ID: 1115109635

View in Genome Browser
Species Human (GRCh38)
Location 14:29806077-29806099
Sequence CTTGCCTTGCTTTCCTCTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 486
Summary {0: 1, 1: 1, 2: 5, 3: 38, 4: 441}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115109635_1115109637 0 Left 1115109635 14:29806077-29806099 CCAGGAGAGGAAAGCAAGGCAAG 0: 1
1: 1
2: 5
3: 38
4: 441
Right 1115109637 14:29806100-29806122 AAGCGGATCTCATCAACCACTGG 0: 1
1: 0
2: 0
3: 2
4: 50
1115109635_1115109638 3 Left 1115109635 14:29806077-29806099 CCAGGAGAGGAAAGCAAGGCAAG 0: 1
1: 1
2: 5
3: 38
4: 441
Right 1115109638 14:29806103-29806125 CGGATCTCATCAACCACTGGAGG 0: 1
1: 0
2: 0
3: 0
4: 43

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115109635 Original CRISPR CTTGCCTTGCTTTCCTCTCC TGG (reversed) Intronic
900173615 1:1282254-1282276 CCAGCATGGCTTTCCTCTCCAGG + Exonic
900481353 1:2900970-2900992 CTGCTCTGGCTTTCCTCTCCTGG + Intergenic
900489691 1:2941608-2941630 TTTTCCTTGCTCTCCCCTCCTGG + Intergenic
901192999 1:7423701-7423723 CTTCCCTTGCTTACCTCCCAGGG + Intronic
902712456 1:18249754-18249776 TTTGCCTCCCTTTCCTCTACTGG + Intronic
902782090 1:18711490-18711512 CTTGAGTTGGTTTCCTATCCAGG + Intronic
902978901 1:20109273-20109295 CTTGCCTTGCTTTGTTGTGCAGG - Intergenic
903163211 1:21503786-21503808 CTTGGCTTGCTGCCTTCTCCAGG + Intergenic
904285481 1:29450851-29450873 CTTGCCTTGCTTGACCCTCACGG - Intergenic
904301335 1:29556686-29556708 ATTGCCCTGCTGTCCTCTCCTGG - Intergenic
904397341 1:30230711-30230733 GTTTCCTTTCTGTCCTCTCCTGG - Intergenic
904412050 1:30330446-30330468 CTCTCCTTCCTCTCCTCTCCCGG + Intergenic
904601847 1:31677424-31677446 CATCCCTTGCTCCCCTCTCCAGG + Intronic
904858141 1:33515376-33515398 CTTGCCTGGCTTTCCAGACCTGG + Exonic
905207759 1:36352638-36352660 CTTGCCCTGCTATGCTCTGCAGG - Intronic
906194201 1:43919961-43919983 CTTCCCTTGCTGCTCTCTCCTGG - Intronic
907372018 1:54009926-54009948 CCTGCCCTGCTTTCCTCACAGGG + Intronic
909932065 1:81507570-81507592 CTTGCTCTGCTTCCCTCTCGAGG - Intronic
910112665 1:83699470-83699492 TCTGCCTTTCTTTCCTTTCCTGG + Intergenic
913715495 1:121530164-121530186 ATATCTTTGCTTTCCTCTCCAGG - Intergenic
913997175 1:143661069-143661091 CTTCCCTTGGATTCCTCGCCAGG + Intergenic
915355745 1:155254554-155254576 CTTGCCTCTCCTCCCTCTCCTGG - Intronic
917701835 1:177589602-177589624 CTTCCTTTGCTTTGCTCTCAAGG - Intergenic
918177941 1:182061522-182061544 CAGGCCTTGCTCTCCACTCCTGG + Intronic
920027190 1:203007521-203007543 CTTGAGTCGCTTTCCTCTCTTGG - Exonic
920030711 1:203035852-203035874 CTTGCCTGGCAGTCCTCTCTGGG + Intronic
920119229 1:203643260-203643282 CGTGCCCTGCATTCCTCCCCTGG + Intronic
920280969 1:204843525-204843547 CTCCCCTTTCTTCCCTCTCCAGG + Intronic
920682907 1:208086137-208086159 CTTGATTTGCTTTCCTCACTGGG + Intronic
921243192 1:213208248-213208270 TTTGCATTGGTTTCCTCTCTTGG + Intronic
921333854 1:214066534-214066556 GTTGCCCTGCTTATCTCTCCAGG - Intergenic
922364800 1:224853862-224853884 AATGCCTTTCTTTCCTCTCATGG + Intergenic
922439054 1:225636933-225636955 CTTGCTTTAGTTTCCTCTTCTGG - Intronic
922516188 1:226209886-226209908 CTTGTGCTGCTTCCCTCTCCCGG + Intergenic
922700204 1:227754830-227754852 CTTGGTCAGCTTTCCTCTCCAGG - Intronic
923539758 1:234879595-234879617 CTTGCCTGGCTTCCCTCCTCTGG + Intergenic
923742644 1:236669786-236669808 CTTGCCTTGCATACTTCACCAGG - Intergenic
924050165 1:240072613-240072635 CTTGTCTTGTTTTCCTGTGCTGG - Intronic
1063843315 10:10096529-10096551 CTTACATAGCTTTCCTCTTCAGG + Intergenic
1064226495 10:13490489-13490511 CTCTCCATGCTCTCCTCTCCAGG + Intronic
1067569286 10:47359915-47359937 CCTGCCTTTCTTTCCCCTCCAGG + Intergenic
1067839903 10:49667198-49667220 CTTTCCTCCCTTTTCTCTCCTGG - Intergenic
1068053691 10:51983491-51983513 CTTGGTCTGCTGTCCTCTCCTGG - Intronic
1070641606 10:78174299-78174321 GGTGCATTGCTTTCATCTCCTGG + Intergenic
1071454660 10:85836792-85836814 CTTGGCCTGCTTACCTCTCCTGG + Intronic
1074240783 10:111637063-111637085 ATTGTCTTTCTTTCCCCTCCAGG - Intergenic
1075068302 10:119304236-119304258 GTTGCCCTGCTTTCCCCTCAAGG - Intronic
1075120394 10:119660225-119660247 CTGGCCTGGCTTTTCTCTCTAGG + Intronic
1075391072 10:122092386-122092408 TTTGCTTTGCTTTGCTCTTCTGG - Intronic
1075585605 10:123655881-123655903 CTCCCCTTCCTTTCCTCTCTTGG - Intergenic
1075595199 10:123724095-123724117 TCTGCCTGGCTCTCCTCTCCTGG - Intronic
