ID: 1115097191

View in Genome Browser
Species Human (GRCh38)
Location 14:29650653-29650675
Sequence CCTTTTAAGCAGTTTTTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 259
Summary {0: 1, 1: 3, 2: 7, 3: 30, 4: 218}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115097188_1115097191 9 Left 1115097188 14:29650621-29650643 CCTGAAAGACTGAGCACTAGACA 0: 1
1: 0
2: 3
3: 15
4: 174
Right 1115097191 14:29650653-29650675 CCTTTTAAGCAGTTTTTGGCAGG 0: 1
1: 3
2: 7
3: 30
4: 218

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115097191 Original CRISPR CCTTTTAAGCAGTTTTTGGC AGG Intronic
901671376 1:10858175-10858197 CGTTTTAAGCAGGTTTTGAGAGG - Intergenic
902122488 1:14178869-14178891 ACTTTTAAGCTCTTTTTGGAAGG + Intergenic
903908496 1:26704559-26704581 CCTTTAATACTGTTTTTGGCCGG + Intronic
906160645 1:43646726-43646748 TCTATTAAGAATTTTTTGGCCGG + Intergenic
907080349 1:51616279-51616301 CAATTTAAGCATTTATTGGCTGG - Intronic
907148309 1:52257448-52257470 CCTTTTAACCAGTACTTAGCTGG + Intronic
908159749 1:61394810-61394832 CCTTGAAAGTAGTCTTTGGCTGG + Intronic
908719873 1:67113835-67113857 CCTTTTAAGGTGTTTTCAGCAGG - Intronic
908795729 1:67829412-67829434 CTTTTTAAGTACTATTTGGCAGG + Intronic
908996406 1:70161394-70161416 CTTTTTAAGAAATTTTTGGCCGG + Intronic
911090882 1:94015975-94015997 CTTTTTAAACAGTTCTTGGTTGG + Intronic
911208245 1:95114537-95114559 CATTTAAAACAGTTTTTGGCTGG + Intergenic
911774954 1:101797254-101797276 CCTTTTAAGCTTTTTTTCCCTGG + Intergenic
912399097 1:109373644-109373666 GCTTTTAAGCATTTTTAGGCGGG - Intronic
913016121 1:114737210-114737232 CCTTTTAATCACTTTTTTGGGGG - Intronic
913975964 1:143455818-143455840 CATTTGAAACTGTTTTTGGCAGG - Intergenic
914070361 1:144281440-144281462 CATTTGAAACTGTTTTTGGCAGG - Intergenic
914108794 1:144684914-144684936 CATTTGAAACTGTTTTTGGCAGG + Intergenic
915198691 1:154210024-154210046 CCTTCTAAGCAGTTTTTACTAGG + Intronic
916139264 1:161679815-161679837 ATTTTTAAGAATTTTTTGGCCGG + Intergenic
917670315 1:177267730-177267752 CCTCTTAAGCAGTCTGTGGGTGG + Intronic
917693092 1:177489086-177489108 TGTTTTAATCAGTTTTTGGGGGG - Intergenic
917728103 1:177846969-177846991 GATTTTAAGCAGTGTGTGGCTGG - Intergenic
919029153 1:192216981-192217003 TCATTTAACCAGTTTTTGGTTGG + Intergenic
919117048 1:193293772-193293794 CCCTTTTAGAAGTTTTTGACAGG - Intergenic
919126573 1:193401512-193401534 TCTTTTATGTAGTTGTTGGCAGG - Intergenic
921079724 1:211729391-211729413 GCTTCTAAGCAGTTGGTGGCAGG + Intergenic
921896063 1:220402447-220402469 CCTATTATGAAGTTGTTGGCTGG + Intergenic
922130269 1:222770905-222770927 TCTCTTGACCAGTTTTTGGCTGG + Intergenic
923464146 1:234233084-234233106 CCTCTTTAGCAATTTCTGGCTGG - Intronic
