ID: 1115104385

View in Genome Browser
Species Human (GRCh38)
Location 14:29743096-29743118
Sequence TTTAAGCAAGATATTTTGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 694
Summary {0: 1, 1: 0, 2: 3, 3: 44, 4: 646}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115104383_1115104385 27 Left 1115104383 14:29743046-29743068 CCAATTTGCTTATAATCACAAGA 0: 1
1: 0
2: 3
3: 17
4: 192
Right 1115104385 14:29743096-29743118 TTTAAGCAAGATATTTTGAGAGG 0: 1
1: 0
2: 3
3: 44
4: 646

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115104385 Original CRISPR TTTAAGCAAGATATTTTGAG AGG Intronic
900708899 1:4098439-4098461 TTTCAGCATGAGATTTAGAGGGG + Intergenic
902160678 1:14527892-14527914 TTTCAGCATGAGATTTGGAGAGG + Intergenic
902356719 1:15907640-15907662 TTCAAGCAAATCATTTTGAGTGG - Intronic
903167538 1:21531428-21531450 TTTATGCAAGATACTTTTTGTGG + Intronic
903560979 1:24227203-24227225 TTTAAGGAATATATTTTGTAAGG - Intergenic
906016864 1:42589953-42589975 TTTCAGCAAGAGATTTGGAGAGG - Intronic
906554360 1:46696186-46696208 TTTGATGAAGATATTGTGAGTGG + Intronic
907019347 1:51050986-51051008 TTTAAGAAATATATTTTGTAAGG - Intergenic
908047782 1:60190299-60190321 TTTCAACATGATATTTGGAGGGG - Intergenic
908554550 1:65244834-65244856 TTTTAGAAAGATATTGTGAAAGG + Intergenic
909230967 1:73089572-73089594 TTTCAACATGATATTTGGAGAGG - Intergenic
909347205 1:74604513-74604535 TTTAAGGAATATATTTTGTAAGG - Intronic
909419240 1:75445081-75445103 TTTCAGCATGAGATTTGGAGTGG - Intronic
909597443 1:77422298-77422320 TTTCAGGAAGATAATTTGATGGG - Intronic
909989831 1:82210221-82210243 TTTCAACATGATATTTGGAGGGG - Intergenic
910271288 1:85397789-85397811 TTTCAGCATGAGATTTAGAGGGG - Intronic
910497673 1:87850834-87850856 TTAAAGCAAGGTATTTTAATAGG - Intergenic
910840006 1:91552389-91552411 TTTGATCAAGATATTTTGCTTGG + Intergenic
911187936 1:94922034-94922056 CTTAAGATAGATATTTTGACTGG - Intronic
911350342 1:96746157-96746179 TTTATGCAAGCGTTTTTGAGAGG + Intronic
911387957 1:97201236-97201258 TTAAAGTAAGAAATTTTAAGTGG - Intronic
911494027 1:98608307-98608329 TTTATGTAAGATAATTTGGGGGG + Intergenic
911559853 1:99391207-99391229 TTTAAAAAATATATTTTGAAAGG + Intergenic
911643885 1:100318713-100318735 TTTCAACATGATATTTGGAGAGG - Intergenic
911706094 1:101015216-101015238 TCTAAGAAATATATTTTGTGAGG - Intronic
912060470 1:105662138-105662160 TTTAAGCAAGATATTTCAAAAGG + Intergenic
913006796 1:114641378-114641400 TTTCAGCATGAGATTTGGAGGGG - Intronic
913076642 1:115345803-115345825 TTTCAACATGAGATTTTGAGGGG - Intergenic
913106672 1:115620998-115621020 TTTTTGAAAGATATTTTCAGTGG + Intergenic
913984679 1:143554089-143554111 TATTAGCAAGAAAATTTGAGAGG + Intergenic
914461618 1:147890757-147890779 TTTAAAAAAAATATTTTGGGGGG - Intergenic
914944921 1:152055696-152055718 TTTAAGCAAGACAGTTTCACAGG - Intergenic
914954266 1:152146927-152146949 TTTCAGCATGAAATTTGGAGGGG + Intergenic
914981956 1:152422832-152422854 TTTGAGGAAGATATTCTGGGAGG - Intergenic
916398732 1:164422261-164422283 TTTCAGCATGAGATTTGGAGGGG - Intergenic
917389639 1:174521191-174521213 TTAAAGAAAAATATTTTGATTGG + Intronic
918499243 1:185175633-185175655 TTTTAGGAAGATATTTTGGCAGG + Intronic
918827957 1:189351552-189351574 TTTTATCAAGAGATTTTAAGTGG + Intergenic
919039607 1:192366623-192366645 TTTAAAAAATATAATTTGAGAGG - Exonic
919434358 1:197538760-197538782 TTTCAACATGAGATTTTGAGAGG - Intronic
920424176 1:205860285-205860307 TTCAAGGAAAAGATTTTGAGGGG + Intergenic
920545199 1:206810724-206810746 TTTCAGCATGAGATTTGGAGGGG - Intronic
921102852 1:211945868-211945890 TTTCAGTAACATGTTTTGAGGGG - Intronic
921487588 1:215733376-215733398 TTTTAGCATGAGATTTAGAGAGG + Intronic
921730926 1:218577189-218577211 TTTCAGCATGAGATTTGGAGGGG - Intergenic
921755407 1:218849907-218849929 TTTAAGAAACGTATTTTAAGTGG + Intergenic
921822712 1:219635885-219635907 TTTATGTAAAATATTTTAAGCGG - Intergenic
922435678 1:225604154-225604176 TTTAAACAAGCTACTTTCAGTGG + Intronic
923756811 1:236798498-236798520 TTTAGCCAATATATTTTGTGGGG - Intronic
923898914 1:238304347-238304369 TTTCAACATGAAATTTTGAGGGG - Intergenic
1062909128 10:1200822-1200844 TTTAAGCACATTATTTAGAGTGG - Intronic
1063770090 10:9187684-9187706 GATAAGCAAGATATTGTAAGTGG + Intergenic
1063826228 10:9900785-9900807 TTTGGGAAAGAAATTTTGAGGGG + Intergenic
1063934405 10:11062320-11062342 TTTAAGAAACATATTTTGTAAGG + Intronic
1065692099 10:28345189-28345211 TTTCAGCATGAGATTTGGAGGGG - Intergenic
1068070385 10:52186524-52186546 TTTCAACATGATATTTGGAGGGG + Intronic
1068073953 10:52230767-52230789 TTTAAGCATTATCTTTTGATAGG - Intronic
1068712652 10:60151236-60151258 TTTCAACAAGAGATTTGGAGGGG - Intronic
1068787911 10:60997194-60997216 TTTAAAAAAGATATTTCGGGAGG - Intronic
1069557932 10:69409584-69409606 GTACAACAAGATATTTTGAGAGG + Intronic
1070539235 10:77404225-77404247 TTTCACTAAGATATTTTAAGAGG - Intronic
1070630586 10:78081906-78081928 TTTACCCAAGATAGTTTGAGTGG + Intergenic
1071006617 10:80890874-80890896 TTTCAGCATGAGATTTGGAGGGG - Intergenic
1071263318 10:83940828-83940850 TTGAAGCAAGGTTTTTGGAGAGG - Intergenic
1072151181 10:92685756-92685778 TTTAAGAAATATATTTTGTAAGG + Intergenic
1072811305 10:98464257-98464279 TTTAAGGAATAGATTTTGAAAGG + Intronic
1073155277 10:101341597-101341619 ATCAAGAAACATATTTTGAGAGG - Intergenic
1073374793 10:103023678-103023700 TTTCAACAAGAGATTTGGAGGGG + Intronic
1073737755 10:106369051-106369073 TTTAAACCACATATTTTTAGGGG + Intergenic
1073959978 10:108914198-108914220 TTTCAGCCATATATTTTGACAGG - Intergenic
1074255987 10:111803130-111803152 GTTAAGCAAGATATAATCAGTGG + Intergenic
1074397491 10:113109700-113109722 TTTAAGTGAGATATTATGAAAGG + Intronic
1074616178 10:115070591-115070613 TGTAAGAAAGATGATTTGAGGGG - Intergenic
1074959846 10:118433259-118433281 TTTCAACATGACATTTTGAGGGG + Intergenic
1075225221 10:120622812-120622834 TTTAAGAAAGACATTTTGTAAGG + Intergenic
1075247647 10:120837906-120837928 TTTCAACAAGAGATTTGGAGGGG + Intergenic
1075750280 10:124763581-124763603 TTTAAGCAAAATATTATAATGGG - Intronic
1078228878 11:9420484-9420506 TTTTAGCAAGACTTTTTGAAAGG + Exonic
1078490221 11:11761467-11761489 TTTAAGGAAGAAAGTGTGAGTGG - Intergenic