1075651309 10:124129616-124129638 CTGGCCTTGGTTTCCTCTTCTGG + Intergenic
1075875662 10:125803778-125803800 CCTGCCATGCTGTACTCTCCAGG + Intronic
1076475949 10:130751536-130751558 CTTCCCTTTATTTCCTCTGCCGG - Intergenic
1076564563 10:131389310-131389332 CTTGCCTGGCCTGCCTCTCCTGG + Intergenic
1076589086 10:131570865-131570887 CTGGCCTGGCTTCCCTCTTCAGG - Intergenic
1077305007 11:1865041-1865063 CTTGGCTTTCCTGCCTCTCCTGG - Intronic
1077787564 11:5401146-5401168 ATTGCCTTCCTCTCCTCCCCAGG + Intronic
1078183205 11:9029627-9029649 CTTGCCTTAATTTCCTCCCTGGG - Intronic
1078694982 11:13622141-13622163 CTTGCCTTGCCTACCTCACTGGG - Intergenic
1079101644 11:17545505-17545527 CTTTCCTTTCATTCCTTTCCAGG - Intergenic
1079337099 11:19579581-19579603 CAAGCCTTGCTTTCCTCCTCTGG + Intronic
1079453546 11:20618146-20618168 ATTTCCTTCCTTTCCTCTCAGGG + Intronic
1080439305 11:32276458-32276480 TATGCCCTGTTTTCCTCTCCAGG - Intergenic
1081306199 11:41515161-41515183 GTTGCCTTTCTTTCTTGTCCAGG + Intergenic
1081585715 11:44382367-44382389 AGAGCCTGGCTTTCCTCTCCAGG - Intergenic
1081663710 11:44904150-44904172 TTTCCCTTGCATTCCTCACCAGG + Intronic
1082234208 11:49803176-49803198 CCTTCCATGCTTTCCTCTCCTGG + Intergenic
1082627489 11:55502434-55502456 CAGGACTGGCTTTCCTCTCCCGG - Intergenic
1083127663 11:60587752-60587774 TTTCCCATGCTTTCTTCTCCAGG + Intergenic
1083253130 11:61481267-61481289 CTGGCCTTGCCTGCCTCCCCTGG - Intronic
1083489698 11:63007185-63007207 GTTGCCTTTCTTCCCTCTCTGGG - Intronic
1083696030 11:64443130-64443152 CTTCCCTTGGTTTCTTTTCCTGG + Intergenic
1084374050 11:68764033-68764055 CCTGCCGTGCTGTCCTCTCTAGG - Intronic
1084730414 11:71069693-71069715 CTTGCCTTGCTATGCTGTCCTGG - Intronic
1086600752 11:88630470-88630492 TTTGCCTTGTATTCCACTCCAGG + Intronic
1086617381 11:88838255-88838277 CTTTCCATGCTTTTCTCTCCTGG - Intronic
1087055977 11:93936676-93936698 CTTTGCTTGCTTTGCTCTGCTGG + Intergenic
1087277401 11:96174247-96174269 GATGCCTTGCTTTTCTGTCCTGG + Intronic
1088806584 11:113358495-113358517 CTTGCTCTGCTGGCCTCTCCTGG - Intronic
1090732171 11:129581434-129581456 CTGGCCTTGCTCTTCTGTCCTGG - Intergenic
1091334433 11:134755691-134755713 CTTGCCTCGCCTTCCTCACAAGG - Intergenic
1091370295 11:135051817-135051839 CTTGAAATGCCTTCCTCTCCAGG + Intergenic
1091903226 12:4162219-4162241 CTTGCCATGCATTCGTCACCTGG - Intergenic
1092056233 12:5510458-5510480 CCTCCCTTCCTTTCTTCTCCAGG + Intronic
1092766909 12:11861315-11861337 CAAGTCCTGCTTTCCTCTCCAGG + Intronic
1093510669 12:19923408-19923430 CTTCACTTGCCTTCCTCTCCAGG + Intergenic
1094125108 12:27015006-27015028 ATTGTCTTGCTTTCCTTCCCTGG + Intergenic
1095497959 12:42805250-42805272 CTAGCCTTGATTTCCTCACATGG + Intergenic
1097990809 12:65831177-65831199 TTTGCTTTGCTTTGCTTTCCTGG + Intronic
1098631178 12:72723917-72723939 ATTGCCTTGCCTTCCTAGCCTGG + Intergenic
1100585512 12:95976014-95976036 CGGGCCTTGGTTTTCTCTCCAGG + Intronic
1100594922 12:96063430-96063452 CTTTCCTTACTCTCCTCTTCAGG + Intergenic
1100690621 12:97035121-97035143 CTGGCCTGTCTTCCCTCTCCAGG - Intergenic
1100804047 12:98262421-98262443 CAGACCTTGCTTTCCTCTCTGGG - Intergenic
1102208481 12:111106850-111106872 CCTGTCCTTCTTTCCTCTCCCGG - Intronic
1103177831 12:118879844-118879866 CATGCTTTGTTTCCCTCTCCAGG + Intergenic
1103512888 12:121487466-121487488 CCTGCCTTTCTTTGCTCTCCTGG + Intronic
1103698964 12:122838069-122838091 CCAGCCTCGCTTTCCTCCCCTGG + Intronic
1104316560 12:127708584-127708606 CTCACCATGTTTTCCTCTCCAGG + Intergenic
1104604997 12:130181388-130181410 CTTGCCATTCTTCCCTCCCCTGG + Intergenic
1104692993 12:130840349-130840371 CTGGCCTTGCCTTCTCCTCCTGG - Intergenic
1104732920 12:131118523-131118545 CTTGCCTTCCTGTGCTCTTCTGG + Intronic
1105813148 13:24011637-24011659 CCTGTCTTGCTTTCTTCTCTTGG + Intronic
1106389377 13:29320260-29320282 CTTGCCTTGTTCGCCTCTCGTGG - Intronic
1106497993 13:30298880-30298902 TTTGCCTTTCTTTTTTCTCCTGG - Intronic
1106979772 13:35264879-35264901 CTTGCCTGGCTGTTCTGTCCAGG - Intronic
1108438947 13:50429275-50429297 CTTGCATTGTTTTCCATTCCAGG + Intronic
1108483315 13:50898119-50898141 TTTGCCTTCCTCCCCTCTCCAGG + Intergenic
1109313571 13:60723464-60723486 ATTGTCGTGCTTTCCTCTCTTGG + Intergenic
1110118030 13:71844306-71844328 CCTGCCTTGCTTGCCTGTCCAGG - Intronic
1111018634 13:82415974-82415996 TTTATCTTGCTTTCCTCTTCAGG + Intergenic