924434015 1:244022580-244022602 CCCTTTGAGTAGTTTTTGACTGG + Intergenic
1064401853 10:15028110-15028132 CCTTTTAAGCAGTCAGTGGCTGG - Intergenic
1067004122 10:42645428-42645450 CCTTTTAAGCAGTCAGTGGCCGG - Intergenic
1067670380 10:48315126-48315148 CCTTTTCAGAAGTTTTTTTCTGG + Intronic
1069975959 10:72213568-72213590 CCTTTTAATCATTTTTGGGGGGG - Intronic
1071828663 10:89350613-89350635 CCTTTTAAGCATTTCTTGCAGGG + Intronic
1072056403 10:91761539-91761561 TCTTGTAAGCAGTATTTGGTTGG - Intergenic
1073945887 10:108750088-108750110 TTTTTTAAGCCGTTTTTGGTTGG - Intergenic
1080266695 11:30408649-30408671 CCTTTTAATCATTCTTTGTCTGG - Intronic
1081478579 11:43461484-43461506 TCTTTTAAGAACATTTTGGCTGG - Intronic
1082727530 11:56754226-56754248 CCTTTTTAGTATTTTTTGCCTGG + Intergenic
1082949001 11:58790203-58790225 CCTTTTAAACTCTTTTAGGCGGG + Intergenic
1084111158 11:67014979-67015001 TCTTTTAAGTAGTTTGTGGCGGG - Intronic
1084559851 11:69897986-69898008 CCGTTTAAGCAGTATTTAGGGGG - Intergenic
1086110332 11:83192341-83192363 CCTTTTAAGCAATTTGTGGCGGG - Intergenic
1086119083 11:83286897-83286919 CTGTTAAAGCAGTTGTTGGCGGG - Intergenic
1089828357 11:121300590-121300612 CCTTTTAAGTATTTTTGGTCAGG - Intronic
1092195075 12:6544463-6544485 CCTTTTAAGCTATTTTTGGCTGG - Intronic
1092357449 12:7808466-7808488 CCTTTTTAGTTGTTTTTGGTAGG + Intergenic
1092536442 12:9392516-9392538 CCTTTTAAGCATTTCATGGGTGG - Intergenic
1092629578 12:10363666-10363688 CCTTTTAAGCATTTCGTGGGTGG - Intergenic
1093043097 12:14407546-14407568 CCTATTAAGCATTATTAGGCTGG + Intronic
1093478423 12:19580279-19580301 CCATTTAGGCAGGATTTGGCAGG - Intronic
1093619166 12:21266367-21266389 CCTTTTAATCAGTCTCTGGAAGG - Exonic
1094496333 12:30991711-30991733 CATTTTGAGCAGTTTTGAGCAGG + Intronic
1096659360 12:53114422-53114444 GATTTTAAACAGTTTCTGGCTGG + Intronic
1097923359 12:65101485-65101507 CATTTTAGGCAGTTTTTGCCTGG - Intronic
1098348190 12:69528171-69528193 CCTTTTAAACATTCTATGGCTGG - Intronic
1099040287 12:77645025-77645047 TTTTTTAAGCTGTTTTTGGGAGG - Intergenic
1099635727 12:85208336-85208358 CTTTTTAAGTGCTTTTTGGCAGG - Intronic
1100525355 12:95413992-95414014 TCTTTTAAGAAATTTCTGGCTGG - Intergenic
1103781290 12:123400329-123400351 CATTTTAAAAACTTTTTGGCTGG - Intronic
1105223275 13:18353918-18353940 CATTTGAAACTGTTTTTGGCAGG + Intergenic
1106264262 13:28096056-28096078 ATTTTTAAGTAGTTTTAGGCTGG + Intronic
1107490278 13:40874888-40874910 CCTTTTAAGCAGTCAGTGGCTGG - Intergenic
1107912366 13:45117532-45117554 CCTATTAAGCAGGTTGGGGCTGG + Intergenic
1108897963 13:55359086-55359108 TGTTTTAAGCATTTTCTGGCAGG + Intergenic
1108958650 13:56192140-56192162 TTTTTTAAGCAATTTTGGGCTGG + Intergenic