1078868285 11:15319557-15319579 TTTAACCAATAGATTTTGATTGG + Intergenic
1080422184 11:32120291-32120313 TTTCAGCGTGATATTTGGAGGGG - Intergenic
1080577773 11:33615611-33615633 TTTAAGCTGTATATTTTAAGGGG + Intronic
1080953442 11:37064381-37064403 TTTTAGCATGAGATTTAGAGGGG - Intergenic
1081124979 11:39311629-39311651 ATAAAGCAAGTTCTTTTGAGAGG + Intergenic
1081250017 11:40818046-40818068 TTTAAACAAGATTTCTTAAGTGG + Intronic
1081297128 11:41405324-41405346 TTTAAGCAAGAAAATTGGATGGG - Intronic
1082212086 11:49517568-49517590 TATAAACAACACATTTTGAGAGG + Intergenic
1082287308 11:50331380-50331402 TTTAGGCAATACATTATGAGTGG - Intergenic
1082681175 11:56172992-56173014 TTTAAAAAATATTTTTTGAGGGG + Intergenic
1085087168 11:73676963-73676985 TTTAAGCAATAGATTTTGCTTGG - Exonic
1085619130 11:78024081-78024103 TGGAAGCAAGATATTTTGTTGGG + Intronic
1086514931 11:87600697-87600719 TTTAAGCACAATATTTGGGGAGG - Intergenic
1086641549 11:89164017-89164039 TTAAATAAAGGTATTTTGAGGGG - Intergenic
1086734647 11:90290763-90290785 TTTAGGCAAGAGATAATGAGGGG + Intergenic
1087118861 11:94551922-94551944 TTTAACCAACATTTTTCGAGTGG + Intronic
1088025775 11:105180540-105180562 TTCAAGAAGAATATTTTGAGAGG - Intergenic
1088294809 11:108281231-108281253 TTAAAGCTAGATTTTCTGAGTGG + Intronic
1088439598 11:109854903-109854925 TTTAAGCAATATATTTCATGAGG - Intergenic
1088522629 11:110715548-110715570 TTTAAGGAAGATACTCTGATGGG + Intergenic
1088659418 11:112030403-112030425 TTTCAGCATGAGATTTGGAGGGG + Intronic
1088765377 11:112970459-112970481 ATTAAGCAAGATACTTTCATTGG - Intronic
1089336326 11:117726329-117726351 ATTAAGCCAGATATTCTGTGTGG + Intronic
1089422956 11:118345424-118345446 TTTCAGCAGGGTATTGTGAGTGG + Intronic
1089934027 11:122344963-122344985 TTTAAGAAAAATATTTAGAGTGG - Intergenic
1090022562 11:123140812-123140834 TTTCAGCATGAGATTTGGAGGGG - Intronic
1090146107 11:124324772-124324794 TTTAATTAAAATATTTTCAGTGG - Intergenic
1090258010 11:125299299-125299321 TTTCAGCATGAGATTTGGAGGGG + Intronic
1090680710 11:129054268-129054290 TTTACGGAAGATTTTCTGAGGGG + Intronic
1090860359 11:130647498-130647520 TTTCAGCATGAGATTTGGAGAGG + Intergenic
1091255946 11:134185743-134185765 TTTAAGGAATATTTTATGAGGGG - Intronic
1091644701 12:2264758-2264780 TTTAAGCAAGATATCTCTTGAGG - Intronic
1092518282 12:9238960-9238982 CTTAAACAAGTTATTTTAAGAGG - Intergenic
1092559964 12:9601988-9602010 TTTAGTCAAGATATTTTTTGAGG + Intronic
1092890343 12:12963960-12963982 TTTACGCAACACATTTTTAGGGG + Intergenic
1093102108 12:15039645-15039667 TTTGAAGAATATATTTTGAGGGG + Intergenic
1093284630 12:17243477-17243499 TTTAAGCAAGATATAATGAAAGG + Intergenic
1093541300 12:20288790-20288812 TTTAAGAAATATATTTTGTAAGG + Intergenic
1093879273 12:24384776-24384798 TTTAAGCTCAATACTTTGAGGGG - Intergenic
1094410343 12:30161544-30161566 TTTAACCAACGTATTTAGAGAGG + Intergenic
1094762040 12:33545021-33545043 TTTAAACATGAGATTTGGAGGGG + Intergenic
1095165130 12:38963371-38963393 TCTAAGAAAGATATTTTGAGGGG - Intergenic
1095167013 12:38985171-38985193 TTTCAGCATGAGATTTGGAGGGG - Intergenic
1095530162 12:43177810-43177832 TTTCAACATGATATTTGGAGGGG - Intergenic
1096404329 12:51332298-51332320 TCTAACCAAAATATTTTGAGAGG + Intronic
1097487591 12:60225092-60225114 TTTCAACAAGAGATTTGGAGGGG + Intergenic
1097612030 12:61835346-61835368 TTTGAAAAAGATATTTTGGGGGG + Intronic
1097642169 12:62195465-62195487 TTTAAGAAATATATTTTGCTAGG - Intronic
1098075089 12:66721009-66721031 TTTAAGAAATATATTTTGTAAGG - Intronic
1098178528 12:67819879-67819901 TTTAACAAAAATTTTTTGAGTGG + Intergenic
1098385721 12:69916593-69916615 TTTAAGGAAGATAATTTTATTGG - Intronic
1098507577 12:71271907-71271929 TTTCATCATGAGATTTTGAGGGG + Intronic
1099203957 12:79707063-79707085 TTTCAACATGATATTTAGAGAGG + Intergenic
1099493777 12:83319209-83319231 TTGAAGGAATATATTTTGATTGG - Intergenic
1099540974 12:83907363-83907385 TTTCAACATGAAATTTTGAGGGG - Intergenic
1099854991 12:88152454-88152476 TTTCAGCATGAGATTTGGAGGGG + Intronic
1099902318 12:88727131-88727153 TTTCAACATGAGATTTTGAGGGG - Intergenic
1099983894 12:89640631-89640653 TTTCAGCATGAGATTTGGAGGGG - Intronic
1100050250 12:90440181-90440203 TTTAAGAAATACATTTTGTGGGG + Intergenic
1100257125 12:92895684-92895706 TTTAAGAAATATATTTTGTAAGG + Intronic
1100337738 12:93648014-93648036 TTTCAGCATGAGATTTGGAGGGG - Intergenic
1100446558 12:94665951-94665973 TTTAAGTTAAATGTTTTGAGAGG - Intergenic
1101299076 12:103459299-103459321 TTTAAACATGAGATTTGGAGGGG - Intronic
1101558035 12:105829533-105829555 TATAAGCTAGCTATTGTGAGTGG + Intergenic
1101778608 12:107816027-107816049 TTTCAGCATGATTTTTGGAGGGG - Intergenic
1102158936 12:110753116-110753138 TTTAAGAAAGATATTTTAGGCGG + Intergenic
1102234600 12:111286406-111286428 TTTAAAAAAGATATTGAGAGAGG - Intronic
1102307428 12:111816009-111816031 TTTTAACATGAGATTTTGAGGGG - Intergenic
1102489784 12:113283244-113283266 TTTAAGACAGATATATTGATAGG - Intronic
1102879105 12:116470646-116470668 TTTAAAAAAAATATTTTTAGAGG + Intergenic
1103088159 12:118078039-118078061 TTTAAACATGAGATTTGGAGGGG - Intronic
1105254320 13:18731333-18731355 TTTCAGCATGAGATTTGGAGGGG + Intergenic
1106000396 13:25717650-25717672 TTTAATGAAGAAATTTTGAAGGG + Intronic
1106084791 13:26531702-26531724 TTGAAGGAGGATATTTTGAAGGG + Intergenic
1106484870 13:30163132-30163154 TTTTAACATGAGATTTTGAGGGG + Intergenic
1106593288 13:31116221-31116243 TCGAAGCAAGAGATTTTGAGAGG + Intergenic
1106947829 13:34848477-34848499 TTTCAGCATGAGATTTGGAGAGG - Intergenic
1107503141 13:41001693-41001715 TTAAAGCAGAATATTTTGAGGGG - Intronic
1108445213 13:50501673-50501695 TTTCAGCATGAGATTTGGAGGGG + Intronic
1108549144 13:51525822-51525844 TTTCAGCATGAGATTTGGAGGGG + Intergenic
1108727016 13:53193857-53193879 TTTAAGGAAGAAAATGTGAGAGG - Intergenic
1108770340 13:53693312-53693334 TTTCAACATGATATTTGGAGAGG - Intergenic
1109145567 13:58774552-58774574 TTAAAGCAAGATATTTTGAAAGG - Intergenic
1109269063 13:60234106-60234128 GTAAAATAAGATATTTTGAGAGG - Intergenic
1109513175 13:63405550-63405572 TTTCAGCATGAGATTTAGAGAGG + Intergenic
1109853446 13:68099375-68099397 TTTAAGAAATATATTTTGTAAGG - Intergenic
1109953362 13:69532076-69532098 TTTAATAAATATATTTTGAAAGG + Intergenic