1112146907 13:96710052-96710074 CTTACCTACCTTTCCTCCCCAGG - Intronic
1112961854 13:105136582-105136604 CTAGCCTTGCTTTTGTCTGCGGG + Intergenic
1113314383 13:109163145-109163167 CTTGACCTGCTTTCCTTTCTGGG + Intronic
1113518378 13:110920307-110920329 CTTGCCATGCTCTCCTCCTCTGG + Intergenic
1113606655 13:111612676-111612698 ATTGCCTTGTTTACCTCTCAGGG - Intronic
1114190319 14:20435652-20435674 ATTGCCTTCCTTTCCTCTGGAGG - Intergenic
1114773571 14:25455993-25456015 CCTTCCTTCCTTTCCTCCCCAGG + Intergenic
1115109635 14:29806077-29806099 CTTGCCTTGCTTTCCTCTCCTGG - Intronic
1115300599 14:31881023-31881045 CTTGCCTGGCATTCTGCTCCTGG - Intergenic
1115445299 14:33483027-33483049 CTTCCTTTGCTTTCCCCACCTGG - Intronic
1117281384 14:54244649-54244671 GTTGCCTTACTTTTGTCTCCAGG - Intergenic
1118305218 14:64649829-64649851 CCTGCCTTGCTATCCTCCCCAGG - Intergenic
1118885459 14:69862110-69862132 CTTGGATTGCTTTCATCTTCTGG + Intronic
1119171114 14:72537041-72537063 CTTGCCTTCCATTCCCTTCCTGG - Intronic
1120160539 14:81140586-81140608 ATTGCCTTCATTTTCTCTCCAGG + Intronic
1121615547 14:95311355-95311377 CCACCCCTGCTTTCCTCTCCTGG - Intronic
1122217977 14:100216465-100216487 CTTGCCTTTCTTCCCTGGCCTGG - Intergenic
1123012373 14:105355689-105355711 CTTCCCCTTCTTTCCCCTCCAGG - Intronic
1123105207 14:105838060-105838082 CTTGCCTGGATATCCCCTCCTGG - Intergenic
1123417261 15:20102948-20102970 CTTGGCTGGCTTTGCTCTCTTGG + Intergenic
1123417465 15:20103827-20103849 CTTGGCTGGCTTTGCTCTCTTGG + Intergenic
1123526537 15:21109802-21109824 CTTGGCTGGCTTTGCTCTCTTGG + Intergenic
1123526840 15:21111105-21111127 CTTGGCTGGCTTTGCTCTCTTGG + Intergenic
1124110285 15:26779203-26779225 CTTCCTTTTCTTTCATCTCCTGG + Intronic
1126280437 15:46941203-46941225 CTTCCTTTGCTTTTCTCCCCTGG - Intergenic
1126469916 15:48998145-48998167 TTTGCCATGCTTTCATCTCAAGG - Intronic
1128255279 15:66191573-66191595 CTTGCCTTCCTCTCCCCTCGGGG - Intronic
1128500585 15:68224652-68224674 CCTGCCTGGTTTTCTTCTCCTGG + Intronic
1128897958 15:71393106-71393128 CTTGGCTTTCATTCCTCCCCAGG - Intronic
1129003485 15:72353127-72353149 CTTTCCCCGCTTTCCTCACCGGG - Exonic
1129461368 15:75701625-75701647 CTGGCCCTCCTTTTCTCTCCCGG + Intronic
1129717655 15:77861548-77861570 GATGCCTTGCTTCCATCTCCTGG - Intergenic
1129723466 15:77890182-77890204 CTGGCCCTCCTTTTCTCTCCCGG - Intergenic
1129964308 15:79720210-79720232 CTTCCCTAGGTTTCTTCTCCAGG - Intergenic
1130461106 15:84158698-84158720 GATGCCTTGCTTCCATCTCCTGG + Intergenic
1130948891 15:88570236-88570258 CCAGCCTTGCTCTCCTCCCCTGG - Intergenic
1131668051 15:94591004-94591026 CTGGCCTGGCTTTCTTCTCTTGG - Intergenic
1133600200 16:7332840-7332862 ATTTTCTTTCTTTCCTCTCCCGG + Exonic
1135575827 16:23584899-23584921 CTGGCCTTGGTCTCCTATCCTGG - Intronic
1136449852 16:30347703-30347725 CTTGCCTTCCGTTCTGCTCCCGG - Intergenic
1137701048 16:50497998-50498020 CTTGCCTTGGTTTCTTCATCTGG + Intergenic
1137713032 16:50580148-50580170 CTTCCTTTGCTGGCCTCTCCAGG + Intronic
1137862841 16:51864171-51864193 CTTTCCCTTCTTTTCTCTCCTGG + Intergenic
1138125963 16:54438661-54438683 CTCTCCTTCCTTTCCTCTCTGGG + Intergenic
1138452287 16:57100636-57100658 CTAGCCTTGGTTTACTCACCTGG + Intronic
1138532857 16:57644165-57644187 CTTCTCTTGCTTTCTCCTCCTGG + Intronic
1138597089 16:58034890-58034912 GCTCCCTTGCTTTCCTCCCCAGG + Intronic
1138955195 16:61963166-61963188 CTTGCTTTGCTTTCTACTCTGGG - Intronic
1139770924 16:69275622-69275644 CTGGCCTTGCCTCCCTCTGCAGG - Intronic
1139891190 16:70254138-70254160 CTTTCCTTGCTTTCCTTTCCAGG - Intronic
1140317785 16:73915725-73915747 CTTGGCTTCCTTTGGTCTCCTGG - Intergenic
1140628980 16:76829277-76829299 CTTGCCTGTCTTCTCTCTCCTGG + Intergenic
1140827632 16:78722176-78722198 CGTGCCTTGGTGTCCTCTACTGG - Intronic
1140875066 16:79143217-79143239 CTTTCCCTGCTTCCCCCTCCTGG + Intronic
1141041001 16:80672467-80672489 CTTTCCTTTCTTTCTTTTCCTGG - Intronic
1141877598 16:86836658-86836680 CTTGGCGTGCTGTCCTCTGCCGG - Intergenic
1203138845 16_KI270728v1_random:1747112-1747134 CTTGCCTGGCTTTGCTGGCCGGG - Intergenic
1143051607 17:4130594-4130616 CTTTCCTGGCTTTTCTCTCCCGG - Intronic
1143471779 17:7179795-7179817 CCTGACTTGCTTCCCTCTCCTGG + Intergenic
1143561280 17:7696720-7696742 CTTCACTTCCTTTCCACTCCTGG - Intronic
1143784987 17:9249282-9249304 CTGGCCTTGCTCTGCCCTCCAGG - Intergenic
1143877180 17:10000875-10000897 CTTCGCTTGCTTTCTGCTCCTGG - Intronic