1110056223 13:70976097-70976119 AGTTTTAGACAGTTTTTGGCAGG + Intergenic
1113575189 13:111390315-111390337 ACTTTGGAGCAGTTTCTGGCTGG + Intergenic
1114232834 14:20799711-20799733 CCTTTTAAGCATTTTGAGGCAGG - Intergenic
1115096842 14:29647870-29647892 CCTTTTAAGCAGTTTATGGTGGG + Intronic
1115097191 14:29650653-29650675 CCTTTTAAGCAGTTTTTGGCAGG + Intronic
1115388065 14:32820907-32820929 CATTTTAAGCAGCTTTTGCCTGG - Intronic
1115869563 14:37784874-37784896 CCTTTGAAGCTTTGTTTGGCTGG + Intronic
1115887412 14:37988448-37988470 CCTTTTAAGAATTTTGAGGCTGG + Intronic
1116682981 14:47999021-47999043 CCTTGTAACCAGTTTTTGGGTGG + Intergenic
1117098923 14:52325391-52325413 CCTTTTCTGCACTTCTTGGCTGG + Intronic
1118006647 14:61569414-61569436 CCTTGTAAGCTGTATCTGGCTGG - Intronic
1118370589 14:65134409-65134431 TCTTTTAAGAAGATGTTGGCCGG + Intergenic
1119504306 14:75158621-75158643 CCTCTGAAGTACTTTTTGGCTGG - Intronic
1121321397 14:92993762-92993784 CTTTTTAAGCACTTTGGGGCAGG - Intronic
1122085388 14:99297811-99297833 CCTTAAAAGCAGATGTTGGCTGG + Intergenic
1122309899 14:100787857-100787879 CCTTTCCTGCAGTTTTGGGCTGG + Intergenic
1123790319 15:23712954-23712976 CTTTTTAAGCAGCATTTGGGTGG + Intergenic
1124053138 15:26217630-26217652 CATTTTCAGCAGCTATTGGCTGG + Intergenic
1128981674 15:72192750-72192772 ATTTTTAAGCAGTTTTTGGCTGG - Intronic
1129042645 15:72703151-72703173 CCGTGTCAGCAGTTTCTGGCTGG + Intronic
1129749498 15:78051139-78051161 CATGATAAGCAGTTTGTGGCTGG - Intronic
1130153595 15:81331182-81331204 CCTTTTAAGCAGTCGGTGGCCGG + Intergenic
1131418847 15:92286394-92286416 ACTTTTGTGCATTTTTTGGCTGG - Intergenic
1131527273 15:93162466-93162488 CCTTTTAAGTAGTCGGTGGCCGG + Intergenic
1131534290 15:93221690-93221712 CCTTTTAAGCAGTCGGTGGCTGG + Intergenic
1133708491 16:8378626-8378648 CCTTTTAAGAATTTCTGGGCCGG + Intergenic
1135227483 16:20674456-20674478 CCTTTTAAGCATTTTGGGGGTGG - Intronic
1138782386 16:59804817-59804839 AATTTTAAGCATTTTATGGCAGG - Intergenic
1139491867 16:67290472-67290494 ACTTTTAAGCATTCTTAGGCCGG - Intronic
1148676714 17:49449859-49449881 CCTTTGAAGAAGTTTCTGGAAGG - Intronic
1149289634 17:55204996-55205018 CCTTTTTAGTAGTTCTTAGCAGG + Intergenic
1150886599 17:69093568-69093590 ACTTTTAAGCATTTTGGGGCGGG - Intronic
1151276092 17:73035434-73035456 CCTTTAAATAACTTTTTGGCCGG - Intronic
1151759634 17:76093272-76093294 CATTTGCAGCAGGTTTTGGCTGG + Intronic
1153847208 18:9060826-9060848 CCTTTTAAGAAATTTTAGCCTGG - Intergenic
1155358708 18:24979360-24979382 CCATTGAAGTAGGTTTTGGCTGG - Intergenic
1155441183 18:25864420-25864442 GCTTTCAAGCAGTTTTTCTCTGG - Intergenic
1155584091 18:27344736-27344758 TGTGTTAAGCAGTATTTGGCAGG - Intergenic
