ID: 1115103073

View in Genome Browser
Species Human (GRCh38)
Location 14:29726549-29726571
Sequence GACCTTAAGAAGCTACTGTC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 73}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115103069_1115103073 20 Left 1115103069 14:29726506-29726528 CCTGGAACTGATGACAGATCTGA 0: 1
1: 0
2: 0
3: 17
4: 187
Right 1115103073 14:29726549-29726571 GACCTTAAGAAGCTACTGTCGGG 0: 1
1: 0
2: 0
3: 7
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115103073 Original CRISPR GACCTTAAGAAGCTACTGTC GGG Intronic
904706659 1:32395910-32395932 GACCTTAAGAAAGTTATGTCAGG - Intergenic
907801480 1:57769998-57770020 GCCCTTAAGAAGCCAGTGTCTGG - Intronic
907827118 1:58029172-58029194 GACCTTGAGAGGTTAGTGTCTGG + Intronic
907882074 1:58559661-58559683 GCCCTGAAAAAGATACTGTCAGG + Intergenic
907898078 1:58711490-58711512 GCCCTTAAGAAGCTCATGGCTGG - Intergenic
911015656 1:93329479-93329501 GACCTTAAGAAACTAGTTTAAGG - Intergenic
912900291 1:113639993-113640015 GAGTTTAAGAAGCCACTGGCTGG - Intronic
914417280 1:147495631-147495653 AACCTCAAGAAGCAACTTTCAGG + Intergenic
917434717 1:175008833-175008855 GACCTTAAAAAGCAACTTGCTGG - Intronic
917535246 1:175869851-175869873 GACATGAAGAAGCTATTCTCAGG + Intergenic
1063291818 10:4757508-4757530 GACCAGAAGAAGCTTCTCTCTGG + Intergenic
1067064854 10:43097876-43097898 GACCTCAAGCAGCAACCGTCTGG + Intronic
1068180364 10:53510944-53510966 CACCTTAAGAAACTACAGGCCGG + Intergenic
1074267459 10:111918751-111918773 TCACTTAAGAAGCTACTGTTAGG + Intergenic
1079107133 11:17578780-17578802 CACCTTAACAGGCTACTGTGAGG + Intronic
1079457285 11:20647649-20647671 AACCTTGAGGAGCTACTGTGAGG - Intronic
1082259882 11:50070771-50070793 AGCCTTAAGAAGCCATTGTCAGG + Intergenic
1087716867 11:101618293-101618315 GACCTAAAAATGCTACTGTATGG - Intronic
1094293482 12:28877896-28877918 GGCATTAAGGATCTACTGTCTGG - Intergenic
1095277789 12:40309820-40309842 GTCCTTAAAAAGCTTGTGTCAGG + Intronic
1101901423 12:108793882-108793904 GACCTTGAGTAGCTGCTGGCTGG - Intronic
1104051924 12:125200800-125200822 GCCCTCAAGAAGCTACTCTTGGG - Intronic
1107483706 13:40806564-40806586 GAGCTTCAGAAGACACTGTCAGG - Intronic
1109961914 13:69642952-69642974 GACTTTAAGAAGCTACCTCCAGG - Intergenic
1112039680 13:95534297-95534319 AACCATATGAAGCTACTGCCAGG + Intronic
1113998558 14:16119644-16119666 TACCTCAAAAAGCTTCTGTCTGG - Intergenic
1115103073 14:29726549-29726571 GACCTTAAGAAGCTACTGTCGGG + Intronic
1118464922 14:66022384-66022406 GGCATTAAGGAGCTACTGACAGG + Intergenic
1120457942 14:84755820-84755842 GACCCTATGAAGCAAATGTCAGG + Intergenic
1120984754 14:90324758-90324780 GACCTTCAGAAGTTACTTACTGG + Intronic
1127159309 15:56164762-56164784 AACCTTAAGAACCAACTTTCTGG - Intronic
1127537069 15:59900184-59900206 GACCTTAAAAAGCTCCCCTCTGG + Intergenic
1127614125 15:60666558-60666580 CACCTTAAGAATGTACTGTGGGG + Intronic
1128291448 15:66481559-66481581 GAGTTCAAGAAGCAACTGTCAGG - Intronic
1130368711 15:83264376-83264398 GAAGTTAAGAAGCTGCTGTCAGG + Exonic
1131420908 15:92304607-92304629 AACCTTCAGGAGCAACTGTCTGG + Intergenic
