGG - Intergenic
1176540432 21:8147366-8147388 CCTTTTAAGCATTTCATGGGTGG + Intergenic
1176559383 21:8330411-8330433 CCTTTTAAGCATTTCATGGGTGG + Intergenic
1179548212 21:42126178-42126200 GCTCTTAGGCAGTTTATGGTTGG + Intronic
1181076976 22:20385585-20385607 TCTATTTGGCAGTTTATGGTTGG - Intronic
1182832754 22:33316849-33316871 GTTTCTAAGGAGTTTATGGTTGG - Intronic
1184464830 22:44662746-44662768 CATTTTAAGCACTCTATGGAAGG + Intergenic
1203245375 22_KI270733v1_random:63793-63815 CCTTTTAAGCATTTCATGGGTGG + Intergenic
952608339 3:35177144-35177166 TCTTTTAGGCAGCTTATAGTTGG + Intergenic
953270787 3:41442074-41442096 TCTTGTAAGCAGTATATAGTTGG + Intronic
954032391 3:47828845-47828867 CCTTATAAGGAGTTAATGATGGG + Intronic
954496540 3:50969386-50969408 TCTTGTAAGCAGTATATGGTTGG + Intronic
954521233 3:51228464-51228486 CCTTTTAAACAGAATATGGTGGG - Intronic
955870645 3:63434959-63434981 ACTGCTCAGCAGTTTATGGTGGG + Intronic
958002647 3:87771125-87771147 TCTTATAAGCAGTATATAGTTGG + Intergenic
958081369 3:88749889-88749911 CATTTAAAGCAGTTTATAGAGGG + Intergenic
959250880 3:103943259-103943281 TCTTTTAGGCAGTCTATAGTTGG + Intergenic
960843928 3:121989125-121989147 CCTTTTGAGCAGTATATTTTAGG - Intronic
962513757 3:136129008-136129030 CATTTAAAGCAGTGTATGGAGGG + Intronic
963825456 3:149948278-149948300 TCTTGTAAGCACTTTATTGTTGG + Intronic
966284317 3:178275558-178275580 ACTTTTATGTAGTATATGGTTGG + Intergenic
967946728 3:194809976-194809998 TCTTTTATGGAGTTTATGGGAGG + Intergenic
970153059 4:13110444-13110466 TCTTATAAGCAGCATATGGTTGG - Intergenic
971412303 4:26386954-26386976 CGTTTTTAGCAGTTTATTTTTGG + Intronic
971528912 4:27659728-27659750 ACATTTAAGGAGTTTAAGGTTGG - Intergenic
972517629 4:39822900-39822922 TATTTTTAGCATTTTATGGTAGG + Exonic
974520316 4:62974196-62974218 CCTTTTAAACTCTTTAAGGTGGG - Intergenic
974520979 4:62979288-62979310 CCTTTTAAGCTCTTTAAGGTGGG + Intergenic
974678851 4:65135449-65135471 CCTTGTAGGCAGTGTATTGTTGG - Intergenic
974969396 4:68805466-68805488 CCTTTTAAACTCTTTAAGGTGGG - Intergenic
975078321 4:70241877-70241899 CATTTTAATCAGTATATAGTGGG - Intergenic
975862443 4:78691870-78691892 CCTATTTAGCAGTTTATTGAGGG - Intergenic
980237742 4:130131188-130131210 CCTAGTAAGCTGTTTATGCTTGG + Intergenic
980392361 4:132163157-132163179 CCTTTTAAGCTCTTTAAGGCGGG - Intergenic
980822035 4:138029873-138029895 CCTTTTAAATAATTTATGGTGGG + Intergenic
982439729 4:155421788-155421810 CCTTTTAAACTCTTTAAGGTGGG - Intergenic
982444873 4:155478669-155478691 CCTTTTAAGCAGCTAATAATTGG + Intergenic
984017157 4:174440612-174440634 TCTTTTAAGAAGTTTTAGGTTGG + Intergenic
984136990 4:175953462-175953484 CCTGTAAAGCAGTGTATGGCAGG + Intronic
984290613 4:177789405-177789427 CCTTTTAAACATTTTAAGGTGGG - Intronic
984323792 4:178226426-178226448 CCTTTTAAACTCTTTAAGGTGGG + Intergenic
987152186 5:15054438-15054460 TCTTTTAGGCAGTATATGTTGGG + Intergenic
988984653 5:36605442-36605464 CCTTTTAAACAGCTACTGGTTGG - Intergenic
989692525 5:44161043-44161065 CTTTAAAAGCAGTTTATTGTTGG + Intergenic