1109964707 13:69676743-69676765 TATCAGCAAAATAGTTTGAGGGG + Intergenic
1110334350 13:74309327-74309349 TTCAACATAGATATTTTGAGAGG + Intergenic
1110771288 13:79350353-79350375 ATTCAGCAAGATAATTTGAACGG + Intronic
1111179951 13:84651399-84651421 TTTCAACAAGAGATTTGGAGGGG - Intergenic
1111205624 13:85006068-85006090 TTTAAGAAAATTATTTTAAGAGG - Intergenic
1111217632 13:85164581-85164603 TTTCAACATGATATTTTTAGGGG + Intergenic
1111824977 13:93256390-93256412 TTTAAGTAAAATATTTTAAGAGG - Intronic
1112320020 13:98397224-98397246 TTTCACCAAGAGATTCTGAGAGG - Intronic
1112552581 13:100435383-100435405 TTTCAGCAAGAGATTTGGAGCGG + Intronic
1113012383 13:105784621-105784643 TTTCAGCATGAGATTTGGAGGGG - Intergenic
1113826395 13:113257683-113257705 TTTCAGCATGAGATTTTGAGGGG + Intronic
1114038859 14:18657442-18657464 TTTAAGCAATAGATTTTGCTTGG - Intergenic
1114128006 14:19753234-19753256 TATAAGCCAGAAATTTTGGGAGG - Intronic
1114599367 14:23941981-23942003 TTTCAGCATGAGATTTGGAGGGG + Intergenic
1114689272 14:24565018-24565040 TTTAAACATGAGATTTAGAGGGG + Intergenic
1114772018 14:25438871-25438893 TTACAGCATGATATTTAGAGGGG - Intergenic
1114848140 14:26348815-26348837 TTTCAACATGAGATTTTGAGGGG - Intergenic
1114927418 14:27421550-27421572 TTTCAACATGAGATTTTGAGGGG + Intergenic
1115104385 14:29743096-29743118 TTTAAGCAAGATATTTTGAGAGG + Intronic
1115286169 14:31714714-31714736 TTTCAGCATGAGATTTGGAGGGG + Intronic
1115507039 14:34102646-34102668 CTTAAGTTGGATATTTTGAGGGG - Intronic
1115903731 14:38183936-38183958 TGTAAGCTAGATCTCTTGAGGGG + Intergenic
1116651824 14:47603725-47603747 TTTCAACATGATATTTAGAGGGG - Intronic
1116669784 14:47826539-47826561 TATAACCAAAATATTTTTAGTGG + Intergenic
1116986442 14:51224653-51224675 ATTAGGGAACATATTTTGAGGGG + Intergenic
1117635330 14:57736995-57737017 TTTATGCAAGATATCTCAAGGGG + Intronic
1117858339 14:60060409-60060431 TTTAAGAAATATATTTTGTAAGG + Intronic
1117860270 14:60083880-60083902 TTTAAGCAATATCTTTTGATGGG + Intergenic
1119120724 14:72074090-72074112 TTAAATCAAGATATTTGCAGAGG + Intronic
1119145213 14:72306415-72306437 TTTAAGAAATATACTTTGTGAGG + Intronic
1119960185 14:78847183-78847205 TTTAAGCAAGATATACTCTGGGG - Intronic
1119964466 14:78898715-78898737 TTTAAGCAAATTATCTTGATTGG + Intronic
1120574862 14:86169511-86169533 TTTCAACATGATATTTGGAGGGG - Intergenic
1121464613 14:94106961-94106983 TTTTAGCACGAGATTTGGAGGGG + Intronic
1121482080 14:94286726-94286748 TTCAAGCAACATATTTTCAAAGG - Intronic
1121596589 14:95168038-95168060 TTTCAGCATGAGATTTGGAGAGG - Intergenic
1122058376 14:99120512-99120534 GTTTAGCAAGATATTTTTGGTGG - Intergenic
1123172267 14:106385315-106385337 TTTCACCATGATATTTGGAGGGG + Intergenic
1123720845 15:23060854-23060876 TTTCAACATGATATTTGGAGGGG + Intergenic
1124571909 15:30872499-30872521 TTTCAGCATGAGATTTGGAGGGG - Intergenic
1126509357 15:49450562-49450584 ATTAAGCATCATATTTTCAGGGG - Intronic
1126585873 15:50286457-50286479 TTTAACGAGCATATTTTGAGAGG + Intronic
1126658604 15:51008482-51008504 TTTCAGCATGAGATTTGGAGGGG + Intergenic
1126939433 15:53750559-53750581 TTTAAGCTATACATTTTGTGAGG + Intronic
1126978071 15:54208313-54208335 TTTCACCATGAGATTTTGAGGGG + Intronic
1127375889 15:58384023-58384045 TTTCAGCATGAGATTTGGAGGGG - Intronic
1127550066 15:60028698-60028720 ATTAAGGAAGATATTGTGAATGG + Intronic
1127688531 15:61371960-61371982 TTTCAACAAGAGATTTGGAGGGG + Intergenic
1127712358 15:61612397-61612419 TTCAGACAAGCTATTTTGAGAGG - Intergenic
1128218625 15:65952013-65952035 TTTTTTAAAGATATTTTGAGAGG + Intronic
1128624928 15:69191290-69191312 TTTCAGAAAGATATTTTTACTGG + Intronic
1128663542 15:69521539-69521561 TTATAGGAAGATATGTTGAGAGG + Intergenic
1129506155 15:76083131-76083153 TTTCAGCATGAGATTTGGAGAGG + Intronic
1129948911 15:79568513-79568535 TTTAAGAAACATATTTTGTAAGG + Intergenic
1131619588 15:94053647-94053669 TTTCAACATGATATTTGGAGGGG - Intergenic
1131929840 15:97429614-97429636 ATTCAGCATGAGATTTTGAGGGG - Intergenic
1133640989 16:7717195-7717217 TTTAAGGCAGATTTTTGGAGGGG - Intergenic
1134146429 16:11767509-11767531 TGTAAGAAAGATATTTTAATCGG - Exonic
1135309497 16:21394392-21394414 TGTAATCATCATATTTTGAGGGG + Intergenic
1135530253 16:23246943-23246965 TTTCAGCACGAGATTTGGAGGGG - Intergenic
1135972639 16:27083818-27083840 TTTGTCCCAGATATTTTGAGTGG - Intergenic
1136005920 16:27328977-27328999 TTTCAACAAGAGATTTAGAGAGG - Intronic
1136306241 16:29373516-29373538 TGTAATCATCATATTTTGAGGGG + Intergenic
1137303167 16:47173405-47173427 TTTAACAAAAATATATTGAGTGG - Intronic
1139030763 16:62878116-62878138 GAAAAGCAAGATATTTGGAGAGG - Intergenic
1139180579 16:64743398-64743420 TTTAAGCCAGATAGTTGGGGGGG - Intergenic
1140549024 16:75843685-75843707 TTTAAGCAATACATTTTGTAAGG - Intergenic
1140806639 16:78538053-78538075 TTCCAGCATGGTATTTTGAGCGG + Intronic
1143214290 17:5212772-5212794 CTTAAGAAAAATATTTTGATTGG - Intronic
1143441124 17:6975058-6975080 TTTCAGCATGAGATTTGGAGGGG - Intronic
1145818765 17:27814933-27814955 TTTCAGCATGAGATTTGGAGGGG + Intronic
1146442814 17:32912077-32912099 TTAAAGCAAGATATTTCTATTGG + Intergenic
1146668267 17:34719484-34719506 TTGAAGCCAGAAATTTTGAGGGG + Intergenic
1147058809 17:37857178-37857200 TTTAAGAAATACATTTTGAAAGG - Intergenic
1148654910 17:49276120-49276142 TTTAAGAAAGATATCATGGGAGG + Intergenic
1149192163 17:54076091-54076113 TTTAAGAAATATATTTTGTAAGG + Intergenic
1149518318 17:57298179-57298201 TTTAAGAAACATATTTTGTAAGG - Intronic
1149989349 17:61372773-61372795 ATTAGTCAAGTTATTTTGAGGGG - Intronic
1150194426 17:63280634-63280656 TTTAAACAAGTCATTTTTAGTGG - Intronic
1150386183 17:64763101-64763123 TTTTAGGAATATATTTTGGGGGG - Intergenic
1150428238 17:65094228-65094250 TTTCAGCATGAGATTTGGAGGGG + Intergenic
1150531163 17:65983415-65983437 TTTCAACATGATATTTGGAGGGG - Intronic
1151102410 17:71571256-71571278 TTTCAGCATGAGATTTGGAGGGG - Intergenic
1151971569 17:77460111-77460133 TTTCAGCATGAGATTTGGAGGGG + Intronic
1153133093 18:1880298-1880320 TTTAAGAAATATATTTTGTAAGG - Intergenic
1153512626 18:5872178-5872200 TTTAATCAACATATTTTCATTGG - Intergenic
1153543552 18:6182879-6182901 TTTAAATAAGTTATTTTCAGTGG - Intronic