1143955405 17:10664310-10664332 CGTGCCTTGGTTTCCTCTTCTGG - Intergenic
1145236320 17:21210673-21210695 CTTGCCATGCTTTATTCCCCAGG - Intronic
1145797795 17:27666075-27666097 CTCGCCTTGCTGTTCTATCCAGG + Intergenic
1145972030 17:28961781-28961803 CAGGCAGTGCTTTCCTCTCCTGG + Intronic
1146634436 17:34493644-34493666 CTTGCCTTCCTTACCTGCCCAGG + Intergenic
1146842275 17:36164300-36164322 CTCGCCTTGCTGTTCTATCCAGG + Intergenic
1146854585 17:36252259-36252281 CTCGCCTTGCTGTTCTATCCAGG + Intronic
1146866035 17:36336117-36336139 CTCGCCTTGCTGTTCTATCCAGG - Intronic
1146877843 17:36427232-36427254 CTCGCCTTGCTGTTCTATCCAGG + Intronic
1147068904 17:37936729-37936751 CTCGCCTTGCTGTTCTATCCAGG - Intergenic
1147080428 17:38016266-38016288 CTCGCCTTGCTGTTCTATCCAGG - Intronic
1147084890 17:38056313-38056335 CTCGCCTTGCTGTTCTATCCAGG + Intronic
1147096375 17:38140226-38140248 CTCGCCTTGCTGTTCTATCCAGG - Intergenic
1147100837 17:38180279-38180301 CTCGCCTTGCTGTTCTATCCAGG + Intergenic
1147620168 17:41861202-41861224 CTTGCCAGGCTTTCCTCTCCTGG + Intronic
1148748095 17:49929613-49929635 CATGCCTTGCATTGCTGTCCGGG + Intergenic
1149643211 17:58218771-58218793 CTTGCTTTGTGTTCATCTCCTGG - Intronic
1149647634 17:58251881-58251903 CGTGTCCTGCTTTCCTGTCCAGG + Intronic
1149845430 17:60006743-60006765 CTCGCCTTGCTGTTCTATCCAGG + Intergenic
1149986799 17:61353566-61353588 GTTGCCTTGTCTTCCTCTCTAGG + Intronic
1150083778 17:62263326-62263348 CTCGCCTTGCTGTTCTATCCAGG + Intergenic
1150859849 17:68790292-68790314 CTTGCCTTCCTTTCCTTAACTGG + Intergenic
1151440217 17:74123791-74123813 CTTGCCCTACTTGCCTCTCGGGG - Intergenic
1153573390 18:6495914-6495936 CCTGCTTTGCTTACCTCTCTGGG - Intergenic
1155021657 18:21902247-21902269 CCAGCCTTCCTTTCCTCTGCCGG + Intergenic
1155327171 18:24676157-24676179 ATTGCCTTGATTTCTTTTCCAGG - Intergenic
1156561745 18:38133413-38133435 CTTCCCTCAATTTCCTCTCCTGG - Intergenic
1158116599 18:54003261-54003283 TTTGCCTTTTCTTCCTCTCCAGG - Intergenic
1158620987 18:59032337-59032359 CTACCCTTTCTTTCCTCTCGTGG - Intergenic
1158866060 18:61638758-61638780 CCTTCCTTGGATTCCTCTCCAGG + Intergenic
1159470723 18:68852094-68852116 CCTGCCTTCTTTTCTTCTCCCGG + Intronic
1160104887 18:75964778-75964800 CTCACATTGCCTTCCTCTCCCGG - Intergenic
1161219141 19:3110033-3110055 CGTGCCTTGGTTTCCTGTGCTGG + Intronic
1161346583 19:3771469-3771491 CTTGCTTTGCCTCCCTCCCCAGG + Intronic
1161747740 19:6071429-6071451 CTTGGCTTGATTTTCTGTCCCGG - Intronic
1161751721 19:6102592-6102614 CTCTCCTTGCTTTGCTCGCCAGG + Intronic
1161818697 19:6516166-6516188 CTTCCCCTGCTGTCCGCTCCAGG - Intergenic
1162154727 19:8669794-8669816 CGTGCTTTACTTTCCTCTCTGGG + Intergenic
1162806047 19:13138576-13138598 CCTGCCCTGCGGTCCTCTCCCGG - Exonic
1163104459 19:15115492-15115514 CTGGGCTTGTGTTCCTCTCCTGG - Intronic
1163245865 19:16093781-16093803 CTTGCCCTGCCTTCCCCTCTGGG + Intronic
1163795154 19:19333748-19333770 GTCGCCTTGCTTACCTCTGCTGG + Intronic
1164454259 19:28394084-28394106 CTTCCCTTTATTTCCTCTGCAGG - Intergenic
1164867957 19:31620503-31620525 CTTGCCTTGCCATGGTCTCCAGG - Intergenic
1164873436 19:31666561-31666583 CTTGCCTGACTTCTCTCTCCAGG + Intergenic
1166292540 19:41872237-41872259 CTTTCCTGGCTTGCCCCTCCAGG - Exonic
1166343661 19:42152556-42152578 CTTGCCTTGCTTCCTTTTCCCGG + Intronic
1166943804 19:46384777-46384799 CTTGCCATGTTTTCCTCAGCAGG + Intronic
1167109833 19:47453514-47453536 CCTTCCTTGATTTCCTATCCTGG - Intronic
1168265693 19:55222915-55222937 CTTCCCTTCCTTTCCTTACCCGG - Intergenic
925898974 2:8494972-8494994 CTTGCCTTGATTTTCTCTTAAGG + Intergenic
926384975 2:12327031-12327053 TTTGCCCTGCTCACCTCTCCAGG - Intergenic
926592105 2:14750964-14750986 CATCCTTTTCTTTCCTCTCCGGG - Intergenic
927966836 2:27275632-27275654 CTTGCCTTGCTCGGTTCTCCTGG + Intronic
927996994 2:27493787-27493809 CCTGCTTTTCTTTCCTTTCCTGG + Intronic
928205813 2:29282599-29282621 CCTGCCTTGGTTTCCCCTCTAGG + Intronic
928392346 2:30919333-30919355 CCTGCCTTCCCTTCCTCTCTTGG - Intronic
928883962 2:36127711-36127733 CTTCCCTTGCCTGCCTCTCTGGG - Intergenic
929002575 2:37362716-37362738 CTTCCATTTCTTCCCTCTCCAGG - Intronic
929461201 2:42102876-42102898 CTTCCCTTTCTTTCTTCTCCTGG + Intergenic
929723985 2:44404286-44404308 CATGGCTTGTTTTCCCCTCCAGG + Intronic
931764598 2:65443719-65443741 CTTCCATGGCTTTCCCCTCCTGG - Intergenic
932416779 2:71578357-71578379 CTTGCCATACCTCCCTCTCCAGG - Intronic