989754236 5:44933473-44933495 TCTTATAAGCAGCATATGGTTGG + Intergenic
990255001 5:53958649-53958671 TCTTATAAACAGTATATGGTTGG - Intronic
994908638 5:105872947-105872969 CCTTTTAAGCTTTTTAAGGTGGG - Intergenic
995448315 5:112271834-112271856 CCTATTAAGCACTTTTAGGTAGG - Intronic
995958213 5:117806309-117806331 TGATTTAAGCTGTTTATGGTAGG + Intergenic
1001375261 5:171250572-171250594 TCTTGTAAGCAGTATATAGTTGG - Intronic
1003773485 6:9334395-9334417 GCTTTTAAGCAATTTTGGGTTGG + Intergenic
1005591124 6:27328589-27328611 CCTTTGAAGCAGTATAAGCTGGG - Intergenic
1007987276 6:46219274-46219296 GCTTAAAAGCAGTTTATGGATGG + Intergenic
1008122267 6:47632156-47632178 CTTCTTAAGGAGTTTCTGGTAGG + Intergenic
1009520979 6:64681782-64681804 CCTTTTAAGCTGTTTGTGGCGGG + Intronic
1010285146 6:74068261-74068283 CCTCTTAAGATGTTTCTGGTTGG + Intergenic
1012739700 6:103000658-103000680 CCTTTTAAACTTTTTAAGGTGGG + Intergenic
1014763544 6:125385915-125385937 TCTTTTAAGCAACTTATAGTTGG + Intergenic
1016248392 6:142015158-142015180 CCTTTTAAACTCTTTAAGGTGGG - Intergenic
1016910192 6:149191032-149191054 TCTTTTAAGCTTGTTATGGTGGG - Intergenic
1016972705 6:149779339-149779361 CCTTTTAAGCAGTTTGTGGCAGG - Intronic
1018276865 6:162142054-162142076 TCTTTTAAGCAGCTTATGCATGG - Intronic
1018589213 6:165398911-165398933 TCTTGTAAGCAGTATATAGTTGG - Intronic
1019975878 7:4581075-4581097 CATTTTATGCAGTTTCTGGGGGG - Intergenic
1024790156 7:52956837-52956859 CCTTTTAAACTTTTTAAGGTGGG - Intergenic
1027011955 7:74753237-74753259 TCTTTTCAGCAGATGATGGTTGG + Intronic
1027659922 7:80976714-80976736 ACTCTTAAGCAGTTAATGGTGGG - Intergenic
1028213765 7:88106991-88107013 ACTGGTAAGCAGTTTATGGGCGG - Intronic
1028557075 7:92135840-92135862 CCTTTTAAGCAGTTTGTGTTGGG - Intronic
1029328746 7:99833304-99833326 CCTTTTAAGCATTTCGTGGGAGG + Intronic
1029574613 7:101395288-101395310 TCTTTTAATCAGTCTGTGGTGGG - Intronic
1029867130 7:103645359-103645381 TTTTGTAAGCAGTATATGGTTGG - Intronic
1030817787 7:114057908-114057930 CATTTAAAGCAGTGTATGGAGGG + Intronic
1031454563 7:121963342-121963364 CCTTTTAGGGAGTTTTAGGTGGG + Intronic
1031782310 7:125984294-125984316 TCTTTTAAGAAGCCTATGGTTGG + Intergenic
1034870214 7:154676781-154676803 CCTTTTAAGCATTTTGAGGCAGG + Intronic
1035136263 7:156706012-156706034 TCTTGTGAGCAGTGTATGGTTGG - Intronic
1037960823 8:23096758-23096780 CCTTTTAAGCAGTTTGTGGCAGG + Intronic
1039635604 8:39161402-39161424 GTTTTTTAGCAGTTTTTGGTGGG + Intronic
1043513550 8:80975173-80975195 CATTTTCAGTGGTTTATGGTGGG - Exonic
1043931201 8:86093562-86093584 ACTTTTAAGCTTTTTATGATGGG - Intronic
1044069949 8:87746712-87746734 CCCTTTAAGCAGTTTAAAGATGG - Intergenic
1044184746 8:89238045-89238067 CCTTTTAAACTCTTTAAGGTGGG - Intergenic
1045424587 8:102052126-102052148 CTTTTAAAGCATTTCATGGTTGG + Intronic
1046110974 8:109724163-109724185 CCTTCTAAGCAGCATATGATTGG - Intergenic
1046186745 8:110731792-110731814 CCTTTTAAGAAGTTTGGGATGGG - Intergenic
1047552989 8:125897000-125897022 ACAGTTATGCAGTTTATGGTTGG - Intergenic
1050981799 9:12028417-12028439 GCTTTTAAGCATTTTTAGGTGGG + Intergenic
