ID: 1115103069

View in Genome Browser
Species Human (GRCh38)
Location 14:29726506-29726528
Sequence TCAGATCTGTCATCAGTTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 187}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115103069_1115103071 -2 Left 1115103069 14:29726506-29726528 CCTGGAACTGATGACAGATCTGA 0: 1
1: 0
2: 0
3: 17
4: 187
Right 1115103071 14:29726527-29726549 GACACTTATGTCAATACAGGTGG 0: 1
1: 0
2: 0
3: 3
4: 73
1115103069_1115103072 19 Left 1115103069 14:29726506-29726528 CCTGGAACTGATGACAGATCTGA 0: 1
1: 0
2: 0
3: 17
4: 187
Right 1115103072 14:29726548-29726570 GGACCTTAAGAAGCTACTGTCGG 0: 1
1: 0
2: 0
3: 4
4: 110
1115103069_1115103070 -5 Left 1115103069 14:29726506-29726528 CCTGGAACTGATGACAGATCTGA 0: 1
1: 0
2: 0
3: 17
4: 187
Right 1115103070 14:29726524-29726546 TCTGACACTTATGTCAATACAGG 0: 1
1: 0
2: 0
3: 8
4: 71
1115103069_1115103073 20 Left 1115103069 14:29726506-29726528 CCTGGAACTGATGACAGATCTGA 0: 1
1: 0
2: 0
3: 17
4: 187
Right 1115103073 14:29726549-29726571 GACCTTAAGAAGCTACTGTCGGG 0: 1
1: 0
2: 0
3: 7
4: 73
1115103069_1115103074 21 Left 1115103069 14:29726506-29726528 CCTGGAACTGATGACAGATCTGA 0: 1
1: 0
2: 0
3: 17
4: 187
Right 1115103074 14:29726550-29726572 ACCTTAAGAAGCTACTGTCGGGG 0: 1
1: 0
2: 0
3: 7
4: 47

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115103069 Original CRISPR TCAGATCTGTCATCAGTTCC AGG (reversed) Intronic
900712251 1:4121879-4121901 TCAGCTCTGTCATCTGTACCAGG + Intergenic
901235873 1:7667369-7667391 TCAGAGCTGTCTTCTGGTCCTGG + Intronic
901685090 1:10939318-10939340 TCAGACCTGAGATCAGATCCTGG - Intergenic
902941606 1:19804074-19804096 TCAAATGTGTGAGCAGTTCCAGG + Intergenic
914248953 1:145906455-145906477 GCAGCTCTGTCTTCAGTTCTGGG - Exonic
914804862 1:150984370-150984392 TCAGAGCTGTCCTCAATTCCTGG - Exonic
919397999 1:197074222-197074244 TGAATTCTTTCATCAGTTCCAGG - Intergenic
923744668 1:236688911-236688933 TGAGATCTGTCAACAGATGCTGG + Intronic
1064810554 10:19193099-19193121 TCAAATATTTCTTCAGTTCCTGG + Intronic
1066212595 10:33254447-33254469 TCAGAATTTTCATCATTTCCTGG - Intronic
1067404618 10:46010365-46010387 CCAGCTCTGTCTTCAGTACCAGG + Exonic
1068789834 10:61015905-61015927 TGAGATCTGTGATCAAATCCTGG + Intergenic
1069550788 10:69362641-69362663 TGGGACCTGTCACCAGTTCCCGG - Intronic
1072083045 10:92052388-92052410 TCAGATGTGTGATGAGTGCCAGG - Exonic
1072771372 10:98142307-98142329 TCTGAGATGTAATCAGTTCCAGG + Intronic
1072831969 10:98668040-98668062 TGAGATCAATTATCAGTTCCAGG - Intronic
1075375447 10:121974895-121974917 CCAGATCCGCCATCAGTACCGGG - Exonic
1076954437 10:133688275-133688297 TCACCTTTGTCATCAGTTCAGGG + Intergenic
