ID: 1115109225

View in Genome Browser
Species Human (GRCh38)
Location 14:29801436-29801458
Sequence ATGAACATGAATAAGCAGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 257
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 237}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115109221_1115109225 1 Left 1115109221 14:29801412-29801434 CCTTAAACGATAAAGTTGCCTCC 0: 1
1: 0
2: 0
3: 4
4: 52
Right 1115109225 14:29801436-29801458 ATGAACATGAATAAGCAGTAGGG 0: 1
1: 0
2: 2
3: 17
4: 237
1115109220_1115109225 12 Left 1115109220 14:29801401-29801423 CCATCACAGTACCTTAAACGATA 0: 1
1: 0
2: 0
3: 6
4: 85
Right 1115109225 14:29801436-29801458 ATGAACATGAATAAGCAGTAGGG 0: 1
1: 0
2: 2
3: 17
4: 237

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115109225 Original CRISPR ATGAACATGAATAAGCAGTA GGG Intronic
903076414 1:20770643-20770665 CTGAACATGAAAAAGAGGTAAGG - Intronic
907878049 1:58514204-58514226 ATGTATATGAATATGCATTAAGG + Intronic
909026244 1:70485633-70485655 CTGCAAATGAATGAGCAGTATGG + Intergenic
909437924 1:75665330-75665352 GTCAACAAAAATAAGCAGTAGGG + Intergenic
909469891 1:76015182-76015204 ATTAACATCAAGAAGTAGTAAGG - Intergenic
909557520 1:76969963-76969985 AGGAAAATGAACAAGCAGAAAGG + Intronic
913438751 1:118875065-118875087 ATAAAGAAGAATCAGCAGTAGGG - Intergenic
913590314 1:120318400-120318422 ATCAACAAAAATAAGCAGTGGGG + Intergenic
913617872 1:120579963-120579985 ATCAACAAAAATAAGCAGTGGGG - Intergenic
914572400 1:148931009-148931031 ATCAACAAAAATAAGCAGTGGGG + Intronic
914600439 1:149199250-149199272 ATCAACAAAAATAAGCAGTGGGG - Intergenic
915760878 1:158311266-158311288 CTCAACATGACTAATCAGTAGGG - Intergenic
915775231 1:158476700-158476722 ATGAATATGAATAAGATGAAAGG + Intergenic
916915028 1:169397189-169397211 ATGAACATGAGGAAGGAGGAGGG + Intronic
917776693 1:178344624-178344646 ATGACCATGAACAACCACTAGGG - Intronic
919007556 1:191918118-191918140 ATCAACATGACTAATCATTAGGG - Intergenic
921699369 1:218250019-218250041 ATGAAGATGAATAAGCAGTGAGG + Intergenic
1066411002 10:35169205-35169227 ATGAACAGGAAGAATCAATATGG - Intronic
1067735337 10:48846172-48846194 ATGAACTTGGATAAGCAGCTGGG - Intronic
1068534045 10:58220371-58220393 TTGAACATGATTAAGCAACAAGG - Intronic
1069334789 10:67335331-67335353 CTGAACAGGAATAAGCAGGTTGG + Intronic
1069747764 10:70726681-70726703 ATGATCATGGATCTGCAGTAGGG - Intronic
1070871352 10:79756320-79756342 ATAAACATTAATAAGGAATATGG + Intergenic
1071309071 10:84326621-84326643 ATGTACATGTATTAGCATTATGG + Intergenic
1071638288 10:87278528-87278550 ATAAACATTAATAAGGAATATGG + Intergenic
1071656956 10:87459424-87459446 ATAAACATTAATAAGGAATATGG - Intergenic