1153874280 18:9352864-9352886 TTTATGCAAAATAAATTGAGGGG - Intronic
1154436705 18:14349290-14349312 TTTCAGCATGAGATTTGGAGGGG - Intergenic
1154985198 18:21544304-21544326 TTTAAGCAATACATATTTAGAGG + Intronic
1155677179 18:28443026-28443048 TTTCAGCATGAGATTTGGAGGGG + Intergenic
1155741347 18:29291808-29291830 TTTAAGAAATACATTTTGTGAGG + Intergenic
1155853788 18:30806377-30806399 TTTAAGAAATATATTTTGTAGGG + Intergenic
1155998552 18:32358592-32358614 TTTAAGGAAGACATTTGGTGTGG - Intronic
1156358187 18:36360793-36360815 TTCAAACCTGATATTTTGAGAGG - Intronic
1156659439 18:39329448-39329470 TGCAAGAAGGATATTTTGAGAGG + Intergenic
1157000725 18:43520938-43520960 TTTAAGTAATTTATTTTGATGGG + Intergenic
1158590668 18:58776161-58776183 TTTCAACATGAGATTTTGAGCGG - Intergenic
1158735267 18:60072513-60072535 TTTTAACATGATATTTGGAGTGG + Intergenic
1158904664 18:62000575-62000597 TTTCAATAAGAGATTTTGAGGGG + Intergenic
1159188899 18:65016631-65016653 TGTAATCAAGATATTTAAAGAGG - Intergenic
1159293820 18:66455173-66455195 AATAAGCAAAATATTTTCAGTGG - Intergenic
1159321837 18:66861160-66861182 TTTAACAAAGATGTTTTGAAAGG + Intergenic
1159372355 18:67544746-67544768 TTTCAACAAGAAATTTGGAGGGG + Intergenic
1159605150 18:70467147-70467169 TTTTAGCAATATATTGTGAAAGG - Intergenic
1163853934 19:19684526-19684548 TTTCAACAAGAGATTTGGAGAGG + Intergenic
1164072529 19:21781462-21781484 TTGAAGCAAGATATAAAGAGTGG + Intergenic
1164215930 19:23148015-23148037 TTTAAGTGATTTATTTTGAGTGG + Intergenic
1165579396 19:36849323-36849345 TTTAAGCTAGAAACTTTGGGAGG - Intronic
1168588738 19:57615336-57615358 TTCAAGGAAGTTATTTTGTGTGG + Intronic
925477404 2:4232828-4232850 TTTAAGATAAATATTTTAAGTGG + Intergenic
926284681 2:11479132-11479154 TTTAAGCAAGCTAGGTGGAGGGG + Intergenic
926834927 2:17008260-17008282 TTTAAGAAATATATTTTGTAAGG + Intergenic
926841647 2:17087810-17087832 TTTAAGAAATATATTTTGTAAGG - Intergenic
926844017 2:17113696-17113718 TTTAACCAATATGTTTTGAGTGG - Intergenic
927912066 2:26906724-26906746 TTTAAGCAAAATAGGTGGAGTGG - Intronic
928556875 2:32435937-32435959 TCTAAGTATGATATTTTGTGTGG + Intronic
928704990 2:33940152-33940174 TTTCAACATGATATTTTGAGAGG - Intergenic
929695799 2:44114142-44114164 ATTTTGAAAGATATTTTGAGAGG - Intergenic
929846946 2:45540552-45540574 TTTAAACAGGATCTTTTGAATGG - Intronic
930094893 2:47559458-47559480 ATTAATCAACATATGTTGAGTGG - Intronic
930899595 2:56487743-56487765 TTTAAGAAATACATTTTGAAAGG + Intergenic
931056809 2:58481698-58481720 TTTCAGCATGATATTTGAAGGGG + Intergenic
932155160 2:69409879-69409901 TTTCAGCATGATATTTGGAGGGG + Intronic
932187279 2:69709072-69709094 TTAAAGCAACATGTTTTGCGAGG - Intronic
932943418 2:76197161-76197183 TTTATGGAAGGTATTTTGATAGG - Intergenic
933541695 2:83651984-83652006 TTTAAGAAAGATACATAGAGAGG + Intergenic
933703322 2:85271846-85271868 TTTTAGAAAGATATTTCTAGAGG + Intronic
934489281 2:94748219-94748241 TTTCAGCATGAGATTTGGAGGGG + Intergenic
934865574 2:97807260-97807282 TTTCAGCATGAGATTTAGAGGGG - Intronic
934914137 2:98284975-98284997 TATATGCAAAATATTATGAGTGG + Intronic
934944334 2:98527028-98527050 TTTCAGCATGAGATTTGGAGGGG + Intronic
935792247 2:106603266-106603288 TTTCAGCATGAGATTTGGAGGGG + Intergenic
936611237 2:114004194-114004216 TTTCAGCATGAGATTTGGAGGGG - Intergenic
936635527 2:114252243-114252265 TTTCAGCATGAGATTTAGAGGGG - Intergenic
936702224 2:115025834-115025856 TTTTAATAAGATATTTTGTGGGG + Intronic
936721613 2:115257619-115257641 TCTGAGCATGATATTTGGAGAGG + Intronic
937170176 2:119857859-119857881 TTTCAGCATGAGATTTGGAGGGG - Intronic
937174109 2:119909605-119909627 TTTAAGAAACATATTTTGTAAGG + Intronic
937189049 2:120075495-120075517 TTAAAACAAGATATTCTCAGTGG + Exonic
937462954 2:122104971-122104993 TTTAAACACGAGATTTGGAGGGG + Intergenic
937848463 2:126608763-126608785 TTTTAGAAAGATATTTTCACTGG - Intergenic
938057263 2:128225657-128225679 TTTCAGCATGAGATTTGGAGAGG - Intergenic
938130000 2:128707043-128707065 TTTTAACAAGAGATTTGGAGGGG + Intergenic
938443910 2:131362168-131362190 TTTAAGCAATAGATTTTGCTTGG - Intergenic
938712103 2:133983775-133983797 TTTTAGCATGAGATTTGGAGGGG + Intergenic
938874625 2:135519588-135519610 TTTAAAATAGATATTTTCAGTGG - Intronic
939184767 2:138847341-138847363 CTTCAGCAAAAGATTTTGAGAGG - Intergenic
939929122 2:148209954-148209976 TTTCAACATGAGATTTTGAGAGG + Intronic
940484692 2:154282687-154282709 TTTAAACAAAATATTTTGCATGG - Intronic
940529727 2:154866042-154866064 ATAAAGCAAGCTATATTGAGGGG + Intergenic
940880440 2:158941654-158941676 TTTAGGAAATATATTTTGTGAGG + Intergenic
941071867 2:160964456-160964478 TTTAAGCAAGGTACTCTGATGGG + Intergenic
941097864 2:161261284-161261306 TTTCAACATGATATTTGGAGGGG - Intergenic
941351079 2:164437747-164437769 TTTAAGCAAGATACTCAGAAAGG + Intergenic
941371198 2:164667053-164667075 TTTAAGAAATACATTTTGTGGGG - Intronic
942525972 2:176853364-176853386 TTGTAGCAAGATTTTTTAAGAGG + Intergenic
942721515 2:178958346-178958368 TGTAAACAAGCTATTCTGAGGGG + Intronic
942793239 2:179785401-179785423 TTTAAGAAATACATTTTGAAAGG + Intronic
943042051 2:182815085-182815107 ATTAAGCAATATATTTTGTTTGG + Intergenic
943084047 2:183290715-183290737 TTTAAGAAATATATTTTGTAAGG + Intergenic
943113655 2:183639260-183639282 ATTATGCAGGATATTTTGAAAGG + Intergenic
943117191 2:183687886-183687908 TTTTTTCAAGATAGTTTGAGTGG + Intergenic
943152237 2:184129421-184129443 TTAAAGCAAAATCTTTTGAAGGG - Intergenic
943440860 2:187925914-187925936 TTTAACCAAAATATTTTGCTAGG + Intergenic
943599307 2:189894812-189894834 TTGAAATAAGATATTATGAGAGG - Intronic
943606970 2:189987452-189987474 TATAAGTAAGATCTTGTGAGAGG + Intronic
943926967 2:193797086-193797108 GTTAAGCAAAATATTTTTAAAGG - Intergenic
944181016 2:196894317-196894339 TTCATGCATCATATTTTGAGGGG - Intronic
945299474 2:208202302-208202324 TTTAAGGAAGATATTTCCAAGGG + Intergenic
945315998 2:208371149-208371171 TTTCAACATGACATTTTGAGGGG + Intronic
945668321 2:212770253-212770275 TTTAAACATGAGATTTGGAGAGG - Intergenic
945716421 2:213362933-213362955 TTTCAACAAGAGATTTGGAGAGG + Intronic
945992828 2:216410900-216410922 TCAAAGCAAGGTATTATGAGGGG - Intergenic
946066375 2:216991019-216991041 TTTCAGCATGAGATTTGGAGAGG - Intergenic