1077694992 11:4385736-4385758 TCAAATCTCTCTTCATTTCCAGG + Exonic
1077793801 11:5469617-5469639 TTAGATCTGTCATGAGCTCCAGG + Intronic
1080531017 11:33176630-33176652 TTAGAACTGTCATAACTTCCTGG - Intergenic
1083483686 11:62967704-62967726 TCAGTTAAGTCATCTGTTCCTGG - Intronic
1084939727 11:72606101-72606123 GCAGCTCTGGCCTCAGTTCCAGG + Intronic
1086131884 11:83409620-83409642 TGAGGTCTGTGAGCAGTTCCAGG + Intergenic
1091569946 12:1676257-1676279 TCATATCTTTCATCAATTCTCGG + Intergenic
1092012547 12:5126915-5126937 TTTGAACTGACATCAGTTCCAGG - Intergenic
1093441089 12:19197120-19197142 TCAGATCTTACTTCACTTCCTGG + Intronic
1095139737 12:38646887-38646909 TCAGAGCTGACATAAGATCCTGG + Intronic
1096219490 12:49820151-49820173 TCAGCTCTGCCATCACCTCCAGG - Intronic
1096598170 12:52710497-52710519 TGAGACCTGCCATCAATTCCAGG + Intergenic
1098683770 12:73393971-73393993 TCAGATCTGGAATCAGTATCTGG - Intergenic
1098872060 12:75827188-75827210 TCACATCTGTGATCACATCCTGG - Intergenic
1099325097 12:81204771-81204793 TCAACTATGTCATCAGTACCTGG - Intronic
1102031141 12:109740891-109740913 TCAGATCTGTCTTCAGACCCTGG - Intronic
1102997910 12:117363551-117363573 TCAGTTCTCTCCTCACTTCCAGG + Intronic
1104778834 12:131406760-131406782 TCAAATCTTTAATGAGTTCCAGG - Intergenic
1109187424 13:59287224-59287246 TCAGATCAGTCTTCAAATCCAGG + Intergenic
1114889430 14:26898924-26898946 TCAGTTCTGTCATTAGTTATGGG + Intergenic
1115103069 14:29726506-29726528 TCAGATCTGTCATCAGTTCCAGG - Intronic
1116012594 14:39368243-39368265 TCAGGTCTGTCATCAGTGAATGG + Intronic
1119331493 14:73797751-73797773 TCAGCCCTGTCACCAGGTCCTGG - Intergenic
1119758728 14:77136707-77136729 TCAGATCTGTCACCAGAGCATGG - Intronic
1120088620 14:80305435-80305457 CCAGAACAGTCATCAGTTCTTGG - Intronic
1121808290 14:96852815-96852837 TCATATTTGTCTTCAGTTACAGG + Exonic
1122166526 14:99829059-99829081 TCAGTGCTGTCCACAGTTCCAGG + Intronic
1122556841 14:102585205-102585227 TGACAACTGTCATCAGTGCCAGG + Intergenic
1202853063 14_GL000225v1_random:33358-33380 TCACCTTTGTCATCAGTTCAGGG + Intergenic
1202855626 14_GL000225v1_random:49826-49848 TCACCTTTGTCATCAGTTCAGGG + Intergenic
1202860128 14_GL000225v1_random:76400-76422 TCACCTGTGTCATCAGTTCAGGG - Intergenic
1202861037 14_GL000225v1_random:81068-81090 TCACCTTTGTCATCAGTTCAGGG - Intergenic
1202861632 14_GL000225v1_random:86651-86673 TCAGCTGTGTCATCAGTTCAGGG - Intergenic
1202863159 14_GL000225v1_random:97316-97338 TCACCTTTGTCATCAGTTCAGGG - Intergenic
1202863873 14_GL000225v1_random:103214-103236 TCACCTTTGTCATCAGTTCAGGG - Intergenic
1202863879 14_GL000225v1_random:103282-103304 TCATCTTTGTCATCAGTTCAGGG - Intergenic
1202864582 14_GL000225v1_random:107162-107184 TCACCTTTGTCATCAGTTCAGGG + Intergenic