1142157827 16:88540633-88540655 GACCTGCAGCAGCTTCTGTCTGG + Intergenic
1142906549 17:3046724-3046746 TTCCTTAAGAAGCTACTGGGGGG - Intergenic
1144485681 17:15662303-15662325 AAGCTTAAAAAGCTACTGTGGGG + Intronic
1150430919 17:65116467-65116489 TTCCTTAAGCACCTACTGTCAGG + Intergenic
928244835 2:29618095-29618117 GACCTTTAGAAGCTGCTCTTAGG + Intronic
930342407 2:50133500-50133522 GACCTAAAGAAGAGTCTGTCTGG - Intronic
931723185 2:65082402-65082424 GACATTCAGAAACTACTGCCAGG + Intronic
944633885 2:201655834-201655856 GACCTTAAGAATTTATTTTCAGG + Intronic
1171947786 20:31393662-31393684 GATCTCAAGAAGCCCCTGTCAGG + Intergenic
1173456111 20:43202993-43203015 GAGCGCAAGAAGCTACTGCCAGG + Intergenic
1174645024 20:52078395-52078417 GAGCTTGAGAAGCTGCTGTCAGG - Intronic
1176989013 21:15471904-15471926 GAGCTGAAGAATCTGCTGTCAGG + Intergenic
1178946810 21:36955105-36955127 GTCCTTCAGGAGCTACTGTGGGG + Intronic
1183672825 22:39283191-39283213 GCCCTTAAGAAGCTCAGGTCTGG + Intergenic
954092802 3:48298642-48298664 GGCCTTAAGATGAAACTGTCAGG - Intronic
957144437 3:76405209-76405231 AACCTTAAGAAGCTTCTGGCTGG - Intronic
969577525 4:8045289-8045311 GGCCTTCAGAGGCGACTGTCAGG + Intronic
971099847 4:23453282-23453304 GACTTTAAGTAGCTAATATCGGG - Intergenic
980085930 4:128390006-128390028 GACCTCAAGAAGGAAGTGTCTGG - Intergenic
984127138 4:175825514-175825536 TACATTAAGGAGCTAATGTCAGG + Intronic
984806596 4:183757379-183757401 CACCTTAAGAAACTACAGTTTGG + Intergenic
986957521 5:13171746-13171768 TACATCAAGAAGCTACTTTCTGG + Intergenic
987884533 5:23797127-23797149 GAACTAAAGAAGCTACAGGCCGG + Intergenic
994822592 5:104672887-104672909 GCAATTAAGAAGCTACTTTCAGG + Intergenic
996143178 5:119940193-119940215 TATCTTAAAGAGCTACTGTCAGG - Intergenic
998208785 5:140178026-140178048 GAACTTAAGACTTTACTGTCAGG + Intronic
1007893708 6:45324487-45324509 GAACTTAAGAATCTACTTTGAGG + Intronic
1014354472 6:120387777-120387799 TTCCTTAAGAATATACTGTCAGG + Intergenic
1015997652 6:139010980-139011002 GATCTTCAGAAGCTTTTGTCAGG - Intergenic
1024459151 7:49642321-49642343 GTCCTTAAGACGCTTCTCTCTGG + Intergenic
1030601026 7:111592405-111592427 AAGCTCAAGAAGCTACTGTATGG + Intergenic
1036154620 8:6329854-6329876 CACCTTAAGAAATTACTGTCAGG + Intergenic
1037418404 8:18675990-18676012 GACCATAAGGAGCTTCTGTGTGG - Intronic
1040501887 8:48012318-48012340 GAGGTTAAGAAGCTACTCTCGGG + Intronic
1040778604 8:51078038-51078060 GAACTTAAGAGGATACTTTCAGG + Intergenic
1042018770 8:64346899-64346921 CACCTTAAGAAGTTAGTGTGGGG + Intergenic
1045598081 8:103680017-103680039 GGCCTAAATTAGCTACTGTCTGG + Intronic
1045883808 8:107072110-107072132 GACCTTAAGAAGGAGCTGTTAGG + Intergenic
1046977199 8:120293554-120293576 GACTTTAAGAAGCTAGGGTCAGG + Intronic
1055702361 9:78959214-78959236 AACCTTAAGAAATTACTGCCAGG - Intergenic
1062162210 9:135086957-135086979 GACCTTATGCAGCTCCTGCCGGG + Intronic
1193475130 X:81954777-81954799 GAAATTTAGAAGCTACTGTTAGG + Intergenic
1197723380 X:129759893-129759915 GACCAGAAGAGGCCACTGTCAGG + Intronic
1198955627 X:142126301-142126323 GAGCTTCAGAAGGCACTGTCAGG - Intergenic
1201304707 Y:12540932-12540954 GACCCTGAGAAGTTACTGTTTGG + Intergenic