946515107 2:220403086-220403108 TTTCAGCATGAGATTTGGAGGGG - Intergenic
946642560 2:221800138-221800160 TTCAAGCACCATATTTTAAGAGG + Intergenic
946802653 2:223436773-223436795 TTTTAGAGAGAAATTTTGAGGGG - Intergenic
948244427 2:236466793-236466815 TTTCAGCATGAGATTTGGAGGGG + Intronic
1168868672 20:1110388-1110410 TTTCAGCAGGAGATTTGGAGGGG - Intergenic
1169336805 20:4763503-4763525 TTAAAGGAAGGGATTTTGAGAGG - Intergenic
1170480143 20:16757024-16757046 TTTAAACATGAGATTTGGAGGGG + Intronic
1170627722 20:18042326-18042348 TTTCAACAAGACATTTGGAGGGG - Intronic
1170922476 20:20691821-20691843 TTTCAACAAGAGATTTGGAGGGG - Intronic
1171323726 20:24271475-24271497 TTTAAGAAATATATTTTGTAAGG - Intergenic
1172236592 20:33380456-33380478 TTTAAGCCAGACACTTTGGGAGG - Intronic
1172968306 20:38855057-38855079 TTTAAGTCATATATTATGAGGGG - Intronic
1173065235 20:39704241-39704263 TTTTAGAAAGATAATTTGAGAGG + Intergenic
1174692460 20:52520791-52520813 TTTAAGAAATATATTTTGGAAGG - Intergenic
1174986127 20:55454451-55454473 TTCTAGCTAGAAATTTTGAGGGG - Intergenic
1175622498 20:60460949-60460971 TTTAAACATGAGATTTGGAGGGG - Intergenic
1176602567 21:8806676-8806698 CTTAAGCAAGAGATTCTGAGAGG + Intergenic
1176840333 21:13836364-13836386 TTTCAGCATGAGATTTGGAGGGG + Intergenic
1177073412 21:16541455-16541477 TTCAAGCAAAATAATTTGATTGG + Intergenic
1177407079 21:20683792-20683814 TTTCAACAAGAGATTTTCAGGGG - Intergenic
1178310417 21:31525516-31525538 TTTCAGCATGAGATTTGGAGGGG + Intronic
1178455712 21:32748397-32748419 CTTAAGCAAAATATTTTGCAGGG - Intronic
1178609691 21:34070136-34070158 TTCAAGTAAGTTTTTTTGAGGGG - Intergenic
1178758879 21:35381184-35381206 TTTAAGCAAGAAGTTTTGCTAGG - Intronic
1179205927 21:39278370-39278392 TTTCATCAAGATATTATGTGTGG + Intronic
1180344853 22:11698229-11698251 CTTAAGCAAGAGATTCTGAGAGG + Intergenic
1181661594 22:24354216-24354238 TTTGAGCATGAGATTTGGAGGGG + Intronic
1181674002 22:24440253-24440275 TTAACGCATGATTTTTTGAGGGG - Intronic
1181842113 22:25672567-25672589 TTTATGTAAGATATTTTAAGAGG + Intronic
1183083139 22:35469937-35469959 TTTAAGCAAGAGAGCTGGAGAGG + Intergenic
1183757960 22:39788140-39788162 TTTAAGAAATATATTTTGTAAGG + Intronic
1183775515 22:39961787-39961809 TTTATTCAATATATTTTGAAAGG + Intronic
1184032129 22:41901279-41901301 TTCAAGCTAGATATTGTCAGTGG + Intronic
1184718439 22:46295452-46295474 TTTCAACATGAGATTTTGAGGGG + Intergenic
949523536 3:4879544-4879566 TTTCAGCAAATTATTTTGTGTGG - Intronic
949716596 3:6938990-6939012 TTTAAGCAAGAGATCGAGAGGGG - Intronic
949984501 3:9529441-9529463 TTTAAGAAATACATTTTGAAAGG - Intronic
950057892 3:10042208-10042230 TTTAAGCAGTAAGTTTTGAGTGG + Intronic
951226238 3:20124596-20124618 TTTCAGCATGAGATTTGGAGGGG + Intronic
951267402 3:20585181-20585203 TTTCAGCATGAGATTTGGAGGGG + Intergenic
951351763 3:21615071-21615093 TTTAAACATGAGATTTGGAGGGG - Intronic
951578912 3:24141597-24141619 TTTAAGAAACATTTATTGAGTGG - Intronic
952180810 3:30914539-30914561 CTTAGGCAAGATATTTTCTGAGG + Intergenic
952464935 3:33572878-33572900 ATTAAGCAAAACATTTTGAAAGG - Intronic
952515561 3:34101233-34101255 TTTAAGAAATACATTTTGTGAGG - Intergenic
953364354 3:42329989-42330011 TTTAATCAAGATAAAATGAGAGG + Intergenic
954463788 3:50642766-50642788 GTTCAGCAAGAAATTTTGTGTGG + Intronic
955776104 3:62435235-62435257 TTGCAGCAAGAAATTTAGAGTGG + Intronic
956088691 3:65640709-65640731 TATAAGCAATATATTCGGAGAGG - Intronic
956478330 3:69647157-69647179 TTGACCCAAAATATTTTGAGGGG + Intergenic
957123020 3:76120773-76120795 TATGAACAAGATAATTTGAGAGG - Intronic
957190411 3:77001137-77001159 TTTATGCAACATAATTTTAGAGG - Intronic
957285282 3:78209907-78209929 TTTCAGCATGATATTTGGAGGGG - Intergenic
957327723 3:78717656-78717678 GTTAAGCCAAATATTTTTAGGGG - Intronic
957451438 3:80387136-80387158 TTGAAGCAAGATCCTTTGGGTGG - Intergenic
957951273 3:87130257-87130279 TTGAAACAAGATATACTGAGAGG + Intergenic
958051055 3:88346835-88346857 TTTAAGGAATACATTTTGTGAGG + Intergenic
958096126 3:88947468-88947490 TTTAAGAAATATATTTTGTAAGG + Intergenic
958221820 3:90696255-90696277 TTTCAACAGGATATTTTGTGTGG - Intergenic
958443720 3:94189045-94189067 TTCCAGCAAGTTATTTTGTGAGG - Intergenic
958727281 3:97921091-97921113 TTTAAGGAAGGTATTGGGAGGGG - Intronic
959245365 3:103861613-103861635 TTTAAACATGAGATTTGGAGGGG - Intergenic
961644748 3:128386921-128386943 TTTCAACATGATATTTTGAGGGG + Intronic
961719681 3:128884859-128884881 CTAAAGCAAAATATTATGAGTGG - Intronic
962877326 3:139545357-139545379 TTTCAGCAAGATAATCTCAGAGG - Intergenic
963151872 3:142053196-142053218 TTTCAGCATGAGATTTGGAGCGG - Intronic
963414697 3:144979917-144979939 TTTAATCACAATATTTTTAGAGG - Intergenic
963511750 3:146256137-146256159 TTTCAGCAGGAGATTTTGAGGGG + Intergenic
963636215 3:147800104-147800126 TTTATACATGATATTTAGAGTGG - Intergenic
964592191 3:158377318-158377340 TTTCAACAAGAAATTTGGAGGGG - Intronic
964599213 3:158476788-158476810 TTTAAGAAATATATTTTGTGGGG + Intronic
965133843 3:164737198-164737220 TTTAAACACGAGATTTGGAGGGG - Intergenic
965282718 3:166774670-166774692 TTTAGAAAACATATTTTGAGAGG - Intergenic
965865332 3:173198695-173198717 TTTCAACAAGAAATTTGGAGAGG + Intergenic
965865596 3:173200784-173200806 TTTTAACATGAGATTTTGAGAGG + Intergenic
966294206 3:178400091-178400113 TTTCAGCATGAGATTTGGAGAGG - Intergenic
966697504 3:182806065-182806087 TTTAAGCAAGAGTTCATGAGTGG + Intronic
967071457 3:185965929-185965951 TTTCAGCATGATGTTTGGAGGGG + Intergenic
967142051 3:186569685-186569707 ATTAAGGAAGATATTAAGAGTGG + Intronic
967254631 3:187577201-187577223 TTTAAGCAATATATATTGCTTGG + Intergenic
967411519 3:189170823-189170845 TTTAAACAACATTTTTTGAAGGG + Intronic
967416895 3:189229234-189229256 TCTAAGCAAGATATTTTTGTAGG + Intronic
967512933 3:190334010-190334032 TTTAAGCAATATCTTTTTAATGG - Intronic
967576998 3:191106347-191106369 TTTCAACATGATATCTTGAGGGG - Intergenic
967616089 3:191568484-191568506 TTTCAACATGAGATTTTGAGAGG + Intergenic
967670356 3:192226570-192226592 TTTAAGCATAAGAATTTGAGGGG - Intronic
969708332 4:8827330-8827352 TTTAAGCATTTCATTTTGAGGGG - Intergenic
971238896 4:24869474-24869496 TTGGAGCAAGCTACTTTGAGTGG + Intronic
971465397 4:26953326-26953348 GTTAGACAAAATATTTTGAGTGG - Intronic
