ID: 1115114221

View in Genome Browser
Species Human (GRCh38)
Location 14:29860245-29860267
Sequence GACCCACTGTGTTGCAGCGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 88}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115114218_1115114221 28 Left 1115114218 14:29860194-29860216 CCTGAAAAAATCAAAGCGATTAT 0: 1
1: 0
2: 0
3: 14
4: 228
Right 1115114221 14:29860245-29860267 GACCCACTGTGTTGCAGCGAAGG 0: 1
1: 0
2: 0
3: 4
4: 88
1115114220_1115114221 -5 Left 1115114220 14:29860227-29860249 CCTTGTTTTTTTAGACATGACCC 0: 1
1: 0
2: 0
3: 16
4: 232
Right 1115114221 14:29860245-29860267 GACCCACTGTGTTGCAGCGAAGG 0: 1
1: 0
2: 0
3: 4
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115114221 Original CRISPR GACCCACTGTGTTGCAGCGA AGG Intronic
900119853 1:1043909-1043931 GGCCCCGTGTGTGGCAGCGACGG + Exonic
901601776 1:10428352-10428374 GCCCCACTGTTTTCCAGCCAGGG - Intergenic
904192743 1:28759911-28759933 GAGCCACTGTGCTCCAGCGTGGG + Intronic
908169186 1:61487978-61488000 GACCCACTGGGGTGCAGTGTAGG + Intergenic
913284183 1:117212054-117212076 GTCTCACTGGGTTGCAGTGAGGG + Intergenic
916555446 1:165890727-165890749 AACCCACTGTCTGGCAGAGAGGG + Intronic
917786031 1:178458371-178458393 GAAGCACTGTGTGGCAGGGATGG - Exonic
920115789 1:203620329-203620351 GACCCACTGAGCTCCAGCTAAGG - Intergenic
920118594 1:203638667-203638689 GTCACACAGTGTTGCAGTGATGG - Intronic
921379584 1:214510770-214510792 GACCTACTGTGTGGTAGCCAAGG - Intronic
922005090 1:221522195-221522217 GACCCACGGAGATGCAGTGAAGG - Intergenic
1064731427 10:18334769-18334791 GAACCACTGAGTTACAGCAAAGG + Intronic
1066482717 10:35812550-35812572 GACTCACAGTGTTGCAGGGCTGG - Intergenic
1069931872 10:71888341-71888363 GTGCCACTGTGTTCCAGCGTGGG + Intergenic
1071575810 10:86725265-86725287 GACCCACTGTGCTTCAGCTGTGG + Intronic
1072822971 10:98576618-98576640 GACCCCCTGTGTTTCACAGAGGG + Intronic
1076627209 10:131829423-131829445 GACCTACTGTGTCCCAGCAAAGG - Intergenic
1077268394 11:1663741-1663763 GACCCCCAGTGTGGCAGCGTAGG + Intergenic
1077272485 11:1687877-1687899 GACCCCCAGTGTGGCAGCGTAGG - Intergenic
1077886583 11:6391738-6391760 GACCCACTGTGCTGCCGCCGGGG + Exonic
1079063967 11:17273883-17273905 GAGCCACTGTGTTTCAGCCTGGG - Intronic
1079383151 11:19956683-19956705 GACACACAGTGTTGCTGGGATGG - Intronic
1081635179 11:44716461-44716483 GACCCAAGGTCTTGCAGCAAAGG + Intergenic
1087498197 11:98917399-98917421 AACCCACTGTCTTGAAGGGAAGG - Intergenic
1094341879 12:29421067-29421089 GACCCACTGTTTTGTGGCCAGGG + Intronic
1101559070 12:105838645-105838667 GACCCTCTCTGTCCCAGCGAAGG + Intergenic
1114179859 14:20356993-20357015 AACCCACTGTGTTAGAGAGAAGG - Intronic
1115114221 14:29860245-29860267 GACCCACTGTGTTGCAGCGAAGG + Intronic
1119416474 14:74473609-74473631 GTCCCACTGGATTGCAGTGATGG + Intergenic
1123825930 15:24082055-24082077 GAGCCACAGTGTTCCAGAGACGG - Intergenic
1124504496 15:30261486-30261508 GACACACTGGGCTGCAGCAAAGG - Intergenic
1124739055 15:32277149-32277171 GACACACTGGGCTGCAGCAAAGG + Intergenic
1134252371 16:12583357-12583379 GACCCACTGTGTCTCAGTGATGG + Intergenic
1135985652 16:27181893-27181915 GACACACTGTGTGGCTCCGATGG + Intergenic
1138638323 16:58362012-58362034 AACCCACTGTCTTGAAGGGAAGG - Intronic
1139282614 16:65783706-65783728 GACCCACTGAGAGGCAGTGATGG + Intergenic
1140713650 16:77702011-77702033 GACCCACAAGGTTGCAGCCAAGG - Intergenic
1141301420 16:82819562-82819584 GCCACACTGTGTTTCAGGGAGGG + Intronic
1141954516 16:87361505-87361527 GACCCTCCCTGTGGCAGCGAGGG + Intronic
1144709659 17:17393170-17393192 GTCCCTCTGTGCTGGAGCGAGGG - Intergenic
1148122475 17:45221392-45221414 GACCCACGGTGGTGCAGCGTTGG - Intergenic