1071856805 10:89634196-89634218 CTTAACATGAGTTAGCAGTATGG - Intronic
1076989762 11:266767-266789 ATGAACATGAACAAGAATAAAGG + Intergenic
1081889372 11:46527703-46527725 CTGAACATGACTAATCATTAGGG + Intronic
1082921688 11:58502253-58502275 ATGAACATGAAAAAGGAGACTGG + Intergenic
1085658212 11:78336763-78336785 ATGAACAGGAATAAATAGCATGG + Intronic
1085673223 11:78489337-78489359 CTCAACATCAATAAGCATTAGGG + Intronic
1085771125 11:79326754-79326776 ATGAACATGAAAAAGCTCTAGGG - Intronic
1088150972 11:106744580-106744602 ATGAAAAGTAATAAGCAGGAAGG + Intronic
1088429121 11:109738619-109738641 ATGAACATGAATGAGGAAAATGG - Intergenic
1088760116 11:112921611-112921633 ATGAAGAGGAATAAGCATGAAGG - Intergenic
1089853864 11:121523561-121523583 ATGAAGATGAATTAGCATTTTGG - Intronic
1090318151 11:125816268-125816290 ATGAACATCTACAAGCATTAAGG - Intergenic
1093494471 12:19740386-19740408 GGGAACATTCATAAGCAGTACGG + Intergenic
1093585179 12:20827339-20827361 ATGAACTTGAAAAAGCATTTGGG + Intronic
1095575199 12:43729345-43729367 ATGAAATTTAAAAAGCAGTATGG - Exonic
1097929935 12:65171634-65171656 ATGAATATAAAAAAGCAGCAAGG + Intronic
1100151642 12:91744914-91744936 ATAAATAGGAATAAGCACTAGGG + Intergenic
1100211450 12:92402583-92402605 AAGAACATGAAGAAGAAGGAGGG - Intergenic
1100770358 12:97914575-97914597 ATGCTCTTGAATAAGCAGTGTGG - Intergenic
1102103951 12:110304150-110304172 ATAAACATTATTCAGCAGTAAGG - Intronic
1102517621 12:113460703-113460725 ATAAAGATGAATGTGCAGTAAGG + Intergenic
1104999883 12:132683361-132683383 CTGAAGATGAAGAAGCAGCAAGG + Intronic
1105659930 13:22482968-22482990 ATGAACATAAACAAGCATAAGGG - Intergenic
1106429148 13:29663161-29663183 ATGAACATTAATACACAGAATGG - Intergenic
1106855304 13:33845820-33845842 ATGAACATCTACAAGCAGCAGGG - Intronic
1109748909 13:66664487-66664509 CTAAACATGAATAAGAATTAAGG + Intronic
1110708632 13:78625566-78625588 ATGCTAATGACTAAGCAGTAAGG - Intronic
1110958587 13:81590588-81590610 ATGTATATGTATAAGCATTATGG + Intergenic
1111307072 13:86428487-86428509 ATGAATAAGAAGAATCAGTATGG - Intergenic
1112094466 13:96116903-96116925 ATGAACATTTATATGAAGTAAGG + Intronic
1115109225 14:29801436-29801458 ATGAACATGAATAAGCAGTAGGG + Intronic
1115369867 14:32601092-32601114 TTTAACATGAATAATCAGAATGG + Intronic
1116172214 14:41417390-41417412 ATGACCATGAAAAATCAATAAGG + Intergenic
1116276739 14:42843714-42843736 ATGATCCTGAATGACCAGTAGGG - Intergenic
1118108413 14:62688118-62688140 ATAAACAAAAATATGCAGTATGG - Intergenic
1120495712 14:85232377-85232399 ATGACAATGGATAAGCAATAAGG - Intergenic
1121702878 14:95969208-95969230 ATGAACATGATGAAGCTGTCTGG - Intergenic
1123869593 15:24557196-24557218 TTCAACAGGAATGAGCAGTATGG - Intergenic