932874922 2:75441612-75441634 CTTCCCTAGCTTTCATGTCCAGG - Intergenic
933799666 2:85950644-85950666 CATCCCTTCCCTTCCTCTCCTGG + Intergenic
933813571 2:86048422-86048444 CCTGCCTTGGTTTCCTCACCTGG - Intronic
934646182 2:96060495-96060517 CTTGGATGGCTCTCCTCTCCTGG - Intergenic
935194659 2:100805657-100805679 CTTGCGTTGCTTTCCTCTCTTGG - Intergenic
935329015 2:101962737-101962759 CTTGCCCTGCATTCCTCACAGGG + Intergenic
935465682 2:103395411-103395433 CTTGGCTTGATTCCCTCCCCAGG + Intergenic
935888328 2:107648686-107648708 CTTGGTCTGCTGTCCTCTCCTGG + Intergenic
936869019 2:117110388-117110410 CTTGGTTTGCTGGCCTCTCCTGG - Intergenic
936937163 2:117849502-117849524 CTTGCCTTTCATTCGTCTCCAGG - Intergenic
937590996 2:123613087-123613109 CTTGCATTCCTTTTCTCTACGGG + Intergenic
937835261 2:126465058-126465080 CATGCCTTGATTTCCTCACAGGG + Intergenic
937995746 2:127693367-127693389 CCTTCCTTACTTTCCTTTCCTGG - Intergenic
938036305 2:128037788-128037810 CTTGCCTTCCTTTTCTCTAGAGG - Intergenic
938508350 2:131911324-131911346 ATTGCCTTGCTTTCCACCCTGGG + Intergenic
938579037 2:132629764-132629786 CTAGGCTTGCTTCCCTCTCTGGG + Intronic
938803475 2:134784971-134784993 TTTGCTTTCCTTTCCTTTCCAGG - Intergenic
939937103 2:148306099-148306121 CTTGGCTTGCTATCCTAGCCTGG - Intronic
940291373 2:152080553-152080575 ATGACCTTGCTTTCCTCTCTAGG + Intronic
940893440 2:159057236-159057258 CTTGCCTTCCTCTCATCTACAGG + Intronic
941220324 2:162770968-162770990 CTTGCCTTTTCTTCCTATCCAGG + Intronic
941609339 2:167641709-167641731 CTGGCCTTGGTTTTCTCTGCTGG + Intergenic
941663956 2:168225146-168225168 GTTGCTTTGTTTTCCTCTTCAGG - Intronic
942405203 2:175646633-175646655 CTTGGTTTGCTGGCCTCTCCTGG + Intergenic
944464201 2:199983918-199983940 CTTCACTTTCATTCCTCTCCAGG + Intronic
944614199 2:201443347-201443369 CTTCCCTTCCTTGGCTCTCCTGG + Intronic
946400712 2:219467008-219467030 CATGCCTTGCTGTCCTGGCCAGG + Intronic
946405503 2:219489922-219489944 CTTGCCTGGCTTTCTCCTCCAGG - Exonic
946917910 2:224544952-224544974 CTTGCTTTCCTTTCCTCTAAAGG + Intronic
1169303288 20:4465489-4465511 CTTACCTAGCCTGCCTCTCCTGG - Intergenic
1170430906 20:16275548-16275570 CTAGCCTTGCTCACCTCTCCTGG - Intronic
1170464255 20:16608473-16608495 TTTGCTTTGCTTTGCTGTCCTGG - Intergenic
1170533111 20:17314227-17314249 CCTGCTTTGATTTCCTCTCTAGG + Intronic
1171377396 20:24702836-24702858 CCTGCCTCGCTTTCCTTCCCTGG - Intergenic
1172053339 20:32136802-32136824 CTTTCCATGCTTTTATCTCCAGG - Intronic
1172181842 20:33008356-33008378 CTTGCCTTGCTTGCTTCATCAGG - Intronic
1172571884 20:35976947-35976969 CTTCTGTTGCTTGCCTCTCCTGG + Intronic
1173897950 20:46565247-46565269 CTTCCCTTGCTCTCCTTACCTGG + Intronic
1175199727 20:57268597-57268619 CTTGCTTTGCTTCCCTGGCCTGG - Intergenic
1175965465 20:62658073-62658095 CCTGCCTGGCTTGGCTCTCCCGG + Intronic
1176264599 20:64202589-64202611 CCTGCCTTCCCTCCCTCTCCTGG - Intronic
1176785143 21:13247239-13247261 ATTGCCTTGCTTTCCACCCTGGG - Intergenic
1177648870 21:23935374-23935396 TTTGCCTTGTTTTCCCCGCCAGG + Intergenic
1177688427 21:24470876-24470898 CTTGCCGTGCTTCCCTCCCTAGG - Intergenic
1177983181 21:27940997-27941019 ATTGCCTTGCTTTCCACCCTGGG - Intergenic
1178953793 21:37006294-37006316 CGGGCCTCGCTTTCCTCTCCCGG + Intronic
1179005562 21:37511107-37511129 CCTGCCTTCCATTCCTCCCCTGG - Intronic
1179059350 21:37965321-37965343 TTTGCCTTGCAGGCCTCTCCAGG - Intronic
1179550663 21:42141602-42141624 CTTGTCTTTCTTTGTTCTCCCGG + Intronic
1179674288 21:42971548-42971570 CCTGCCCTGCCTTCCTCCCCCGG - Intergenic
1179958402 21:44754068-44754090 CTTGACTTTCTATCCTCTCTCGG - Intergenic
1181809088 22:25392581-25392603 CTTGCTTTGCTTTTCTCTGAGGG - Intronic
1182585558 22:31342622-31342644 GTTGCTTGGCTTTCCTCTCCTGG - Intronic
1182709214 22:32310189-32310211 GTGGCCTTGCCTCCCTCTCCTGG - Intergenic
1182710590 22:32320558-32320580 CATGCTCTGCTTTCCTTTCCTGG + Intergenic
1183762663 22:39837752-39837774 CTTGCCTGGCTTTACTCTCAGGG - Intronic
1184289346 22:43490118-43490140 CCTGCCTTGTTTTCCTCTACTGG - Intronic
1184344025 22:43901977-43901999 CTTGCCCCACTTTCCTCTCTGGG + Intergenic
1184396811 22:44247124-44247146 GTGGCCTTGCCTCCCTCTCCTGG - Exonic
1184430498 22:44439357-44439379 CTAGCCTCGGTTTCCTCACCTGG - Intergenic
1184431221 22:44442404-44442426 CATGCCTTGGTGTCCCCTCCTGG + Intergenic
1184931171 22:47682364-47682386 CTGGGCTTGCTTTCCTCACGAGG - Intergenic