1156274552 18:35571236-35571258 CCATTTAATCATTTTTTAGCTGG + Intergenic
1156952302 18:42917089-42917111 CCCTTTAAGCACTTGATGGCCGG + Intronic
1157262433 18:46187635-46187657 CCTTTAAGACAGTTATTGGCCGG - Intronic
1157975666 18:52324179-52324201 CCTTTTAAAGAGTTTTATGCAGG - Intergenic
1158206809 18:55002145-55002167 CCCTTTATGCAGTTTTAAGCTGG - Intergenic
1159153744 18:64555150-64555172 CTTTTTAAGGATTTTTTGGATGG + Intergenic
1162313069 19:9919025-9919047 CCTTTTCAGCAGTTTTATGGAGG - Intronic
1163401262 19:17094346-17094368 CTTTTTAAGCAGTTTTATCCAGG + Intronic
1168433473 19:56299799-56299821 ATTTTTGACCAGTTTTTGGCTGG + Intronic
925864661 2:8216565-8216587 CCTTTGTAGCTTTTTTTGGCAGG - Intergenic
926226958 2:10973583-10973605 CCTTTTAAGGAGTTTCTGGGAGG - Intergenic
929490768 2:42394251-42394273 CCTTTTTAGCAGTTTTTGTTGGG - Intronic
932506703 2:72240277-72240299 CTTTTTAAGCAGTTTTCGAAAGG + Intronic
934180662 2:89616803-89616825 CATTTGAAACTGTTTTTGGCAGG - Intergenic
934290962 2:91691059-91691081 CATTTGAAACTGTTTTTGGCAGG - Intergenic
936443298 2:112574994-112575016 CATTTTAAGCAGATTGTGGCCGG + Exonic
941826936 2:169909132-169909154 CCTTTTAAGGAATTTGTGGCTGG + Intronic
942129853 2:172867267-172867289 TTTAATAAGCAGTTTTTGGCTGG - Intronic
943560583 2:189456943-189456965 CTTTTTAAACAGTGTTGGGCCGG + Intronic
944051648 2:195476700-195476722 CCTTTCCAGCAGTTTCTGGAGGG + Intergenic
944236995 2:197449916-197449938 GATTTTAAGAAATTTTTGGCCGG - Intergenic
945186920 2:207148686-207148708 TCTCTTGAGCAGTATTTGGCTGG + Intronic
945309364 2:208293439-208293461 CCTTTTCAGCATTTTTTGCAAGG + Intronic
948448185 2:238050086-238050108 CATTTTAAGAAGTTCTTGGCTGG - Intronic
1169399311 20:5266267-5266289 CCTTTTAAAAAGTTTTGGCCAGG + Intergenic
1170092612 20:12607871-12607893 ACTGTTAAGAAGTTTTTTGCAGG - Intergenic
1172157067 20:32834520-32834542 CCTTTTAAGCCATTTTTGGGGGG + Intronic
1172984928 20:38977845-38977867 ACTTTTGTGCATTTTTTGGCTGG + Intronic
1175345717 20:58273145-58273167 CCTTTTTCTCATTTTTTGGCTGG + Intergenic
1176346111 21:5749296-5749318 CCTTTTAAGCATTTCATGGGTGG + Intergenic
1176352925 21:5869880-5869902 CCTTTTAAGCATTTCATGGGTGG + Intergenic
1176498716 21:7575159-7575181 CCTTTTAAGCATTTCATGGGTGG - Intergenic
1176516477 21:7788160-7788182 TGTTTTAAACATTTTTTGGCTGG + Intergenic
1176540432 21:8147366-8147388 CCTTTTAAGCATTTCATGGGTGG + Intergenic
1176559383 21:8330411-8330433 CCTTTTAAGCATTTCATGGGTGG + Intergenic
1176731826 21:10506354-10506376 CATTTGAAACTGTTTTTGGCAGG + Intergenic
1176874548 21:14115381-14115403 CCTTTTAAGCTGTCAGTGGCCGG - Intronic
1178016038 21:28347120-28347142 CCTTGTAAAGAGTTATTGGCCGG + Intergenic
