ID: 1115113333

View in Genome Browser
Species Human (GRCh38)
Location 14:29850908-29850930
Sequence GGTCCTCTATTCTGTCCCAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 13688
Summary {0: 2, 1: 83, 2: 1756, 3: 4018, 4: 7829}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115113333 Original CRISPR GGTCCTCTATTCTGTCCCAT TGG (reversed) Intronic