1185061930 22:48611662-48611684 CTGGCCTTTCTTGCCTCTCCTGG + Intronic
1185170518 22:49291096-49291118 CTTGGCTGGCTTCCTTCTCCCGG + Intergenic
1185349080 22:50325041-50325063 CTTGCCTTTCCTCCCTCACCTGG - Intronic
950169614 3:10829208-10829230 CTTGCCTTACCAACCTCTCCAGG + Intronic
950479995 3:13238203-13238225 CTCCACCTGCTTTCCTCTCCTGG + Intergenic
950488216 3:13285314-13285336 TCTGCCTTGCTTTCCATTCCTGG + Intergenic
950576781 3:13836918-13836940 CTTGCCTTCCTTTCCTACCTGGG - Intronic
950719206 3:14870525-14870547 CTTGCCTGACAGTCCTCTCCTGG + Intronic
951405170 3:22288340-22288362 CTTTTCTTGATTTCTTCTCCTGG + Intronic
952189868 3:31011362-31011384 CTTGTTTTGCCTTCCTCTCTGGG - Intergenic
952339859 3:32436516-32436538 CAAGCCTGGCTTTCATCTCCTGG + Intronic
952786179 3:37157493-37157515 CTTTCCTTGTTTTCCTCTTCTGG - Intronic
953428126 3:42812578-42812600 GTTTGCTTGCTTACCTCTCCAGG + Intronic
953882770 3:46700256-46700278 CCTGCCTGGCTGTCATCTCCGGG + Intergenic
953925981 3:46982568-46982590 CCTGCCTTGGTTTCCCCACCAGG - Intronic
954757992 3:52852524-52852546 CTGGCCTTGCTTTCTGCTGCTGG - Intronic
955086200 3:55705338-55705360 ATTGACCTGCTTTCCTCTCAAGG - Intronic
955149894 3:56356615-56356637 CTGGCCTTTCCTTCCTTTCCTGG + Intronic
955851456 3:63224456-63224478 TTTTCCTTACTTCCCTCTCCTGG - Intergenic
956633005 3:71334432-71334454 CTTCCTTTGCTTTCCTCTCCAGG - Intronic
959391242 3:105776977-105776999 CCTCCCTTTCTCTCCTCTCCAGG - Intronic
960055228 3:113272388-113272410 CTTGCCCTCCTTGCCCCTCCAGG + Exonic
960435568 3:117622438-117622460 TTCTCCTTGCTTTCCTTTCCTGG + Intergenic
960442430 3:117705454-117705476 CTTGCATTTCTTACCTCTGCAGG - Intergenic
961167860 3:124776046-124776068 CTGGCTTTCCTTCCCTCTCCTGG - Intronic
962072128 3:132044515-132044537 CTTGCCTTCCCTTCCTTTCCTGG - Intronic
962325469 3:134428586-134428608 CTTGCTTTACTCACCTCTCCTGG - Intergenic
962476154 3:135757156-135757178 ATTGCCTTGCTTTCTTATCAGGG - Intergenic
962580040 3:136789982-136790004 CTTACCTTACTCACCTCTCCAGG + Intergenic
963310845 3:143708467-143708489 CTCACCTTTCTTTCCTCTCTGGG + Intronic
963555996 3:146789878-146789900 CTTGTCCTGCTTTCTTCTACTGG + Intergenic
963828622 3:149983231-149983253 CTTGAGTCGCTTTCCTCTCTTGG + Intronic
964755541 3:160088266-160088288 CCTCCCTAGCTTTCCTCCCCTGG + Intergenic
965887897 3:173471362-173471384 CTTGCCTTTCTTTCAGCTTCTGG + Intronic
965919516 3:173895380-173895402 GTTTCATTGCTTTCCTTTCCGGG - Intronic
966337546 3:178886144-178886166 CTTGCCTTATTTTCCCCGCCAGG - Intergenic
967777404 3:193398745-193398767 CTTGCCTTTCTTTCCTCCTAAGG + Intergenic
967989511 3:195120768-195120790 CTTGCCTTGTCTTCCCCTCCGGG - Intronic
968963757 4:3759091-3759113 CTGGCCCTCCTCTCCTCTCCTGG + Intergenic
971194178 4:24456237-24456259 CATCCCTTGCCATCCTCTCCAGG - Intergenic
973537486 4:51898162-51898184 CATGCCATGCTTCCCTCTCTAGG - Intronic
974796271 4:66754682-66754704 CTTGCCTTGCTTTGCTATTAAGG - Intergenic
978359723 4:107917652-107917674 CTTGCCTTGCTTACTTCACAGGG - Intergenic
979216541 4:118171276-118171298 CTTGCCAGGATTGCCTCTCCTGG - Intronic
980116555 4:128685216-128685238 CTTGCCTTGGTCTCTTCTTCTGG - Intergenic
980599074 4:134995732-134995754 CTTTCCTTTCTTTCTTCTGCAGG - Intergenic
981531875 4:145761598-145761620 CTTGCGTTGCTTTCCCCGGCAGG - Exonic
981949649 4:150390760-150390782 CATCCTTTGCTTTCCTCTCCTGG - Intronic
982634358 4:157873993-157874015 TTTGCCTCCCTTTCTTCTCCTGG - Intergenic
983180306 4:164640511-164640533 TTTGCCTGGCTTTCCTATCATGG + Intergenic
984693992 4:182760858-182760880 ATTGCCTGTCTTTCCTCTTCGGG - Intronic
985876128 5:2597265-2597287 CTTGCTTTGCTTCCTTCTTCTGG - Intergenic
987540444 5:19247920-19247942 CCTGCCTACCTTTTCTCTCCTGG - Intergenic
987685666 5:21197585-21197607 CTTGCCTTGAATTCTTCCCCAGG + Intergenic
988587792 5:32522813-32522835 CTTGAGTCGCTTTCCTCTCTTGG - Intergenic
988666839 5:33338261-33338283 CTTCCCTTTCTTTCACCTCCAGG - Intergenic
988836221 5:35035316-35035338 CGTGTCTTCCTTTCCTCTCCAGG - Exonic
989118097 5:37976409-37976431 TTTGCCATGCTCTGCTCTCCTGG + Intergenic
990023442 5:51157150-51157172 TTTGCCTTGCTGACCTCCCCTGG - Intergenic
990148192 5:52787270-52787292 CTTGCAATGCTTCCCTTTCCTGG - Intergenic
992319471 5:75597725-75597747 CTTGACTTTCTTTCCTCTAAAGG + Exonic
992434723 5:76745132-76745154 CTTTCCTTTCTGTCATCTCCTGG + Intergenic
993653014 5:90544563-90544585 CTTTCCCTGCTTTCCAATCCTGG + Intronic