1126228396 15:46297241-46297263 ATGCACATGGATTAGCACTAAGG - Intergenic
1127278822 15:57471413-57471435 ATGAACATGTTTAAGCAGGCTGG + Intronic
1127559961 15:60126474-60126496 TTGAACATGAGAAAGCATTAAGG + Intergenic
1131592207 15:93761922-93761944 ATGCACATAAATACGCATTATGG - Intergenic
1131716340 15:95114522-95114544 ATGAACATCAAAAAGCATCAAGG + Intergenic
1131808401 15:96147433-96147455 ATGGACATGAATAAGGGTTATGG - Intergenic
1133540908 16:6752749-6752771 ATGGAAGTGAAGAAGCAGTAAGG - Intronic
1133628145 16:7591580-7591602 ATGAGCAGGTATAATCAGTAGGG - Intronic
1137448555 16:48549346-48549368 ATTAACAAAAATAGGCAGTAAGG + Intronic
1141246292 16:82310701-82310723 ATGATCAGGATTAAGCAGGATGG - Intergenic
1141545896 16:84768668-84768690 ATGAACATAAATAAGCTATTTGG - Intronic
1142370431 16:89676937-89676959 ATGAACCTGAAAAAGCATTTGGG - Intergenic
1144709893 17:17394589-17394611 AGGAACAAGAATAGGCAGTGTGG - Intergenic
1147511370 17:41071697-41071719 AAGAAGATGAATCAGGAGTAGGG + Intergenic
1147548176 17:41419313-41419335 ATGTACATGAACAAGGAATATGG + Intergenic
1148564060 17:48622910-48622932 AAGAAAATGAATAAGGAGCAGGG - Exonic
1151103479 17:71583844-71583866 GTGAACATATATAAGAAGTAAGG + Intergenic
1151286496 17:73115705-73115727 AAGAGAATGAATAAGCATTAGGG - Intergenic
1153446436 18:5178187-5178209 ATGCATATCAATAAGCAGGAGGG - Intronic
1154335947 18:13464868-13464890 ATGCACATGAATATGGAGCACGG - Intronic
1156040126 18:32811059-32811081 ATGAAAAAGAATAAGAATTAAGG + Intergenic
1163294041 19:16400771-16400793 ATGAACAAAAATAACCAGAAAGG + Intronic
1167584573 19:50366603-50366625 ATGAACATCTATAAGCATCAAGG - Intronic
926838550 2:17051981-17052003 ATGAACATGAAAAAGGACCAGGG + Intergenic
930965452 2:57318507-57318529 ATCAACATAAACAAGCAGTGAGG + Intergenic
934699328 2:96427193-96427215 AGGGACATGAATAAGCTGTGGGG + Intergenic
935477237 2:103537534-103537556 ATCAACAAAAATAAGCAATAGGG - Intergenic
936601101 2:113895443-113895465 ATGAACAAGAATTAGGAGTATGG + Intronic
938790965 2:134675642-134675664 AAGAAGATGAATAAGAAGTAAGG + Intronic
939065159 2:137474465-137474487 CTGAACTTGACTAAGAAGTATGG + Intronic
940404921 2:153289913-153289935 AGGAACATGAAAATGGAGTAGGG + Intergenic
941285181 2:163602822-163602844 ATGAAAAGGAATATTCAGTAGGG + Exonic
943396830 2:187348936-187348958 ATGACCATGTATAAGTAGTAAGG + Intronic
943881553 2:193151615-193151637 GAGAACAGGAATAAGAAGTAGGG + Intergenic
944437883 2:199710781-199710803 ATGAACTTGAATCATCAGTAAGG + Intergenic
944650395 2:201824490-201824512 ATGAACTTAAATAGGCAGTGAGG + Intronic
946073285 2:217052795-217052817 ATAGACATGAATAAGGAATAAGG + Intergenic
946845846 2:223858425-223858447 ATGAACAGAAATCAGCAGTGAGG - Intronic
946951919 2:224885456-224885478 AAAGACATGAATAAGCAGAATGG - Intronic