971550766 4:27953101-27953123 TTTCAACACGATATTTGGAGGGG + Intergenic
971601554 4:28597589-28597611 TTTAAGCAAGACAGTATCAGGGG + Intergenic
971856947 4:32056179-32056201 GCTAATCAAGACATTTTGAGGGG + Intergenic
972020707 4:34310167-34310189 TTTCAGCACGAGATTTGGAGGGG - Intergenic
972699928 4:41483850-41483872 TTTGAGCAAAATATTATGGGAGG - Intronic
972835752 4:42868146-42868168 TATAAGCCAGAGACTTTGAGTGG - Intergenic
973612641 4:52651204-52651226 CTTAAGCAATATTTTTTAAGAGG + Intronic
973819169 4:54647566-54647588 TTTAAGCAAGATAATTTTTAAGG - Intergenic
973958879 4:56090007-56090029 CTTAACCAAAATATTCTGAGGGG + Intergenic
974213588 4:58815527-58815549 TTTAAAAAAGATATTAAGAGGGG + Intergenic
974276863 4:59732138-59732160 TTGAAGAAAGATATTTTGAATGG - Intergenic
974397608 4:61358993-61359015 TTTAAAAAAGACATTTTTAGGGG - Intronic
974561014 4:63518283-63518305 TTTAAGCAGTATATTTTGTAAGG + Intergenic
974884649 4:67803637-67803659 ATAAAGCAATATGTTTTGAGAGG - Intergenic
975448196 4:74492788-74492810 TTTCAACAAGAGATTTGGAGGGG - Intergenic
975533903 4:75428655-75428677 TTTCAGCATGAGATTTGGAGGGG - Intergenic
975609619 4:76191354-76191376 TTTCAACATGAGATTTTGAGGGG - Intronic
975761954 4:77629100-77629122 TTTAAGAAATATATTTTGTAAGG - Intergenic
975853914 4:78602509-78602531 TTTAAGCAAGGCAGTTTGAGAGG - Intronic
976299235 4:83502252-83502274 TTTAAGCAAAATATTCAGTGGGG - Intronic
976349357 4:84043171-84043193 TTTCAGCAAGAATTTTGGAGGGG + Intergenic
976367615 4:84247480-84247502 TGTAAGCAAGATTTTTTAACAGG + Intergenic
976731381 4:88265803-88265825 TTAAATCAAGATATCTTGAAGGG - Intronic
977120910 4:93100434-93100456 TCTAAGCAAGATTTTTTAAATGG + Intronic
977403402 4:96563931-96563953 TTTAAGCAAGAAACTGGGAGGGG - Intergenic
977409207 4:96640005-96640027 TTTAATCAAGTTAATTTTAGTGG - Intergenic
977755003 4:100658721-100658743 TTTAAGCAAAATAATGTGACTGG + Intronic
978260461 4:106751125-106751147 TTTAAGAAATACATTTTGTGAGG - Intergenic
978659783 4:111110825-111110847 TTTCAGCATGAGATTTGGAGGGG + Intergenic
979230819 4:118347390-118347412 TTCAATCAAGAGATTTTGGGTGG + Intronic
979234512 4:118384904-118384926 TTTCAACATGATATTTGGAGGGG - Intergenic
979306815 4:119155255-119155277 TTTCAGCATGAGATTTAGAGGGG + Intronic
979312083 4:119214554-119214576 TTTAAAAAAGATATTTTAATGGG + Intronic
979348033 4:119612212-119612234 TTTCAACATGAGATTTTGAGGGG - Intronic
979507620 4:121515623-121515645 TTTCAGCATGAGATTTGGAGGGG - Intergenic
979590413 4:122472873-122472895 TTTAAGAAAGACATTTTGTAAGG + Intergenic
979973902 4:127171995-127172017 TTTAAGAAATATATTTTGTAAGG + Intergenic
980529549 4:134034426-134034448 TTTAAGAAATATATTTTGTAAGG + Intergenic
981164065 4:141536112-141536134 TTTAAGAAATATATTTTGTAAGG - Intergenic
981346220 4:143679738-143679760 TATAAGCAAGATAGTTCCAGAGG - Intronic
982101923 4:151976359-151976381 ATGAAGGAAGATTTTTTGAGGGG - Intergenic
982483180 4:155935866-155935888 TATAAACAAGATATTTTGATTGG + Intronic
982496019 4:156093255-156093277 TTTCAGCAAGAGATTTGAAGGGG - Intergenic
983059204 4:163136523-163136545 TTTAAGCAGATTATCTTGAGGGG - Intronic
983449192 4:167889718-167889740 TTTCAACATGAGATTTTGAGGGG - Intergenic
983540157 4:168900252-168900274 TTTCAGCATGAGATTTGGAGGGG + Intronic
984245571 4:177271605-177271627 TTTAAACCAGATCTTTTGACTGG - Intergenic
984338131 4:178418211-178418233 GTTAAGAAAGATATTATCAGAGG - Intergenic
984719562 4:182957131-182957153 TTTTATCAAAATATTTTAAGAGG + Intergenic
984882399 4:184421880-184421902 TTTTAACACGAGATTTTGAGGGG - Intronic
985284217 4:188318547-188318569 TTTAAGAAAGAGATTTTAAAAGG + Intergenic
985479816 5:102444-102466 TAAAAGCAAGATATTTTGGTGGG + Intergenic
986778812 5:11045530-11045552 TTCTAGCATGAGATTTTGAGGGG + Intronic
987385390 5:17324148-17324170 TGTAAGCAATACATTTTCAGTGG - Intergenic
988503251 5:31800595-31800617 GTCAAGCAGGATATTCTGAGGGG + Intronic
988717911 5:33846047-33846069 CTTCAGCATGAAATTTTGAGGGG + Intronic
988771909 5:34440764-34440786 ACTAAGAAAGATATTTTGAAAGG - Intergenic
989327677 5:40218688-40218710 TTTAAACATGAGATTTGGAGAGG - Intergenic
989417707 5:41199716-41199738 TTTAGTCAAGCTATTTTTAGTGG + Intronic
989532275 5:42522009-42522031 TATAAGCAAGATTTTATGAAGGG + Intronic
990078122 5:51876579-51876601 TTCAAGAAAAATATATTGAGTGG - Intergenic
990391370 5:55325119-55325141 TTATAGCAAGTTATTTTTAGAGG + Intronic
990828837 5:59933622-59933644 TTTAAGCAAGTTATTTTCTTAGG - Intronic
991024945 5:62019290-62019312 TTTCAGCATGAGATTTGGAGGGG - Intergenic
991699748 5:69306225-69306247 TTCAAACAAAATCTTTTGAGGGG - Intronic
992271343 5:75066778-75066800 TTTAAGAAATATATTTTGTAAGG + Intergenic
992877478 5:81070939-81070961 TTTAAGAAAGATTTTTTGGGGGG + Intronic
993174188 5:84460979-84461001 TTTAAACATGAAATTTGGAGGGG + Intergenic
993336348 5:86664325-86664347 TTTAAGGGAAATATTTTGTGTGG - Intergenic
993342514 5:86741798-86741820 TTTAAGCATGAGATTTTGAGGGG - Intergenic
993799333 5:92312252-92312274 TTTAAGCTACATTTTTTGAATGG - Intergenic
994760164 5:103841977-103841999 TTTTAGCAAGAGATTATGTGAGG + Intergenic
995107991 5:108397438-108397460 TTTAATCAAAAAATGTTGAGTGG + Intergenic
995367057 5:111374332-111374354 TTTGAGCAAAATTTTTGGAGAGG + Intronic
995747134 5:115415853-115415875 TTTACGTAAGCTAATTTGAGTGG - Intergenic
997021367 5:130006512-130006534 TTTATGCTACATATTTTGATTGG + Intronic
997620251 5:135284607-135284629 TTTCAGCAGGAGATTTGGAGGGG - Intronic
997703381 5:135923026-135923048 TTTAAGAAATATATTTTGTAAGG - Intronic
998611062 5:143689007-143689029 TTTTAGAAAGATATTTTTATTGG + Intergenic
998788509 5:145739201-145739223 TTTAAATAAGAAATTTTGAGAGG + Intronic
998948008 5:147361888-147361910 TTTACACAAGATATTTAGTGAGG - Intronic
999130650 5:149280748-149280770 TTGTACAAAGATATTTTGAGAGG - Intronic
999709525 5:154304558-154304580 TTTAAAAAAGATATTTTCACTGG - Intronic
999843202 5:155450876-155450898 TTTCAGCAGGAGATTTGGAGGGG + Intergenic
1000525851 5:162356543-162356565 TTTCAACATGAGATTTTGAGGGG + Intergenic
1000671047 5:164063722-164063744 TTTCAACAAGAGATTTGGAGGGG - Intergenic
1000863310 5:166482935-166482957 TTTAAGAAATACATTTTGAAAGG - Intergenic
1001091483 5:168744922-168744944 TTTAAGAAATATATTTTGTAAGG + Intronic
1001184563 5:169556480-169556502 TTTCAGCATGAGATTTGGAGAGG - Intergenic