994086833 5:95768217-95768239 CTTTCCTTGCTTTCTACTTCAGG + Intronic
994212274 5:97100258-97100280 CTTGAACTGCTTTCGTCTCCAGG + Intronic
994538492 5:101061686-101061708 CTTACCTTGCTTTCATGTCTTGG + Intergenic
995553629 5:113304817-113304839 CTTTTTTTGTTTTCCTCTCCAGG - Intronic
997420215 5:133760758-133760780 CTTGCTTTTTTTTCCTCTCTAGG - Intergenic
997566748 5:134893766-134893788 CTTGCCTTGCCTTCCATCCCAGG - Intronic
999088428 5:148913528-148913550 CCAGCCTTGCTTTCCTCACAAGG - Intergenic
999246669 5:150158620-150158642 CTGGCCTTGGTTTCCTCCTCTGG + Intergenic
999503824 5:152174718-152174740 CTGGCCTTGATTTCTCCTCCAGG + Intergenic
999672033 5:153966344-153966366 GTTGCCTTCCTCTCCCCTCCTGG + Intergenic
1001335542 5:170793509-170793531 CTTCTCTTCCTTTACTCTCCTGG - Intronic
1001698617 5:173690660-173690682 CTTCCCATGCTTCCCTGTCCTGG + Intergenic
1001922898 5:175614391-175614413 CCTGCCTTGCATTGCTCTGCCGG + Intergenic
1001933884 5:175691254-175691276 CTTCCCCTGACTTCCTCTCCAGG - Intergenic
1004113495 6:12744895-12744917 CTTGCCTTACTTCCCTGGCCAGG + Intronic
1005386737 6:25292787-25292809 CTTACCTTCCTCCCCTCTCCAGG - Intronic
1005806443 6:29478090-29478112 CTGGATCTGCTTTCCTCTCCTGG - Intergenic
1006294098 6:33162146-33162168 CTTCCCTAGCCTCCCTCTCCTGG - Intergenic
1006443069 6:34063910-34063932 CCTGCCTTCCTTCCCGCTCCTGG - Intronic
1006610375 6:35291097-35291119 TCTGCCCTGCTTCCCTCTCCAGG - Intronic
1007175919 6:39897330-39897352 CTTGTCTTACTTTCCTCTTTTGG + Intronic
1008682125 6:53883929-53883951 CTTTCCTTTCTATCCTCTTCAGG + Intronic
1009596770 6:65746042-65746064 CTTGGTTTGCTGGCCTCTCCTGG + Intergenic
1011071896 6:83393835-83393857 CTTGCCTTACTGTCTTCTCTGGG - Intronic
1011142225 6:84171120-84171142 CTTCCCTTGCTCCCTTCTCCTGG + Intronic
1013287560 6:108694046-108694068 CTTGCCATCCTTACCTCCCCCGG + Intergenic
1013289390 6:108707723-108707745 CTTGCCAGGCCTTCATCTCCTGG + Intergenic
1013853431 6:114542401-114542423 CATGTGTTGCTTTCATCTCCAGG - Intergenic
1013992152 6:116265699-116265721 CTTGATTTGCTGGCCTCTCCTGG - Intronic
1014860283 6:126458135-126458157 CTTGTTTTACTTTCCTCTTCTGG + Intergenic
1015088405 6:129324887-129324909 TGTGCCTTGGTTTCCTCACCTGG - Intronic
1015832859 6:137388422-137388444 TGTACCTTCCTTTCCTCTCCTGG - Intergenic
1017262404 6:152402417-152402439 CTTCCTTTCTTTTCCTCTCCTGG + Intronic
1017602952 6:156103322-156103344 ATTGCCTTTCTTTCCCTTCCAGG + Intergenic
1018246546 6:161829698-161829720 CTTTGCTTTCTTTGCTCTCCGGG - Intronic
1018431536 6:163726390-163726412 CCTTCCTTGCTTGCCTTTCCTGG - Intergenic
1018463145 6:164018090-164018112 TTTGCCTTCCTTTCACCTCCTGG - Intergenic
1019512493 7:1424769-1424791 CTTGATTTTCTTTCCTCTGCTGG + Intergenic
1021554716 7:21907781-21907803 CTTCCCCTGCTTTACTCTGCTGG + Intronic
1023295233 7:38708078-38708100 CTGGCCTTAGTTTCCTCTTCTGG + Intergenic
1024164402 7:46715634-46715656 CTTGCCCTTCTCTCCTCCCCAGG - Intronic
1024568919 7:50708562-50708584 GTTAGCTTGGTTTCCTCTCCAGG + Intronic
1026141575 7:67711437-67711459 CTTTCCTTTCTCTCTTCTCCTGG + Intergenic
1026509338 7:71015547-71015569 CTTCCTTTTCTCTCCTCTCCTGG - Intergenic
1028183987 7:87759324-87759346 CTTCCCTTGCTACCCTTTCCAGG - Intronic
1028639717 7:93029028-93029050 CTTGGCCTGCTGGCCTCTCCGGG + Intergenic
1029453838 7:100657121-100657143 CTTCCCTTCCCTCCCTCTCCCGG - Intergenic
1032402357 7:131632637-131632659 CTTGCCTTGCTTTCCTTTCTAGG + Intergenic
1032733732 7:134670739-134670761 CATTCCTCACTTTCCTCTCCTGG - Intronic
1032799610 7:135307560-135307582 CCTACCTTGGTTTCCTCCCCAGG - Intergenic
1033174814 7:139114205-139114227 CTTGCATCGCTTCCATCTCCTGG + Intergenic
1033365613 7:140671022-140671044 CTGGCCTTCCCTTCCTCTCCAGG + Intronic
1033779764 7:144654574-144654596 TTGCCCTTTCTTTCCTCTCCTGG - Intronic
1034081016 7:148277636-148277658 CTTGCCTTGCTTCCCAGTCTGGG - Intronic
1034936569 7:155204056-155204078 CTGCCCTTGCTGTCCTCACCTGG - Intergenic
1035683192 8:1503851-1503873 CGTGCCTGGCTTTCCCCTCTTGG + Intronic
1036632126 8:10523369-10523391 CTGGCATTGCTCTCCTCACCCGG + Intergenic
1037654447 8:20871153-20871175 CCTGTCTTGGTTTCCTCACCAGG - Intergenic
1038627862 8:29211375-29211397 CTTCCCTTGTTCTCCTCTCAGGG - Intronic
1038631753 8:29251994-29252016 TTTTCCTTTCTTTCCTTTCCTGG - Intronic
1039251724 8:35673175-35673197 TTTGTCTTGCTTTTCTTTCCAGG - Intronic
1040776091 8:51044794-51044816 CAGGCCCTGCTATCCTCTCCAGG + Intergenic