948488899 2:238298797-238298819 ATGATCATGATTATGCAGAAGGG + Intergenic
1169128667 20:3150505-3150527 AAGAAAAAGAATAAGCATTAAGG - Intronic
1169153747 20:3311626-3311648 ATGAAAATGAGTAAGCTATATGG + Intronic
1169707909 20:8527386-8527408 ATGAAAATAAATAAACAGCATGG + Intronic
1169990740 20:11499841-11499863 AGGAACCTGAAAAAGAAGTATGG - Intergenic
1170967328 20:21085327-21085349 ATGAACATAAATAATAAGAATGG - Intergenic
1172551969 20:35808111-35808133 ATGAACATGAAAATGGAGAAAGG - Intronic
1172844327 20:37920674-37920696 ATGGACATGCATAAGCAGGGAGG - Intronic
1173722971 20:45276206-45276228 AATAACATGAACAGGCAGTAGGG - Intergenic
1174855220 20:54038275-54038297 ATAAACAGGAGTAAGCAGGAGGG - Intronic
1177014617 21:15770547-15770569 AGGAAAATGAGTAAGTAGTAAGG - Intronic
1177476691 21:21633069-21633091 ATGAACCTCAAAAACCAGTAGGG + Intergenic
1177668155 21:24188718-24188740 TTGAACATGAACAAGCATGAGGG - Intergenic
1178096906 21:29225112-29225134 ATGAACATGAAAATTAAGTATGG - Intronic
1181771399 22:25128272-25128294 ATGAACATGAAGAAACATTAAGG - Intronic
1182730629 22:32488663-32488685 ATGAACAAGAATAAGCCTTTAGG - Intronic
1184438715 22:44496186-44496208 CTGCACATGAATATGCAGTCTGG - Exonic
1184957702 22:47902769-47902791 ATGACAATGAGTAAGAAGTAAGG - Intergenic
950592624 3:13949547-13949569 ATGAACATGAAGTACCAGAAAGG + Intronic
950983492 3:17334024-17334046 ATGATAATGAAAAAGCAGTGGGG + Intronic
951634590 3:24759216-24759238 ATGTAAATAAATGAGCAGTATGG - Intergenic
952613680 3:35243083-35243105 ATCAACAAAAATAAGCAATAGGG + Intergenic
952671259 3:35972308-35972330 ATGAACAAAAAAAAGTAGTAAGG - Intergenic
952909342 3:38168803-38168825 ATGAACCTCAAAAAGCATTATGG - Intronic
954053079 3:47998602-47998624 CTGAACATATATAAGCAGTCTGG + Intronic
955898055 3:63721868-63721890 ATGGACAGGAAGAATCAGTATGG + Intergenic
956188351 3:66583795-66583817 GTGATCATGAATAAACAGAATGG - Intergenic
957624250 3:82638951-82638973 GAGAGCATGAAGAAGCAGTATGG + Intergenic
958470666 3:94513762-94513784 ATGAAAATGAGTATGCAGAACGG - Intergenic
958579933 3:96005878-96005900 TTGAACATGAGTTAGCAGTTTGG - Intergenic
959221478 3:103526260-103526282 ATCAACATCAGTAAGCAGAAGGG + Intergenic
960203274 3:114864183-114864205 ATGAACATGTACAAACAGAAAGG - Intronic
960890738 3:122444823-122444845 AGGAAAACGAATAAGCAGAAAGG + Intronic
960917116 3:122707018-122707040 ATGAACATGAATTACCATAATGG - Intronic
962035622 3:131648403-131648425 ATGTCCATGAATAAGCAGATAGG - Intronic
963857005 3:150265060-150265082 ATGAAATTTAAGAAGCAGTACGG + Intergenic
965153977 3:165021757-165021779 ATAAACATAAATTAGCATTAGGG - Intronic
965192519 3:165549681-165549703 ATGAAGCTGAATAAGCAGGCAGG - Intergenic
966149620 3:176852537-176852559 ATGAAAAAGAATAACCAATATGG - Intergenic