1178650505 21:34418172-34418194 TGTTTTAAACATTTTTTGGCTGG + Intergenic
1184043270 22:41957075-41957097 CCCTTTAAGGAGTCTTAGGCTGG - Intergenic
1203245375 22_KI270733v1_random:63793-63815 CCTTTTAAGCATTTCATGGGTGG + Intergenic
951555101 3:23913298-23913320 AATTTTAAGCATTTTTTGGAAGG + Intronic
952573163 3:34742299-34742321 CCTTGTGCTCAGTTTTTGGCTGG + Intergenic
952620775 3:35338868-35338890 CCTTTTAAGCAGATATTAACAGG - Intergenic
952644199 3:35636551-35636573 CTTTATAAGCACTTTTTAGCTGG - Intergenic
953126663 3:40096988-40097010 CCTTTTACTGAGTTGTTGGCAGG - Intronic
955809677 3:62774219-62774241 CCTTTTAAGAGCTTTGTGGCCGG - Intronic
960759342 3:121054957-121054979 CCTTTTATGGACTTTTTGGGAGG + Intronic
962856648 3:139352164-139352186 CATATTAAGTACTTTTTGGCAGG - Intronic
963882904 3:150547858-150547880 CCTTTTAAACAGTCTTTGCCTGG - Intronic
965299903 3:166996362-166996384 CCTGTTAAACAGTTTGTGTCAGG + Intergenic
969548616 4:7848904-7848926 GCTTTTATGCAGTTTTTTTCTGG - Intronic
970630936 4:17943789-17943811 ACATTTTAGGAGTTTTTGGCGGG + Intronic
971359692 4:25925542-25925564 GCTTTTAAGTATTTATTGGCAGG + Intronic
972159278 4:36203283-36203305 CCTGGTAACCAGTTTTTGGGTGG - Intronic
974504081 4:62745567-62745589 CATTTAAAGCAGTTTTTAGAGGG + Intergenic
974585043 4:63863204-63863226 CATTTAAAGCAGTGTTTGGGGGG - Intergenic
974957731 4:68663772-68663794 GCTTTTAAGGTGTTTTTGGGGGG - Intronic
975713260 4:77181331-77181353 CTTTTTTAGCAATTTTTTGCAGG + Intronic
978634519 4:110788509-110788531 TCTTTTAAGTAGTTATTTGCAGG + Intergenic
980188110 4:129488533-129488555 CCTTTTCAGCAGTTCCTAGCTGG + Intergenic
980392361 4:132163157-132163179 CCTTTTAAGCTCTTTAAGGCGGG - Intergenic
981506818 4:145510318-145510340 CCTTTTAAAAAATCTTTGGCGGG + Intronic
982674041 4:158355330-158355352 CCTGTTTAGCACTTTTTGCCAGG + Intronic
984017157 4:174440612-174440634 TCTTTTAAGAAGTTTTAGGTTGG + Intergenic
984136990 4:175953462-175953484 CCTGTAAAGCAGTGTATGGCAGG + Intronic
986769948 5:10963497-10963519 CCAGTGAAGCAGTTGTTGGCAGG + Intergenic
987955805 5:24738454-24738476 CCTTTTAAACAGTTTTATGAAGG - Intergenic
988414329 5:30927081-30927103 TCTTTTAAGTAATATTTGGCAGG - Intergenic
988421462 5:31010692-31010714 CCTTTGAAGGACTTTTAGGCAGG + Intergenic
988510852 5:31863356-31863378 CCTGTTAAGCATTAGTTGGCAGG + Intronic
994379659 5:99056483-99056505 ACTTTTAAACACTTGTTGGCTGG - Intergenic
995289349 5:110432460-110432482 TCTATTAAGCATTTTTTGGAGGG - Intronic
995448315 5:112271834-112271856 CCTATTAAGCACTTTTAGGTAGG - Intronic
998009943 5:138686838-138686860 ACTTTCAAGCAGTTTTGGTCGGG - Intronic
999743253 5:154573093-154573115 ACTTTGAAGCTGTTTTTAGCAGG - Intergenic
1000511696 5:162190640-162190662 CCTATCAAGCTGTTTTTGCCCGG - Intergenic