1042192950 8:66206404-66206426 ATTGCCTTGCTTTTCTCTCTTGG + Intergenic
1043117527 8:76277425-76277447 TTTTCCTTTCTTTACTCTCCTGG + Intergenic
1043888228 8:85627259-85627281 CTTGCCCTGCTTTCCTCTCCAGG + Intergenic
1044052965 8:87532631-87532653 CTTGGCTTGCTATTCTATCCAGG - Intronic
1044873028 8:96638798-96638820 CTTGCATTGGTGTCCTTTCCTGG + Intergenic
1044924702 8:97200473-97200495 CCTGCATTGCTTTTCTCTTCTGG - Intergenic
1048517450 8:135123801-135123823 CTTCCCTTTCCTTCTTCTCCTGG + Intergenic
1048886850 8:138915825-138915847 CTTGCCTTGAATTCTTCTCCTGG + Intergenic
1049432606 8:142572199-142572221 CTCGCCGTGCCTGCCTCTCCTGG - Intergenic
1049693923 8:143974550-143974572 CTGGCCTTGCAGCCCTCTCCTGG + Intronic
1050102524 9:2133964-2133986 ATAGCTTTGCTTTCCTCTCAGGG + Intronic
1050263804 9:3869343-3869365 TTTGCTGTTCTTTCCTCTCCAGG - Intronic
1050475300 9:6034630-6034652 CTTGCTCTGCTGGCCTCTCCTGG + Intergenic
1051107883 9:13601633-13601655 CTTCTCTTTCTTTCCTTTCCAGG - Intergenic
1051256176 9:15216200-15216222 CTTGTCTGTCTTTCCTCTCTAGG + Intronic
1051370528 9:16355317-16355339 CTAGCCATGCTTTCCCCTCCTGG + Intergenic
1052550467 9:29941004-29941026 CTTGCTTTCCTTTCCTCTATTGG - Intergenic
1052689138 9:31793284-31793306 AATGCATTGCTTTCCTCTCTGGG - Intergenic
1053230949 9:36408732-36408754 TTTGTCTGGCTTTCCTCTCCAGG - Intronic
1055003889 9:71483972-71483994 CTTGCCATGCTCTCTTCACCTGG + Intergenic
1055407108 9:75986741-75986763 CTTTCCATGATTTCCTTTCCTGG - Intronic
1055896161 9:81178258-81178280 CTGGCTTTGCTTTTCACTCCAGG + Intergenic
1056762355 9:89424642-89424664 CCTGCCTGGCTTTGGTCTCCTGG + Intronic
1057010993 9:91601129-91601151 CGTGCCTTGCTTGCCCATCCAGG + Intronic
1057367659 9:94438379-94438401 TTTGCTTTGGTTTCCTCTCCAGG + Exonic
1057655669 9:96949682-96949704 TTTGCTTTGGTTTCTTCTCCAGG - Exonic
1058966250 9:110041646-110041668 TTTTCCTTTATTTCCTCTCCAGG - Intronic
1059235508 9:112757656-112757678 TTTGTCTTGCTTTCCCGTCCTGG + Intronic
1059678754 9:116566151-116566173 CTGGCCTTGATTTCTCCTCCAGG + Intronic
1059762857 9:117355593-117355615 CTTGTTTTGCTTTTCTGTCCTGG - Intronic
1060456618 9:123804502-123804524 CTTGACTTTCTTTCCTTTGCTGG + Intronic
1060560529 9:124538855-124538877 TTTGCCTTCCTTTCCTTTCTTGG + Intronic
1061512848 9:131071462-131071484 CTTTTCTTCCTGTCCTCTCCAGG + Exonic
1062493856 9:136822345-136822367 CTTCCCTGGCTCTCCCCTCCTGG + Intronic
1186520097 X:10198530-10198552 CTTGCCATGTTTTGCTCTTCTGG + Intronic
1186835007 X:13428901-13428923 CCTGCCTTTCCTTCCTTTCCAGG + Intergenic
1186960269 X:14728963-14728985 CTCACCTTCCTTACCTCTCCAGG + Intronic
1187585538 X:20657369-20657391 CTTCTCTTGCTCTTCTCTCCAGG - Intergenic
1189334814 X:40164704-40164726 CTTGTTTTTCTTGCCTCTCCTGG + Intronic
1190524125 X:51311135-51311157 CTTGGTTTGCTGGCCTCTCCTGG - Intergenic
1190570867 X:51779927-51779949 CTGGCCCTGCCTACCTCTCCAGG + Intergenic
1191730187 X:64325318-64325340 CTTGCCTGGCTTTGCTATCAGGG - Intronic
1191750300 X:64535374-64535396 CTTGCCTTGCTTTCCACCTCTGG - Intergenic
1191995322 X:67089166-67089188 CTTGCCTTGCCTGCCACTGCTGG - Intergenic
1192872242 X:75195321-75195343 CTTGCTCTGCTGGCCTCTCCTGG - Intergenic
1195620393 X:106948180-106948202 CTTGCTCTGCTTTCTTCTCTTGG - Intronic
1195748040 X:108138091-108138113 CTTGCATTGTCTTTCTCTCCAGG + Exonic
1196097271 X:111813928-111813950 CTTGGATTGCTTTCTTCTCTTGG + Intronic
1196749769 X:119105349-119105371 CTAGCCTTGATTTCCCCTCTGGG + Intronic
1197299795 X:124764166-124764188 CTAGTCATGCTCTCCTCTCCAGG - Intronic
1197645341 X:129011046-129011068 CTTATCGTGCTTTCCTTTCCTGG - Intergenic
1197785724 X:130194831-130194853 CCTGCCTTGCCCTCCCCTCCTGG - Intergenic
1197867407 X:131034008-131034030 CTAGACTTTCTTTCCTCTTCTGG + Intergenic
1198154372 X:133944298-133944320 ATTGCATTTCTTCCCTCTCCTGG - Intronic
1198442160 X:136673666-136673688 CTGCCCTCACTTTCCTCTCCTGG + Intronic
1199046737 X:143183033-143183055 CTTGCATTACCTTCCTATCCTGG + Intergenic
1200210910 X:154346265-154346287 GTTGCTTCCCTTTCCTCTCCAGG + Intergenic
1200219942 X:154385827-154385849 GTTGCTTCCCTTTCCTCTCCAGG - Intergenic
1201755601 Y:17482791-17482813 CGGGACTGGCTTTCCTCTCCCGG + Intergenic
1201845951 Y:18423194-18423216 CGGGACTGGCTTTCCTCTCCCGG - Intergenic
1202378154 Y:24256482-24256504 GATGCCTTGCTTCCATCTCCTGG - Intergenic
1202492628 Y:25413639-25413661 GATGCCTTGCTTCCATCTCCTGG + Intergenic