971612366 4:28742120-28742142 ATGAAAATAAATGAGCAGGAAGG - Intergenic
971789745 4:31154220-31154242 ATGAACATGAAGGAGGAGTTTGG + Intergenic
971887986 4:32477384-32477406 ACAAACATGAAAAAGCAGCAAGG + Intergenic
972684541 4:41339029-41339051 ATGAGGATGAATAAGCAGTGTGG + Intergenic
973335402 4:48950801-48950823 GGCAACATGAACAAGCAGTAGGG - Intergenic
976820742 4:89203770-89203792 ATGCACACAAATGAGCAGTAAGG + Intergenic
977134939 4:93292412-93292434 ATGAACAGAACTAAGAAGTAAGG + Intronic
977761012 4:100737001-100737023 ATGAAGATGAAAGAGCAGAATGG + Intronic
979633515 4:122930530-122930552 ATGAACAATAAAAAGCAGAAGGG + Intronic
980302537 4:131012733-131012755 ATGAAAATGCATCAGCAGTTTGG - Intergenic
980862382 4:138515151-138515173 ATGGACATGAGTAAGCATTTTGG - Intergenic
982114032 4:152082322-152082344 AAGAACATAAATAACCATTATGG - Intergenic
982738036 4:159026596-159026618 ATGAAAAAAAAGAAGCAGTATGG - Intronic
982875913 4:160649412-160649434 ATAAACAAGTAAAAGCAGTAAGG + Intergenic
982928754 4:161375042-161375064 ATGGAAATGAATAAGCAGCACGG + Intergenic
983752253 4:171289624-171289646 AAGAAAATGAATAAGCAGGCCGG + Intergenic
984585380 4:181558389-181558411 CTGAACATGAATAAACAGTTTGG + Intergenic
984641456 4:182168719-182168741 ATGAACATGAATTATAGGTATGG + Intronic
986014366 5:3745027-3745049 ATGAAGATCAAAAAGCAGCAAGG + Intergenic
987746256 5:21976292-21976314 ATACACATGAATAAGCGATAAGG + Intronic
989092478 5:37748022-37748044 ATGAATAGGAAGAATCAGTATGG + Intronic
989708347 5:44365699-44365721 ATGAACTGTAATATGCAGTAAGG - Intronic
990791876 5:59490543-59490565 ATGAACATGAATTACCTGCATGG - Intronic
991151034 5:63370376-63370398 ATGAACATTATTACTCAGTATGG + Intergenic
991766463 5:69986405-69986427 ATACACATGAATAAGCGATAAGG + Intergenic
991780851 5:70131700-70131722 ATACACATGAATAAGCGATAAGG - Intergenic
991845696 5:70861490-70861512 ATACACATGAATAAGCGATAAGG + Intergenic
991873297 5:71132013-71132035 ATACACATGAATAAGCGATAAGG - Intergenic
992991461 5:82287926-82287948 GTGAGCATGAAGAAGCAGTGAGG + Intronic
993971770 5:94428718-94428740 ATGAACATCACTAAGTAATATGG - Intronic
993998794 5:94753751-94753773 ATGAACATGCATATGCAGAAGGG + Intronic
994552240 5:101251046-101251068 ATGAACATTAGTAATCACTAGGG + Intergenic
994635562 5:102341239-102341261 ATGAACATGAAGTATCAGAAAGG + Intergenic
994686197 5:102955743-102955765 ATGAACATGAGAAAGTAGGAAGG - Intronic
996522067 5:124438300-124438322 ATAAACAAGAAAAAGCAGGAAGG + Intergenic
1000227846 5:159285033-159285055 AAGACCAAGTATAAGCAGTATGG - Exonic
1001026551 5:168229307-168229329 ATGACCACGGATAAGCAGGAAGG - Intronic
1003420522 6:5953609-5953631 ATGAACGGGAATGAGCATTATGG + Intergenic
