ID: 1115103071

View in Genome Browser
Species Human (GRCh38)
Location 14:29726527-29726549
Sequence GACACTTATGTCAATACAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 73}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115103069_1115103071 -2 Left 1115103069 14:29726506-29726528 CCTGGAACTGATGACAGATCTGA 0: 1
1: 0
2: 0
3: 17
4: 187
Right 1115103071 14:29726527-29726549 GACACTTATGTCAATACAGGTGG 0: 1
1: 0
2: 0
3: 3
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115103071 Original CRISPR GACACTTATGTCAATACAGG TGG Intronic
902106633 1:14042144-14042166 GAAAATTAGGTCAATCCAGGAGG - Intergenic
903196710 1:21694980-21695002 TACATATATGTAAATACAGGTGG + Intronic
909363645 1:74794602-74794624 GACACTTATGTCTATAAAAGAGG - Intergenic
909632519 1:77781873-77781895 GACACTTGTCTGAAAACAGGTGG + Intronic
917117693 1:171618904-171618926 GATACTCATGTCAAAAAAGGGGG - Intergenic
918061697 1:181067043-181067065 AACATTTATGTCAAGACATGAGG - Intergenic
920882124 1:209889716-209889738 CCCACTTATTTCTATACAGGAGG + Intergenic
922326253 1:224531153-224531175 GACACTGATGTGACTACAGCTGG - Intronic
923231648 1:231991846-231991868 GACATATATGTCCATACATGAGG - Intronic
924318681 1:242825180-242825202 CACACTCATGTCAATCCTGGAGG - Intergenic
924823438 1:247516152-247516174 AACACTCATGTCAATACGGCAGG + Intronic
1063310734 10:4949541-4949563 GACACCTATGTCAATATGGTTGG + Intronic
1063693259 10:8307401-8307423 CATTCTTATGTCAATGCAGGAGG + Intergenic
1064434980 10:15303506-15303528 GGCAGCAATGTCAATACAGGGGG + Intronic
1067151943 10:43743145-43743167 CACACTTATGTCGAGAAAGGTGG - Intergenic
1067514610 10:46927485-46927507 GTCACATATGTAAATTCAGGGGG - Intronic
1067647650 10:48124328-48124350 GTCACATATGTAAATTCAGGGGG + Intergenic
1072265177 10:93720358-93720380 GCCAATTATGTCAATACAGTGGG + Intergenic
1074167738 10:110899822-110899844 GACAGTTTTGTCATTACTGGTGG + Exonic
1079312280 11:19377595-19377617 GACACATATGTGAATATATGAGG + Intronic
1087671509 11:101112495-101112517 GCCACTTCTGTCCATACAGATGG + Intronic
1088574091 11:111252895-111252917 GACAATAATGTCAATGGAGGAGG - Intergenic
1090942339 11:131397932-131397954 GACAATTATGTCAGTACAAAGGG + Intronic
1091671315 12:2454077-2454099 GACACAAATGTCAAAACTGGAGG - Intronic
1092451590 12:8607399-8607421 GACACTTAGGTAAAGACTGGAGG - Intronic
1093295434 12:17384092-17384114 GAGACCTATGCCAATACTGGAGG - Intergenic
1109073365 13:57799583-57799605 GTCACTTATGTCACTACATTGGG + Intergenic
1113305188 13:109069855-109069877 AACACTTATCTCAATAGATGTGG + Intronic
1114433108 14:22679285-22679307 GGTACTTATCTCAACACAGGGGG - Intergenic
1115103071 14:29726527-29726549 GACACTTATGTCAATACAGGTGG + Intronic
1119893854 14:78203113-78203135 TACACTTATGTCCATAGAGAGGG + Intergenic
1125376960 15:39040337-39040359 GACACATATGTAAATGCATGAGG + Intergenic
1126970725 15:54109087-54109109 GAAACGTCTGTCATTACAGGAGG - Intronic
1127708102 15:61567204-61567226 GTCACTGATGTCTATACAGCAGG - Intergenic