1001826622 5:174750803-174750825 TTTAAGGAACATATTTGAAGGGG + Intergenic
1002801984 6:532491-532513 TTTATGCAGGATATTTTGATTGG - Exonic
1003273750 6:4630292-4630314 TTTAACCAAGATATTTGTAGTGG - Intergenic
1004108521 6:12689958-12689980 TTTCAGTAAAATTTTTTGAGAGG - Intergenic
1004588236 6:17024144-17024166 TTTCAACAAGAGATTTGGAGGGG - Intergenic
1004848786 6:19674881-19674903 TCTAAGCAGAATAGTTTGAGGGG + Intergenic
1005367718 6:25095962-25095984 TCTAAGTGAGAAATTTTGAGAGG + Intergenic
1005573366 6:27168702-27168724 TTTCAGCATGAGATTTGGAGGGG - Intergenic
1006226888 6:32547044-32547066 TTTCAACAAGAGATTTGGAGGGG - Intergenic
1007193096 6:40036669-40036691 TTTGAGCAAGTTATTTAGAGGGG + Intergenic
1008020412 6:46570879-46570901 TTTCAACATGAGATTTTGAGAGG + Intronic
1008099772 6:47378150-47378172 TTTAAGCAACATAGCTTAAGAGG - Intergenic
1008811621 6:55507943-55507965 TAGAAGCTAAATATTTTGAGTGG - Intronic
1009604466 6:65849067-65849089 TTTCAGCATGATATCTGGAGGGG + Intergenic
1009696121 6:67105822-67105844 TTTCAACACGATATTTGGAGGGG - Intergenic
1009836871 6:69012527-69012549 TTCAAGCAGGAAATTTTAAGTGG + Intronic
1009868050 6:69421926-69421948 TTTAAGAGACATATTTTGAATGG + Intergenic
1010785094 6:79991786-79991808 TTTCAGCATGAGATTTGGAGAGG - Intergenic
1010808413 6:80266853-80266875 TATAAGCAACATTTATTGAGCGG + Intronic
1011135780 6:84099442-84099464 TTTAAACATGAGATTTGGAGGGG - Intergenic
1011245778 6:85319570-85319592 TTTTAGCAAGAAAGTTTGAGAGG - Intergenic
1011947692 6:92927540-92927562 TTTAAGCATGAGATTTGGAAGGG - Intergenic
1012080188 6:94748480-94748502 TTTAAGAAATATATTTTGTAAGG - Intergenic
1012207764 6:96481994-96482016 CTTAAGAAAGATATTTTGTAAGG - Intergenic
1012212508 6:96538984-96539006 TTTAAGTCAGATGTTTTGATGGG - Intronic
1012300872 6:97586395-97586417 TTTAAGAAATCTACTTTGAGAGG + Intergenic
1012824779 6:104133726-104133748 TTTAAGAAATATATTTTGCAAGG + Intergenic
1013138039 6:107301365-107301387 TTCAAGCAAGTTACTTTGAATGG - Intronic
1013658996 6:112275501-112275523 TTTAAGCACTATGTTTTGGGTGG - Intergenic
1013960975 6:115899872-115899894 TTTCAGCATGAGATTTTGAAGGG - Intergenic
1014314808 6:119850493-119850515 TTTTAGCAATACATTTTAAGTGG + Intergenic
1014366090 6:120543982-120544004 CTCAAGGAAGATATTTTGAAGGG - Intergenic
1014419323 6:121221428-121221450 TTTAAGAAATATATTTTGTAAGG + Intronic
1014521647 6:122450538-122450560 TTTAAGAAATATATTTTGTAAGG + Intronic
1016070219 6:139729960-139729982 TTTAAGCATTTTTTTTTGAGTGG + Intergenic
1016226312 6:141743098-141743120 TTTCAGTTAGATATTTTAAGTGG + Intergenic
1016630803 6:146228525-146228547 TTTCAACATGATTTTTTGAGGGG + Intronic
1016657075 6:146531583-146531605 TTTCAACATGAGATTTTGAGGGG + Intergenic
1017825624 6:158079789-158079811 TTTAACCAATATTTCTTGAGGGG + Intronic
1017851812 6:158310688-158310710 TTTCAGCATGAGATTTGGAGGGG + Intronic
1017885728 6:158597915-158597937 TTTAAACATGAAATTTGGAGGGG + Intronic
1018129506 6:160715729-160715751 TTTAAGCTAGCTATTTGGAATGG - Intronic
1018161269 6:161044982-161045004 TTTCAGCATGAGATTTGGAGGGG + Intronic
1020483834 7:8696457-8696479 ATAAAGCAAGATATTGTGATTGG + Intronic
1020598003 7:10235686-10235708 TTTTTGCAAGATATTTTTACTGG + Intergenic
1020626259 7:10583532-10583554 TTTAAGAAACATATTTTGTAAGG + Intergenic
1020711298 7:11608853-11608875 GTGCAGCAAGACATTTTGAGGGG - Intronic
1020727735 7:11836950-11836972 TTTAAGGAATATATTTTGTAAGG + Intergenic
1020802114 7:12744773-12744795 TTTAAGAAATATATTTTGTAAGG + Intergenic
1021384193 7:20008047-20008069 TTTCAACATGAGATTTTGAGGGG + Intergenic
1022882311 7:34600907-34600929 TTTTAGGAAGCTGTTTTGAGGGG + Intergenic
1022907858 7:34873730-34873752 TTTCAGCATGAGATTTGGAGGGG + Intronic
1023735521 7:43232670-43232692 TGTAAGCAAGAAGTTTTAAGAGG - Intronic
1024624498 7:51193461-51193483 TTTAAGCCAAATACTTTGATTGG - Exonic
1026507812 7:71001090-71001112 TTTAAGAAATATATTTTGTAAGG + Intergenic
1026855622 7:73752284-73752306 TTTAAGAAATACATTTTGTGAGG + Intergenic
1027526661 7:79278025-79278047 TTTCAGCATGAGATTTGGAGGGG - Intronic
1028130577 7:87167865-87167887 TCTAAGCTAGAATTTTTGAGTGG + Intronic
1028216551 7:88140228-88140250 TTTTAACATGAGATTTTGAGGGG + Intronic
1028280251 7:88916809-88916831 TTTAAGAAAATTGTTTTGAGAGG + Intronic
1028614590 7:92751429-92751451 TTTAAGCAGGATTTTTTCATTGG + Intronic
1028642451 7:93058293-93058315 TTTAAGAAATATATTTTGTAGGG - Intergenic
1028740646 7:94270357-94270379 TTTAGGCAGGAGAATTTGAGAGG - Intergenic
1028765624 7:94555454-94555476 TTTAAGTCAGATATTTATAGAGG - Intronic
1028831041 7:95326962-95326984 TTTCAGCATGAGATTTGGAGGGG - Intergenic
1028882301 7:95893502-95893524 TTTAAGGAAGTTATTGGGAGTGG - Intronic
1028976701 7:96922700-96922722 TTTAAACAAATTATTTTCAGAGG + Intergenic
1030744848 7:113152651-113152673 TTTCAACATGATATTTAGAGGGG - Intergenic
1030831532 7:114228529-114228551 TTTAAGCCACTTATTTTGTGAGG - Intronic
1031266054 7:119582197-119582219 TTTAATTAAAATATTTTGAAAGG + Intergenic
1031434669 7:121718068-121718090 TTTAAGAAATATATTTTGTGAGG - Intergenic
1031876178 7:127143431-127143453 AATAAGCAAGTTATTTTGAGAGG - Intronic
1032309763 7:130774185-130774207 TTTTATCAAGATATTTTTAGGGG + Intergenic
1032568428 7:132972972-132972994 ATTAAGCAACATGTTTTGATTGG - Intronic
1033672740 7:143508782-143508804 TTAAAGCATGATAATGTGAGAGG + Intergenic
1034501889 7:151456020-151456042 TTTCAGCATGAGATTTGGAGAGG + Intergenic
1035147036 7:156829303-156829325 TTTCAGCATGATATTTGGAGGGG - Intronic
1035192301 7:157182015-157182037 TTTTAGAAGGATATTTTGAAAGG + Intronic
1035246493 7:157565746-157565768 TTCAAGCAAGATATTTTCCAAGG - Intronic
1035267031 7:157695575-157695597 TGAAAACAAGATGTTTTGAGAGG + Intronic
1035376426 7:158409862-158409884 TTAAAGCCAGATTTTTTGAGAGG - Intronic
1035757249 8:2043527-2043549 TTTAACCCACATATTTTGGGGGG - Intergenic
1036039895 8:5065002-5065024 TTTAAGAAATACATTTTGAAAGG + Intergenic
1037060158 8:14497785-14497807 TTTCAGCATGAGATTTGGAGGGG + Intronic
1037201587 8:16260079-16260101 TCTAAGTAATATATTTTAAGTGG - Intronic
1037235912 8:16719456-16719478 TTAAATGAAGAAATTTTGAGAGG - Intergenic
1037401833 8:18501778-18501800 TTTGAGAAAAAAATTTTGAGGGG - Intergenic