1005112793 6:22302730-22302752 CTGAACATTAATAAACTGTAGGG + Intergenic
1005772501 6:29088934-29088956 ATGGACATAAATAAGCAGTTTGG + Intergenic
1006258639 6:32850821-32850843 ATGAAGATGGAGAATCAGTAAGG + Intronic
1007171022 6:39863608-39863630 AGGAACAGGAATGAGCAGGATGG + Intronic
1007621180 6:43215628-43215650 ATGAACATTAAAAAGCTTTAGGG - Intronic
1007964896 6:45995152-45995174 AGGAACATGTATAAGCTGTGTGG + Intronic
1009540108 6:64944095-64944117 ATCAACAAAAATAAGCAATAAGG + Intronic
1011165622 6:84442715-84442737 ATGAACAGGAATTAGGAGGAGGG + Intergenic
1011892786 6:92187811-92187833 ATAAGTATGAATAAGCAGTGTGG - Intergenic
1012742723 6:103040040-103040062 ATCAACATCATTAAGCAATAGGG - Intergenic
1013628732 6:111963836-111963858 ATCAACAAAAATAAGCAATAGGG - Intergenic
1014880157 6:126713872-126713894 ATCAACCTGAATAATCAGAAAGG - Intergenic
1016689004 6:146914079-146914101 ATGAGCATGAATCAGCAGTTTGG - Intergenic
1017107164 6:150898546-150898568 ATGAATATGAAGACGCTGTATGG + Intronic
1017526552 6:155246265-155246287 GTGGACATGAATGAGCACTAAGG - Intronic
1017803165 6:157917473-157917495 ATGAACATGAAAACTCAATAAGG - Intronic
1018709498 6:166487613-166487635 ATGAAGATGAATCTGCAGGAAGG + Intronic
1020434518 7:8148118-8148140 CTGAACTGGAATAAGCAGTTTGG + Intronic
1021105350 7:16632139-16632161 AACAACATGTATAAACAGTAAGG - Intronic
1021345601 7:19524448-19524470 CTGAAAATGAAGAAGCAGAAAGG + Intergenic
1021484463 7:21152224-21152246 ATGAAGATGAATACGCAGAAAGG + Intergenic
1023282258 7:38583091-38583113 TTGAAAATGAATAAGCGGGATGG - Intronic
1023753544 7:43394597-43394619 AGGAAGATGAATAAGGGGTATGG + Intronic
1024140138 7:46454755-46454777 AAGAACATGAATTGTCAGTAGGG - Intergenic
1025037239 7:55602955-55602977 ATCAACACAAATAAGCAGCAGGG + Intergenic
1025222222 7:57122588-57122610 AGCAACATCAATAAGAAGTATGG + Intronic
1026465919 7:70654481-70654503 ATTAAAAAAAATAAGCAGTATGG - Intronic
1026613721 7:71883517-71883539 ATGAGCAGGAATAAGGAGTTAGG + Intronic
1028283464 7:88963923-88963945 ATGAACATCATTAATCAGTAGGG + Intronic
1028933238 7:96438049-96438071 GTCAACAAGAATAAGCAATAGGG + Intergenic
1029287972 7:99479097-99479119 ATGAACATGAACAAGAAATGTGG - Intronic
1030046152 7:105498636-105498658 ATGACCTTGAATAAGAAGGAAGG - Intronic
1030230315 7:107201821-107201843 ATACAGATTAATAAGCAGTAAGG - Exonic
1030236222 7:107265565-107265587 ATAAACATGAATAAAAATTAAGG - Intronic
1032287456 7:130551591-130551613 AAGAACATGAAATAGCAGTCTGG + Intronic
1032398086 7:131605143-131605165 AGGAACATGAATAAGAGGCAGGG - Intergenic
1033032981 7:137845534-137845556 TTTAACATCGATAAGCAGTAGGG + Intronic
1033787111 7:144745794-144745816 ATGGACATGGATAAGCCATATGG + Intronic
1034100601 7:148446630-148446652 AAGAAAATGCATATGCAGTAAGG - Intergenic