1051157346 9:14164796-14164818 TCTTGAAAGCAGTTTATGTTTGG + Intronic
1055002805 9:71472524-71472546 CTTTTTAAGCATTTTGAGGTGGG + Intergenic
1055320029 9:75074235-75074257 TCTTTTAAGGAGCTTATTGTTGG + Intronic
1058013255 9:100001726-100001748 TCTTGTAGGCAGTTTATAGTTGG + Intronic
1058325139 9:103686861-103686883 ATTTTTAAGCAGTTTAGGATTGG - Intergenic
1059379718 9:113913597-113913619 ACTTTTCAGCAGTTTATGCCAGG + Intronic
1059523917 9:114971640-114971662 CCTTATAAGCAGCATATAGTTGG - Intergenic
1059844700 9:118262051-118262073 CCTTTTAGGCAGTTTATTCCCGG + Intergenic
1203461712 Un_GL000220v1:46865-46887 CCTTTTAAGCATTTCATGGGTGG + Intergenic
1185874459 X:3691135-3691157 CCTTTTAAGCAGTTTGTGGCGGG + Intronic
1187652717 X:21427057-21427079 CCTTTTAAGTAGGTTTAGGTCGG - Intronic
1189893985 X:45634131-45634153 CCTTTTAGGCAGTATAAAGTTGG + Intergenic
1190650959 X:52568302-52568324 CCTTTTAAGTAGTTTGTGGCGGG + Intergenic
1190652261 X:52578467-52578489 CCTTTTAAGTAGTTTGTGGCGGG + Intergenic
1190973015 X:55370807-55370829 CCTTTTAACCAGGATATAGTTGG - Intergenic
1191121420 X:56909987-56910009 CATTTAAAGCAGTTTGTAGTGGG - Intergenic
1191978923 X:66904096-66904118 CAATTTCAGCAGTTTATGGTAGG + Intergenic
1192288824 X:69769421-69769443 CCTGTTAAGCAGTATGTTGTTGG + Intronic
1192615392 X:72615937-72615959 TCTTTTAAGCAGCATATAGTTGG - Intronic
1193938829 X:87655597-87655619 TCTTGTAAGAAGTGTATGGTCGG + Intronic
1194368630 X:93041648-93041670 TCTTTTAAGCAGGATATAGTTGG + Intergenic
1194607377 X:95997591-95997613 CCTTTTAAGAAGCTTATTCTTGG + Intergenic
1195380834 X:104269326-104269348 CCTTTTAAGAAGTTCAAGTTAGG - Intergenic
1195574585 X:106435770-106435792 CCTTTTCTACAGGTTATGGTGGG - Intergenic
1195861351 X:109386667-109386689 CCTTTTAAGTACTTTGTGCTTGG - Intronic
1196542881 X:116930340-116930362 CCTTTTAAACTCTTTAAGGTGGG + Intergenic
1196706988 X:118725518-118725540 CCTTTTAAGGAGTCTTTAGTTGG - Intergenic
1197136295 X:123064105-123064127 CATTTTTAGCAATTTATGCTAGG - Intergenic
1197575670 X:128208143-128208165 CCTTTTAAACTCTTTAAGGTGGG - Intergenic
1198421439 X:136473363-136473385 TCTTCTAAGCAGTTTAGGGCTGG + Intergenic
1199408337 X:147489533-147489555 CCTTTTTACCAGGTTATGATTGG - Intergenic
1200523392 Y:4240926-4240948 TCTTGTAAACAGTATATGGTTGG + Intergenic
1200676828 Y:6157937-6157959 TCTTTTAAGCAGGATATAGTTGG + Intergenic
1201539149 Y:15087362-15087384 CCTTTTAAGCAGTTAATGGTGGG + Intergenic
1201574436 Y:15446901-15446923 CCTTTTCAGCAGTGTCTGGCAGG - Intergenic
1201583720 Y:15537578-15537600 CCTTTTAAACTCTTTAAGGTGGG + Intergenic
1201850150 Y:18471275-18471297 CCATTTCAGCAGCTTATGCTTGG + Intergenic
1201883168 Y:18849102-18849124 CCATTTCAGCAGCTTATGCTTGG - Intergenic
1201914042 Y:19163521-19163543 CCTTTTACACATTTGATGGTAGG + Intergenic
1201982102 Y:19919008-19919030 CCTTTTAAACTCTTTAAGGTGGG + Intergenic
1202051885 Y:20789915-20789937 CCTTTTAAGCATTTTGAGGCAGG + Intergenic
1202297434 Y:23374960-23374982 TGTTTTAGGCAGTATATGGTTGG + Intergenic
1202573375 Y:26295637-26295659 TGTTTTAGGCAGTATATGGTTGG - Intergenic