1002320200 5:178370737-178370759 CCTTTTAAGCAAATTTAGGATGG - Intronic
1002412922 5:179097980-179098002 CCTTTTTAGCTGTTTTCAGCAGG - Intergenic
1003773485 6:9334395-9334417 GCTTTTAAGCAATTTTGGGTTGG + Intergenic
1006411190 6:33874589-33874611 CCTTGTAAGCAGATTCTGTCAGG + Intergenic
1009520979 6:64681782-64681804 CCTTTTAAGCTGTTTGTGGCGGG + Intronic
1011432062 6:87298040-87298062 CCTTGAAAGCAGGTATTGGCTGG + Intronic
1011624059 6:89269255-89269277 CCTTCTAAGCCATTTTTGTCTGG - Intronic
1013697962 6:112726483-112726505 AATTTTAAACAATTTTTGGCAGG - Intergenic
1015764084 6:136697642-136697664 CATTTTAAGTGGTTTTTTGCAGG - Intronic
1016972705 6:149779339-149779361 CCTTTTAAGCAGTTTGTGGCAGG - Intronic
1019975878 7:4581075-4581097 CATTTTATGCAGTTTCTGGGGGG - Intergenic
1021224286 7:18010085-18010107 CATTTAAAGCAGTGTTTAGCGGG - Intergenic
1023323054 7:39020978-39021000 TCTTTTAAACAGTCTCTGGCTGG + Intronic
1024049868 7:45611826-45611848 CCTTTTCTGCTGTTTTTTGCTGG + Intronic
1024409725 7:49026413-49026435 CTTTTTAAGGAAATTTTGGCAGG - Intergenic
1025781510 7:64605928-64605950 CCTTTTAAGTATTTTGAGGCGGG + Intergenic
1026764309 7:73150293-73150315 GCTTTTAAACAGTTTTGGCCAGG + Intergenic
1027040778 7:74960064-74960086 GCTTTTAAACAGTTTTGGCCAGG + Intergenic
1027082859 7:75242293-75242315 GCTTTTAAACAGTTTTGGCCAGG - Intergenic
1028532081 7:91849311-91849333 CCTTTTAATAAGTCTTTGGATGG - Intronic
1028557075 7:92135840-92135862 CCTTTTAAGCAGTTTGTGTTGGG - Intronic
1029328746 7:99833304-99833326 CCTTTTAAGCATTTCGTGGGAGG + Intronic
1030076054 7:105737824-105737846 ACTTTTAAGAATTTTGTGGCTGG + Intronic
1031340684 7:120596291-120596313 CTTTTTAAGCAGACATTGGCTGG - Intronic
1031454563 7:121963342-121963364 CCTTTTAGGGAGTTTTAGGTGGG + Intronic
1031934548 7:127723120-127723142 AATTTTAAGCAGTTTTTAGGGGG + Intronic
1032180631 7:129673841-129673863 TTTTTTAAGCTGTTTTTGGCTGG + Intronic
1032603774 7:133327589-133327611 CATTTAAAGCAGTGTTTGGAGGG - Intronic
1032783303 7:135181848-135181870 TCTTTTAAGCATTTTGAGGCAGG - Intergenic
1034597766 7:152215097-152215119 CATTTAAAACTGTTTTTGGCAGG - Intronic
1034870214 7:154676781-154676803 CCTTTTAAGCATTTTGAGGCAGG + Intronic
1037487245 8:19359024-19359046 CCTTTTCAGCAGTGTTTTGCTGG - Intronic
1037960823 8:23096758-23096780 CCTTTTAAGCAGTTTGTGGCAGG + Intronic
1039577259 8:38633561-38633583 CCTTGAGAGCAGCTTTTGGCTGG + Intergenic
1039630143 8:39102244-39102266 CTTTTTTAGCTGTTTTTGACGGG - Intronic
1039635604 8:39161402-39161424 GTTTTTTAGCAGTTTTTGGTGGG + Intronic
1041993176 8:64019428-64019450 CTTTTTAAACATTTTTTGGGAGG - Intergenic
1042442816 8:68847934-68847956 CATTTAAAGCAGTTTTTAACAGG - Intergenic