1202865227 14_GL000225v1_random:113091-113113 TCACCTTTGTCATCAGTTCAGGG + Intergenic
1202866297 14_GL000225v1_random:120569-120591 TCACCTTTGTCATCAGTTCAGGG - Intergenic
1202866786 14_GL000225v1_random:125287-125309 TCACCTTTGTCATCAGTTCAGGG - Intergenic
1202867424 14_GL000225v1_random:131102-131124 TCACCTTTGTCATCAGTTCAGGG - Intergenic
1202867514 14_GL000225v1_random:131920-131942 TCACCTTTGTCATCAGTTCAGGG - Intergenic
1128136828 15:65269963-65269985 GGAGATCTGTATTCAGTTCCAGG - Intronic
1131406661 15:92170513-92170535 TCAGATCTGTCACTGGCTCCTGG - Intronic
1131538961 15:93260295-93260317 TCAGTTCTGTCCTCAGTTTCAGG + Intergenic
1134014345 16:10878234-10878256 GCAGACCTGTCATCAGTCTCTGG - Intronic
1137614414 16:49838426-49838448 TCAGAACAGTCCTCAGTACCTGG + Intronic
1142357667 16:89610583-89610605 TCAGATCTTTCATTATTTTCAGG + Intergenic
1143281073 17:5754577-5754599 TCAGCTCAGTCATCAGCTCATGG + Intergenic
1143778542 17:9216622-9216644 ACAGCTCTGTCTTCAGCTCCTGG + Intronic
1144620042 17:16812696-16812718 TCAGTTCCCTCATCAGTTCAAGG + Intergenic
1144892647 17:18503008-18503030 TCAGTTCCCTCATCAGTTCAAGG - Intergenic
1144999925 17:19297307-19297329 TCAGATCTGTCAGCACTTTTGGG - Intronic
1145139567 17:20441279-20441301 TCAGTTCCCTCATCAGTTCAAGG + Intergenic
1145279981 17:21459992-21460014 TGAGATGTGTCATCAGTCACAGG + Intergenic
1145796323 17:27657421-27657443 TCAGCTCCCTCATCAGTTCAAGG - Intergenic
1145810756 17:27762703-27762725 TCAGCTCCCTCATCAGTTCAAGG - Intronic
1148196798 17:45719810-45719832 CCACATCTTCCATCAGTTCCAGG - Intergenic
1149130553 17:53296059-53296081 TCAGTTCTTTCATCAGTCCTAGG - Intergenic
1149335790 17:55634460-55634482 CCCCATCTATCATCAGTTCCAGG - Intergenic
1150830067 17:68511709-68511731 TCAGGTCAGTCATCCGGTCCAGG - Intergenic
1151207117 17:72515860-72515882 ACAGACTTGTCATCATTTCCTGG - Intergenic
1152965331 18:109297-109319 TCACCTTTGTCATCAGTTCAGGG - Intergenic
1154254305 18:12769240-12769262 TCAGAATTGACACCAGTTCCTGG + Intergenic
1154390730 18:13934178-13934200 TCCTACCTGTCCTCAGTTCCTGG + Intergenic
1155819204 18:30353093-30353115 TCAGTCCTGACATCAGTTCTGGG - Intergenic
1158031581 18:52971803-52971825 TAAGATCAATCATCAGTGCCAGG - Intronic
1159856521 18:73596192-73596214 CCACATCTGTCTTCAGTTCCAGG - Intergenic
1161328756 19:3676241-3676263 TCACATCTCTCATCACTTCCCGG - Intronic
1161751672 19:6102206-6102228 TCAGACCTTTCCTCAGCTCCAGG + Intronic
1164463967 19:28471823-28471845 TCAGATCACTCATGAGTTTCTGG + Intergenic
1168146375 19:54421759-54421781 TCAGCTCCGACATCAGCTCCAGG + Intronic
926605489 2:14894390-14894412 TCAGATAAGATATCAGTTCCAGG - Intergenic