1141673540 16:85505554-85505576 GACACTGATGCCCACACAGGTGG - Intergenic
1143301956 17:5917083-5917105 GAGAATTATTTGAATACAGGAGG - Intronic
1146439206 17:32878582-32878604 GACACTGATATCGAGACAGGTGG - Intergenic
1156361385 18:36387265-36387287 GACACTTTTGTCAAAAATGGGGG + Intronic
1159634269 18:70786252-70786274 GGCACATATGTCAATTGAGGAGG - Intergenic
1159696122 18:71558131-71558153 CACACTGATGTCAAAACTGGAGG + Intergenic
935102782 2:100012477-100012499 GACACTTAGGGAGATACAGGGGG - Intronic
935853075 2:107244136-107244158 TACACTTATGCAAAGACAGGAGG - Intergenic
941695319 2:168544773-168544795 GACACTTTTGTCAGTGCACGTGG + Intronic
945404893 2:209433447-209433469 GACACTTAAGTCAGAACAGAAGG + Intronic
949739424 3:7213557-7213579 GACACAGATGTATATACAGGAGG + Intronic
953155294 3:40365715-40365737 GACACTTATGTTAATACGTCAGG + Intergenic
953762416 3:45700056-45700078 TGCATTTATGTAAATACAGGTGG + Intronic
963255768 3:143143084-143143106 AACAATTATCTCAATACAAGAGG + Intergenic
970778103 4:19702028-19702050 GACACTTAACTCAGTACAAGAGG + Intergenic
975601169 4:76101024-76101046 GACATTTATGTAAATTCTGGGGG + Intronic
978892112 4:113842153-113842175 GACACTTATGAATTTACAGGTGG - Intergenic
979872664 4:125844664-125844686 GCCATTTATATCAATTCAGGAGG - Intergenic
985421941 4:189793291-189793313 GACACTTTACTCAATACAAGAGG + Intergenic
986004180 5:3654272-3654294 CACAATTATGAAAATACAGGAGG + Intergenic
990487753 5:56276063-56276085 GAGACCTATGTCAATACTGGGGG - Intergenic
1000791402 5:165612917-165612939 TCTACTTATGTCACTACAGGTGG + Intergenic
1004457994 6:15809413-15809435 GACACTTATATTTATACAAGGGG + Intergenic
1004813965 6:19292308-19292330 GACACTTTTGTTTGTACAGGTGG + Intergenic
1005063963 6:21800254-21800276 GACACTTTTTTAAAAACAGGGGG - Intergenic
1012924915 6:105258080-105258102 GACACTGAGGTCTAGACAGGTGG + Intergenic
1017633246 6:156419960-156419982 TACACTTTTGTCTACACAGGTGG + Intergenic
1020807114 7:12803797-12803819 GACACATATGTGAACACAGACGG + Intergenic
1022862761 7:34384964-34384986 TACACTTATATCTATACAGTAGG - Intergenic
1024577813 7:50779174-50779196 GACACTAAAGTGAACACAGGGGG + Intronic
1024685321 7:51738383-51738405 GACACTTCTGTCTGCACAGGAGG - Intergenic
1025858609 7:65305948-65305970 GACACCTCTGTCAATATAGTTGG + Intergenic
1029854696 7:103503735-103503757 GACACTGCTGTTAATACAGTGGG + Intronic
1032394201 7:131577458-131577480 GACACTGATGTCCAAAGAGGCGG + Intergenic
1044562014 8:93621652-93621674 GACACTGATGTAAATGAAGGAGG - Intergenic
1047562242 8:126000056-126000078 GACTCTTATGTCAGAAGAGGAGG + Intergenic
1050271589 9:3951662-3951684 GACACTGATTTTAATAAAGGGGG + Intronic
1052801079 9:32969002-32969024 GACACCTGTGTCAATACACTTGG - Intergenic
1054814213 9:69459293-69459315 GACAATTAGGTCAATTAAGGTGG + Intronic
1055669060 9:78582303-78582325 GACACTGATGTCTAGACCGGGGG + Intergenic
1055963623 9:81844072-81844094 GACAATTATTTCAATCCAGTGGG - Intergenic
1060601768 9:124882810-124882832 GGCACTCATGTCAACACAGAGGG - Intronic
1185995166 X:4938782-4938804 GTCACAGTTGTCAATACAGGAGG - Intergenic