1043114713 8:76235848-76235870 CCTTTTAATAAGTTTTCAGCTGG - Intergenic
1045157980 8:99500884-99500906 TCTTTTCAGCAGCTTTTAGCAGG - Intronic
1045434189 8:102144144-102144166 CCTCTTAAGCTATGTTTGGCAGG + Intergenic
1045531619 8:102990402-102990424 TCTTTTAAGGAGGTTTTGGAGGG + Intergenic
1045630419 8:104113428-104113450 CCTTTAAAGAAGTTATAGGCAGG - Intronic
1046284560 8:112078064-112078086 CCTTTTAAGCATTTCTTGCAGGG + Intergenic
1050170617 9:2812108-2812130 CCTTTTCAGCAGTTTTAGAGAGG + Intronic
1050295404 9:4199171-4199193 CCTTCTATGAAGTTGTTGGCTGG - Intronic
1050981799 9:12028417-12028439 GCTTTTAAGCATTTTTAGGTGGG + Intergenic
1052729022 9:32263825-32263847 TATTTTAATGAGTTTTTGGCAGG + Intergenic
1052825258 9:33169490-33169512 CAGTTTAAGCAGATTTGGGCAGG - Intergenic
1053327615 9:37169763-37169785 CCTTTTGAAAATTTTTTGGCTGG + Intronic
1056377347 9:86027628-86027650 TCTTTTAAACAGCTTTTGGGGGG - Exonic
1058054316 9:100434225-100434247 CCTTTGAAACAGTCTTTGGCTGG + Intronic
1059122164 9:111650790-111650812 CTTCTTAAGCAGGTTTTGGCTGG - Intronic
1059379718 9:113913597-113913619 ACTTTTCAGCAGTTTATGCCAGG + Intronic
1059844700 9:118262051-118262073 CCTTTTAGGCAGTTTATTCCCGG + Intergenic
1203461712 Un_GL000220v1:46865-46887 CCTTTTAAGCATTTCATGGGTGG + Intergenic
1185874459 X:3691135-3691157 CCTTTTAAGCAGTTTGTGGCGGG + Intronic
1186387111 X:9121118-9121140 CCTTTTAACAACTTTTTTGCAGG - Intronic
1187652717 X:21427057-21427079 CCTTTTAAGTAGGTTTAGGTCGG - Intronic
1190650959 X:52568302-52568324 CCTTTTAAGTAGTTTGTGGCGGG + Intergenic
1190652261 X:52578467-52578489 CCTTTTAAGTAGTTTGTGGCGGG + Intergenic
1190802929 X:53808736-53808758 CTTTCTAAGCAGTTTTGTGCGGG + Intergenic
1190826688 X:54024366-54024388 TCTTTGAAGAAGTTTTAGGCAGG - Intronic
1195148196 X:102039458-102039480 CAGTTTAAGGAGTTTTTGGGCGG - Intergenic
1196706988 X:118725518-118725540 CCTTTTAAGGAGTCTTTAGTTGG - Intergenic
1197041596 X:121943211-121943233 ACTTTTAAGAACTTTTTGCCAGG + Intergenic
1198257977 X:134941695-134941717 CCTTTTAAAAAGTTATTGGCTGG + Intergenic
1198282333 X:135154370-135154392 CCTTGGAACCATTTTTTGGCAGG - Intergenic
1198288626 X:135218152-135218174 CCTTGGAACCATTTTTTGGCAGG + Intergenic
1198421439 X:136473363-136473385 TCTTCTAAGCAGTTTAGGGCTGG + Intergenic
1198818239 X:140615956-140615978 CATTTTATGCAGTTGTTGGGTGG + Intergenic
1201539149 Y:15087362-15087384 CCTTTTAAGCAGTTAATGGTGGG + Intergenic
1201574310 Y:15445616-15445638 TCTTTTGAGCAGTGTCTGGCAGG - Intergenic
1201574436 Y:15446901-15446923 CCTTTTCAGCAGTGTCTGGCAGG - Intergenic
1201944175 Y:19493967-19493989 CCTTTTAACAATTTTTTGGGGGG - Intergenic
1202051885 Y:20789915-20789937 CCTTTTAAGCATTTTGAGGCAGG + Intergenic