1037729871 8:21515401-21515423 TTTAAACAAGAATTTTGGAGGGG - Intergenic
1038086423 8:24202392-24202414 TTTTAACAAGATATTTTTAAAGG - Intergenic
1038318753 8:26510018-26510040 TTTCAGCATGAGATTTGGAGGGG - Intronic
1038590748 8:28835120-28835142 TTCAACCAACATTTTTTGAGAGG - Intronic
1040860199 8:51991049-51991071 TTTCAACAAGAAATTTGGAGGGG - Intergenic
1041185706 8:55298659-55298681 TTTCAACATGATATTTGGAGGGG + Intronic
1041203197 8:55471631-55471653 TTTCAGCATGAGATTTGGAGAGG - Intronic
1041331895 8:56735654-56735676 TTTCAGCATGAGATTTGGAGGGG + Intergenic
1042232862 8:66576511-66576533 TTTAAGCAAGACCATTTAAGAGG + Intronic
1042403845 8:68380450-68380472 TTTAAAAAAGATATTTTTAGAGG + Intronic
1043215502 8:77582119-77582141 TTTAAGCACTAAATTTTGGGAGG - Intergenic
1043497176 8:80814657-80814679 TTTAAAAAATAGATTTTGAGGGG - Intronic
1043719480 8:83529041-83529063 GTACAGTAAGATATTTTGAGAGG + Intergenic
1044089696 8:87983923-87983945 TTTAAGCAATACATTTTGTAAGG - Intergenic
1045131469 8:99158904-99158926 TTTAAGAAATATATTTTGTAAGG + Intronic
1045370739 8:101520097-101520119 TGTAAGCAACATATTTTGTATGG + Intronic
1045880187 8:107029371-107029393 TTTCAACAAGAGATTTGGAGAGG - Intergenic
1046652125 8:116847777-116847799 TTTCAGCATGAGATTTGGAGGGG - Intronic
1046859863 8:119078163-119078185 TTTCAGCATGAGATTTGGAGAGG + Intronic
1047110735 8:121786625-121786647 GCTATGCAAGATAATTTGAGAGG + Intergenic
1047229290 8:122982198-122982220 TTTAAACATGAGATTTGGAGGGG + Intergenic
1047610346 8:126514800-126514822 TTTCAGCATGAGATTTGGAGGGG + Intergenic
1047630212 8:126698959-126698981 TGTAAGCAATATATTTTGTAAGG - Intergenic
1047651041 8:126921684-126921706 TTTAATCAAAATATTTCTAGAGG - Intergenic
1047867175 8:129038559-129038581 TGTAAGCAAAATATTAAGAGTGG - Intergenic
1048516012 8:135112364-135112386 TTTCAGCATGAGATTTGGAGGGG - Intergenic
1048917989 8:139202673-139202695 TTTCAGCATGAGATTTGGAGGGG + Intergenic
1050825938 9:9945667-9945689 TGTAATCAAGATAATTTAAGAGG + Intronic
1050940160 9:11448550-11448572 TTTAATAAAGATATATTTAGGGG + Intergenic
1050943784 9:11492457-11492479 TTTGAGGAATATATTTTGTGTGG - Intergenic
1051468877 9:17411947-17411969 TCTGAGCAAGATAATTTCAGAGG + Intronic
1051788408 9:20772015-20772037 TTTAACAAATACATTTTGAGAGG + Intronic
1051930612 9:22380847-22380869 TTTAAGCAAGTTTTTTAGCGAGG - Intergenic
1052055896 9:23907013-23907035 TTTAACCAAGATATTATCTGGGG - Intergenic
1052128064 9:24803603-24803625 TTAAATCAAGATATTTGGAAAGG - Intergenic
1052132462 9:24865174-24865196 GTTATGCAAGATATTTTCTGGGG - Intergenic
1052177210 9:25476834-25476856 TTTAATTAAGATATTAGGAGAGG - Intergenic
1052242896 9:26296388-26296410 TGTAATGAAGATCTTTTGAGGGG - Intergenic
1052423917 9:28278814-28278836 TTTAAGAAATATATTTTGTAAGG + Intronic
1052501416 9:29296178-29296200 TTTCAGCAGGAGATTTGGAGGGG - Intergenic
1052543208 9:29837767-29837789 TTTAAGAAATATATTTTGTAAGG - Intergenic
1053668503 9:40336062-40336084 TTTTAGCATGAGATTTGGAGGGG - Intergenic
1054516108 9:66040231-66040253 TTTTAGCATGAGATTTGGAGGGG + Intergenic
1055377330 9:75663519-75663541 TTTAAGGAACATATCTTGTGAGG + Intergenic
1055861276 9:80752365-80752387 TTTCAGCATGAGATTTAGAGAGG - Intergenic
1056367752 9:85922732-85922754 TTTCAACATGAAATTTTGAGGGG + Intergenic
1056846788 9:90045209-90045231 TTTAAAAAAAATATATTGAGTGG - Intergenic
1057158725 9:92869036-92869058 TTTCAGCATGAGATTTGGAGAGG + Intronic
1058971966 9:110091891-110091913 TTGAAGCAAAATATATTTAGGGG - Intronic
1059371606 9:113844095-113844117 ATTCAACAAGATATTTGGAGGGG + Intergenic
1059982150 9:119784902-119784924 TTTAACCAAGAAATTTAGAGTGG + Intergenic
1061356401 9:130108830-130108852 TTTAAGCAGGTTCTTTTCAGTGG + Intronic
1186315900 X:8369938-8369960 TTAAAACATTATATTTTGAGGGG - Intergenic
1187082649 X:16007306-16007328 TTTAAACATGAGATTTGGAGGGG + Intergenic
1187934550 X:24322826-24322848 TTTCAACATGAGATTTTGAGGGG + Intergenic
1188029057 X:25244041-25244063 TGTAAGGTAGACATTTTGAGAGG - Intergenic
1188638167 X:32462303-32462325 GTAAAATAAGATATTTTGAGAGG - Intronic
1188812082 X:34662798-34662820 GTAAAATAAGATATTTTGAGAGG - Intergenic
1188819729 X:34760335-34760357 TTTCAGCATGAGTTTTTGAGAGG - Intergenic
1189742694 X:44136635-44136657 TTTTAGAAAGATATTTTCACAGG - Intergenic
1189755694 X:44269402-44269424 TTTCAGCATGAGATTTGGAGGGG - Intronic
1190165051 X:48066677-48066699 TATAAGCAAAACATTTTGACTGG - Intronic
1190468325 X:50749713-50749735 TTTAAGAAAGATAGTTTGTCAGG + Intronic
1190535771 X:51426090-51426112 TTTAAGGAATATATTTTTACTGG - Intergenic
1191580446 X:62755236-62755258 ATTGAGGAAGATATTCTGAGAGG - Intergenic
1194163811 X:90489072-90489094 TTTCAACATGATATTTTGAGGGG + Intergenic
1194999512 X:100629012-100629034 TTTAAACACGATCTTTTTAGAGG + Exonic
1195478418 X:105315015-105315037 TTTAATCTTGATATATTGAGAGG + Intronic
1195690772 X:107622930-107622952 TTTAAGAAATATATTTTGTAAGG - Intergenic
1196046807 X:111264827-111264849 TTTTAGGAAGATAATTTGAAAGG + Intronic
1196702273 X:118683732-118683754 TGTAATCAAGATATTCTGAGTGG + Intronic
1196730697 X:118938465-118938487 TTTAAGCCAAATACTTTGATTGG + Intergenic
1197038884 X:121910281-121910303 TTTAGCCAAAATATTTAGAGGGG + Intergenic
1197063659 X:122213061-122213083 TTTCAACAAGAGATTTGGAGAGG + Intergenic
1197737982 X:129866718-129866740 TAGAAGCAAGATGTTTTGGGAGG - Intergenic
1197896289 X:131319078-131319100 TTTAGGCAAGATATTTTAGAAGG + Intronic
1198013749 X:132587847-132587869 TTTAAGAAAGAGATTTTCATGGG + Intergenic
1198066895 X:133107038-133107060 TTTCAACATGATATTTGGAGGGG + Intergenic
1198231844 X:134697427-134697449 TTTAACCAAAATATTAAGAGTGG - Intronic
1198443827 X:136691527-136691549 TTTAAGCAAAATATACTTAGAGG + Intronic
1198446240 X:136717837-136717859 TTTAAGAAAAACATTTTTAGTGG - Intronic
1198986642 X:142462463-142462485 TTTCAACATGATATTTGGAGAGG - Intergenic
1199260258 X:145765004-145765026 TTTAAGAAATATATTTTGTAAGG + Intergenic
1199405088 X:147447850-147447872 TTTAAGAAATATATTTTGTAAGG + Intergenic
1199539126 X:148938865-148938887 GGTATGCAAGATATTTAGAGGGG + Intronic
1199934503 X:152558961-152558983 TTTCAGCATGAGATTTCGAGGGG + Intergenic
1200510074 Y:4066881-4066903 TTTCAACATGATATTTTGAGGGG + Intergenic
1201949432 Y:19547789-19547811 TTTCAACATGAAATTTTGAGGGG - Intergenic