1037684591 8:21128043-21128065 CTGAACTGGAATAAGCAGTTTGG + Intergenic
1039765173 8:40620921-40620943 TTGGAAATGAATAAGCAGTAGGG - Intronic
1040082025 8:43295145-43295167 ATTAACATGTGTAAGAAGTATGG + Intergenic
1042566953 8:70121315-70121337 ATGGATATGATTAAGCAGGAGGG - Exonic
1043304122 8:78773056-78773078 CTGAACTAGAATAAGCAGTTTGG - Intronic
1043304125 8:78773088-78773110 CTGAACTAGAATAAGCAGTTTGG - Intronic
1044026798 8:87183164-87183186 GTCAACAAAAATAAGCAGTAGGG - Intronic
1044542973 8:93428620-93428642 GTGAACTAGAATAAGCAGGAAGG + Intergenic
1045448840 8:102298538-102298560 ATGAACATTTATAATCAGGAAGG - Intronic
1046232692 8:111377928-111377950 ATAAACATGCTTTAGCAGTAAGG - Intergenic
1046351572 8:113021432-113021454 ATGAACATGAATATCCGTTAGGG + Intronic
1048074940 8:131059788-131059810 ATGAGGATGAGTAAGCAGTGAGG + Intergenic
1049205628 8:141362197-141362219 ATGGGCATGAATAAGCCGAAAGG - Intronic
1050614886 9:7391628-7391650 ATGAAGATGAATTAGCCGCAGGG - Intergenic
1054970865 9:71085005-71085027 ATCAACAAAAATAAGCAATAGGG + Intronic
1055311509 9:74986762-74986784 ATTAAGAAGAATGAGCAGTAGGG - Intronic
1055404636 9:75962048-75962070 ATAAACATAAATAACCAGCATGG + Intronic
1057153603 9:92818566-92818588 AATAACATGAATAATCAGTTAGG + Intergenic
1057682319 9:97200307-97200329 AATAACATGAATAATCAGTTAGG - Intergenic
1057778908 9:98034221-98034243 ATGACCATGAGGAAGCAGTGTGG + Intergenic
1058539606 9:105997948-105997970 ATCAAAATGAATAATCAGTGTGG - Intergenic
1062418786 9:136468687-136468709 ATGAATTTGAATTAGCCGTATGG - Intronic
1185922984 X:4114577-4114599 ATGAACAGGAGTGAGCAGTGAGG - Intergenic
1186997565 X:15140012-15140034 ATAAAGATGAATAAGCAGGAGGG + Intergenic
1187286482 X:17909395-17909417 ATGAATAAGAAGAATCAGTATGG - Intergenic
1187654502 X:21455050-21455072 ATCATCATGAATAAGCATTCAGG - Intronic
1188373283 X:29395260-29395282 ATGTACATGAATAAGCAGTTGGG + Intronic
1188759215 X:34004901-34004923 TTGAATTTGAATAAGCATTATGG + Intergenic
1188761446 X:34036266-34036288 ATGAACAATAATAAGGACTATGG - Intergenic
1192749132 X:73969979-73970001 ATGGAAAAGAATAAGCAGTCCGG - Intergenic
1195521110 X:105830496-105830518 ATAAAAAAGAATAAGCAGTATGG - Intronic
1197026232 X:121753172-121753194 ATGTCTATGAAAAAGCAGTATGG + Intergenic
1197457142 X:126691115-126691137 AAGAACATGAAGAAGGAGAAGGG + Intergenic
1197565728 X:128083212-128083234 ATGAACTTGAAAAAGCATTTAGG + Intergenic
1198673925 X:139111460-139111482 ATGAAGATGTTTTAGCAGTAAGG + Intronic
1199353511 X:146832672-146832694 TTGAACAAAAATAAGCAGTGGGG - Intergenic
1199356669 X:146870427-146870449 AAGAACATGAATGGGCAGAATGG - Intergenic
1199804381 X:151283291-151283313 ATGAGGATGAATATGCAGGAAGG - Intergenic