927515824 2:23671080-23671102 TCTGAGCTGTCATTAGCTCCTGG + Intronic
929090981 2:38217104-38217126 ACAGAGCTGTCATCAGTAACTGG - Intergenic
933249062 2:80008122-80008144 TCAGATTTTCCATCTGTTCCTGG - Intronic
933973873 2:87492278-87492300 TCAGATCTGTCTTCTCCTCCTGG + Intergenic
936151802 2:110025845-110025867 TCAGATCTGTCTGCAGTCCTGGG + Intergenic
936192872 2:110345524-110345546 TCAGATCTGTCTGCAGTCCTGGG - Intergenic
936319846 2:111457926-111457948 TCAGATCTGTCTTCTCCTCCTGG - Intergenic
936936711 2:117846183-117846205 TCAGAACTGTCCTCAGTTGGAGG - Intergenic
937266944 2:120622665-120622687 TCAGTGCTGTCATCAGTCCTTGG - Intergenic
939683367 2:145167258-145167280 TCAGATCTATCCTCATTTACTGG + Intergenic
940187147 2:150998364-150998386 CCATATCTGTCATCAGTTATGGG - Intergenic
940309891 2:152267314-152267336 TCAGTTAAGTCATCTGTTCCTGG - Intergenic
940705541 2:157100799-157100821 GCAGATCTGAGTTCAGTTCCTGG + Intergenic
943137778 2:183937454-183937476 ACAGGTCTGTCCTCAGGTCCTGG - Intergenic
946466193 2:219914162-219914184 TCAGACCATTCTTCAGTTCCTGG - Intergenic
947910760 2:233799375-233799397 GCAGAGCTGTCTTCAGTCCCTGG + Intronic
1169133086 20:3177472-3177494 ACTCATCAGTCATCAGTTCCAGG + Intergenic
1173276380 20:41587793-41587815 ACAGAAATGTCATCAGTTGCTGG - Intronic
1173449651 20:43151481-43151503 TCATATCTGGAGTCAGTTCCTGG - Intronic
1174173374 20:48630436-48630458 TTACATCTGTCATGAGGTCCAGG + Intronic
1178208477 21:30499109-30499131 TCAGATCTTTGCTCAGTTGCGGG + Intergenic
1178437052 21:32569384-32569406 TCGGCTCTGTCCTCCGTTCCGGG - Intergenic
1179533749 21:42038139-42038161 TCAGACCTTTGATCAGCTCCCGG - Intergenic
1180887619 22:19258443-19258465 TCAGATTTCTCATCAAGTCCAGG - Intronic
1184317592 22:43708774-43708796 ACAGATTTGTCATATGTTCCTGG - Intronic
1184877623 22:47285534-47285556 TCAGCTCTAACATCAGTGCCTGG - Intergenic
949455252 3:4231134-4231156 CCAGCTCTGTAGTCAGTTCCAGG - Intronic
952157721 3:30661310-30661332 ACAGATGTGTCATCATTTCCTGG + Intronic
952578139 3:34799553-34799575 ACAGATCTGGCATCAGTAGCGGG + Intergenic
953474491 3:43194151-43194173 TCAGATTTCTCAGCAGTTCCAGG - Intergenic
953790162 3:45941264-45941286 GCAGAGCTGTTATCAGTTCCAGG - Intronic
956988319 3:74730794-74730816 TCAGATTTGTCCTCACTTCCAGG - Intergenic
963225584 3:142858392-142858414 TCAGATCTGTGAATAGTTTCGGG + Intronic
964770698 3:160221870-160221892 TCAGATCTTACATCATTTCTAGG + Intergenic
966252151 3:177877988-177878010 TCACATCTGACTTCAATTCCAGG + Intergenic
967786109 3:193498467-193498489 TCAGTTAGGTCATCAGTTCACGG - Intronic
969592551 4:8130263-8130285 CCGCATCTGTCACCAGTTCCGGG + Intronic
970314032 4:14812246-14812268 CCAGATCTGTGATGAGTTCCGGG + Intergenic
970356951 4:15263852-15263874 TTGGATCTGGCATCAGATCCAGG - Intergenic
972281214 4:37603626-37603648 TCAAATCTGTCTTCACATCCAGG - Intronic
976474427 4:85467605-85467627 TGAGATCTGTGATGACTTCCAGG - Intergenic
977875017 4:102139449-102139471 ACAGATTTCTCATCAGTTCTGGG + Intergenic
978954232 4:114595519-114595541 TCAGATCAGTCATCATGCCCTGG + Intergenic
981887802 4:149698429-149698451 TCAGCTCTGCCCTCAGTTCTTGG - Intergenic
982003252 4:151040552-151040574 ACAGCTCTATCATCAGTGCCTGG - Intergenic
982673454 4:158349013-158349035 GCTGATCTGTCAGAAGTTCCGGG + Intronic
983258734 4:165432219-165432241 GCACATCCGTCATCAGTGCCCGG - Intronic
984527848 4:180878427-180878449 TCAGATCTGTCATCTTTTTTTGG - Intergenic
985464124 4:190178387-190178409 TCACCTTTGTCATCAGTTCAGGG + Intronic
990701457 5:58479165-58479187 TCAGAAATGTCATCAGGTCTTGG - Intergenic
991528192 5:67587030-67587052 TCAGAACTCTCATGAATTCCTGG + Intergenic
992739205 5:79756211-79756233 TCTGACCCGTGATCAGTTCCTGG + Intronic
993476222 5:88368255-88368277 TCAGATATCTCATCATTTTCTGG + Intergenic
994621478 5:102168226-102168248 TCAGATCTGTCATAATTTTATGG - Intergenic
996556085 5:124780295-124780317 TCAGATTTCTCTTCAGTTTCTGG - Intergenic
997791342 5:136765195-136765217 TCACAGCAGTCATAAGTTCCTGG - Intergenic
1001942623 5:175751345-175751367 TCAGATCTGTAATGAGAACCTGG - Intergenic
1004775472 6:18839628-18839650 TCAGCTCAGTCATCAGTTTCTGG + Intergenic
1005089158 6:22038335-22038357 TCTGCTCTGTCAGCATTTCCAGG + Intergenic
1005376374 6:25186741-25186763 TCAGCTGTCTCCTCAGTTCCAGG - Intergenic
1008748290 6:54700495-54700517 TCATATCTTTGATCTGTTCCAGG - Intergenic
1009196654 6:60695018-60695040 TTGGATCTGTCATCAGATTCAGG + Intergenic
1009872184 6:69466948-69466970 TCAGCTCTCTCACCAGTGCCTGG - Intergenic
1010196833 6:73248101-73248123 CCAGACCTGGCATCAGGTCCTGG + Intronic
1010367280 6:75065901-75065923 TCAGATCTGTTATCCATTCTTGG - Intergenic
1011599583 6:89047771-89047793 TGAGGTCTGTCCTCAGTTCTGGG - Intergenic
1012799689 6:103809371-103809393 TCAGAACTGTATTCAGTCCCTGG - Intergenic
1019952707 7:4386418-4386440 TCTGCTCTATCATCAGTGCCTGG - Intergenic
1020634568 7:10680963-10680985 TCAGATCTGTCATCAGTCAAGGG - Intergenic
1025728010 7:64085680-64085702 TAACATCTGTCAGCAATTCCAGG - Intronic
1028419026 7:90611598-90611620 TCAGCTTTGTCATCTCTTCCTGG + Intronic
1028473567 7:91230206-91230228 TCACATCTGTCTTGAGTGCCAGG + Intergenic
1028753711 7:94410913-94410935 CCAGCTCTGCCATCAGCTCCAGG - Exonic
1029363708 7:100104174-100104196 TCCCATCTGTCCTCAGCTCCAGG - Intronic
1030840594 7:114348852-114348874 TCAGATCAGCCATCAGTGCGTGG + Intronic
1031716558 7:125115735-125115757 ACAAATCTGTCCTCAGTCCCAGG - Intergenic
1032496401 7:132366143-132366165 TCAGTTCTTTCCTCACTTCCAGG + Intronic
1033420184 7:141198676-141198698 CCAGATCTGTCTCCACTTCCTGG + Intronic
1036368145 8:8139098-8139120 TCAGATTTGACTTCAGTTCTAGG + Intergenic
1036882740 8:12526549-12526571 TCAGATTTGACTTCAGTTCTAGG - Intergenic
1037494307 8:19424141-19424163 TCAGCTCTCTCATCAGGACCTGG - Intronic
1040368318 8:46743408-46743430 GCAGATCTGAGTTCAGTTCCTGG + Intergenic
1044755274 8:95455102-95455124 TCAGATCCTTCTTCAGTTCAGGG + Intergenic
1046446234 8:114324096-114324118 ACAGATCTGTCCTCTGTCCCTGG - Intergenic
1046681623 8:117177021-117177043 TGACATCTCTCATCACTTCCTGG - Intergenic
1047054388 8:121147829-121147851 TCAGATCTGTCTTCAGTACTTGG + Intergenic
1048251351 8:132869247-132869269 TCAGTTCAGTCATCATTTCTGGG + Intronic
1048985429 8:139732349-139732371 ACAGATGTGTGACCAGTTCCTGG + Intronic
1049874549 8:145007858-145007880 TCAGAGCTGACAGCAGCTCCAGG - Intergenic
1050143047 9:2536706-2536728 TCAGATCTGAGATTAATTCCTGG - Intergenic
1050766288 9:9139155-9139177 TCAGAATTGTCTGCAGTTCCAGG - Intronic
1051031472 9:12685176-12685198 TCAGATCTGACATCTATGCCAGG - Intergenic
1053118729 9:35528874-35528896 TCAGGTCTGTCTTGAATTCCTGG - Intronic
1055365729 9:75542710-75542732 CCAAATCTATTATCAGTTCCTGG + Intergenic
1055708804 9:79036752-79036774 TCAGATTTCTCATCGATTCCAGG + Intergenic
1060682968 9:125581904-125581926 TCCTATCTGTCTTCAGTTCTGGG + Intronic
1203737229 Un_GL000216v2:148143-148165 TCACCTTTGTCATCAGTTCAGGG + Intergenic
1203737318 Un_GL000216v2:148962-148984 TCACCTTTGTCATCAGTTCAGGG + Intergenic
1203737525 Un_GL000216v2:150870-150892 TCACCTTTGTCATCAGTTCAGGG + Intergenic
1203738043 Un_GL000216v2:155655-155677 TCACCTTTGTCATCAGTTCAGGG + Intergenic
1203739111 Un_GL000216v2:163073-163095 TCACCTTTGTCATCAGTTCAGGG - Intergenic
1203739433 Un_GL000216v2:166068-166090 TCACCTTTGTCATCAGTTCACGG - Intergenic
1203739744 Un_GL000216v2:168855-168877 TCACCTTTGTCATCAGTTCAGGG - Intergenic
1203740441 Un_GL000216v2:172731-172753 TCACCTTTGTCATCAGTTCAGGG + Intergenic
1190249965 X:48715632-48715654 TGAGATCTGTGAGCAGTTCATGG - Intergenic
1190577146 X:51851437-51851459 TCAGTACTGTCAACAGTTTCAGG - Intronic
1191096310 X:56676285-56676307 TCAGATCTGAGTTCAATTCCTGG - Intergenic
1192802286 X:74478012-74478034 GCAGAGCTGAGATCAGTTCCTGG + Intronic
1196940439 X:120770600-120770622 TCAGATTTGTCTTCAGTTTCAGG + Intergenic
1199716160 X:150508600-150508622 TCAGGCCTGGCAGCAGTTCCTGG - Intronic
1202275221 Y:23111159-23111181 ACGGATCTGGCATCAGTCCCTGG - Intergenic
1202290807 Y:23309532-23309554 ACGGATCTGGCATCAGTCCCTGG + Intergenic
1202428212 Y:24744878-24744900 ACGGATCTGGCATCAGTCCCTGG - Intergenic
1202442579 Y:24925211-24925233 ACGGATCTGGCATCAGTCCCTGG + Intergenic