1157317420 18:46603936-46603958 GTCCCACTGGGTTGCAGCCTGGG - Intronic
1163426130 19:17241971-17241993 GACCCACTGCATTCCAGCCAGGG + Intronic
1165025856 19:32960915-32960937 GACTCCCTGAGTTGCAGAGATGG + Intronic
929436172 2:41930261-41930283 GATCCACTGACTTGCAGTGAGGG + Intergenic
936513739 2:113168673-113168695 GACCCACTGCGTGGAAGCAACGG + Intronic
938093519 2:128447901-128447923 GACCCACTGCGTTACAGTGGGGG + Intergenic
942986289 2:182146134-182146156 GAACCACTGTCTTGAACCGATGG - Intronic
945059649 2:205897600-205897622 GTCCCACTGTGTTGCCCAGATGG - Intergenic
947725838 2:232399801-232399823 GAGCCACTGTATTGCAGCCCAGG - Intergenic
1174274589 20:49394548-49394570 GAAACCCTGTGTTGCAGCCAGGG - Intronic
1177828005 21:26105859-26105881 TACCCACTGTGTTGCAGCACTGG + Intronic
951379721 3:21968625-21968647 AACCCACTGTCTTGAAGCAAAGG + Intronic
954987512 3:54808787-54808809 AACCCACTGTGATGCAGCAGTGG + Intronic
958839954 3:99191659-99191681 GACCCACTGCCTTGAAGGGAAGG + Intergenic
960446847 3:117759518-117759540 GTCCCACTGTGCTTCAGAGATGG - Intergenic
966643418 3:182215812-182215834 CACCCTCTGTTTTGCAGGGAAGG + Intergenic
985224781 4:187748207-187748229 GAGCCACTGTGATGGAGCTATGG + Intergenic
986557811 5:9028465-9028487 GACTCACAGTGTTGCAGGGGAGG - Intergenic
993815963 5:92546272-92546294 GACACACTGTGTTGCTGGCAAGG + Intergenic
995943569 5:117614066-117614088 GACTCCCTGTGTTCCAGGGAAGG - Intergenic
1005880327 6:30053107-30053129 GCGCCACTGTGTTGCAGCCTGGG - Intergenic
1007178212 6:39910771-39910793 GAACCTCTTTGTTGCAGAGAAGG - Intronic
1007292499 6:40798199-40798221 GCCCCCCTGTGATGCAGCTAGGG - Intergenic
1007485459 6:42178130-42178152 GACCCTCGGAGATGCAGCGAGGG - Intronic
1011864381 6:91805227-91805249 GACCCCCTGAGTTGAAGAGATGG - Intergenic
1014501604 6:122197484-122197506 GAACCACTGTTTTCCAGCAAAGG + Intergenic
1016352915 6:143186937-143186959 GACCTACTGTGTGGCAGGCACGG - Intronic
1017283742 6:152651061-152651083 CTCTCACTGTGTTGCAGCAATGG - Intergenic
1018375844 6:163211926-163211948 GAGCCACTGTGGTCCAGGGAGGG + Intronic
1019883610 7:3884859-3884881 GGCCCACTCTGTAGCAGAGAAGG - Intronic
1020605735 7:10334270-10334292 GACCCACAGTTTCGCAGGGATGG - Intergenic
1020969178 7:14912647-14912669 GTCCTACTTTGTTGCAGCTAAGG - Intronic
1023254941 7:38303977-38303999 GACTCTCTGTGTTGCAGAGATGG - Intergenic
1024169159 7:46766339-46766361 CACCCACTGAATTGCAGCTAAGG - Intergenic
1029414756 7:100435914-100435936 GAGCCACTTTGATGCTGCGAAGG - Exonic
1034670710 7:152856041-152856063 GAGCCACTGTATTGCAGCCTGGG + Intergenic
1036936021 8:13003533-13003555 GACCCACTGTTTCTCAGCGGTGG - Intronic
1037961240 8:23099896-23099918 GAACCACAGTGATGCAGAGATGG - Intronic
1040852421 8:51914629-51914651 GACACACAGTTTTGCAGGGAAGG - Intergenic
1045027683 8:98104122-98104144 GAACCACTGTGCTGCAGCCTGGG - Intronic
1045441899 8:102222120-102222142 GATCCACTGTGCTGCAGCCTGGG - Intronic
1054879858 9:70133840-70133862 GACCCACTGTTCTCCAGGGATGG - Intronic
1059436486 9:114279808-114279830 GAGCCACTGTGTTCCAGCCTGGG + Intronic
1061569802 9:131470207-131470229 GACCTACGGTGTTACAGTGAGGG - Intronic
1062218608 9:135402561-135402583 GACCCACCGTGTGGCACAGAGGG - Intergenic
1188832521 X:34917448-34917470 GACCCTCTCTGTTGCAGCTCTGG + Intergenic
1190614559 X:52217199-52217221 AACCCACTGTCTTGAAGGGAAGG + Intergenic
1192378830 X:70592735-70592757 GAACCACTGTTTTGGAGCTAGGG - Intronic
1193683498 X:84550881-84550903 GACTCACTGTGTTGCAAGGTTGG + Intergenic
1194978259 X:100414229-100414251 GACCCACTTTTCTGCAGCCAGGG - Intergenic
1197289844 X:124641958-124641980 GACCCAATGTGTTCCAACCATGG - Exonic
1199345484 X:146733891-146733913 GACCCTCTGTGTTGGAGGTAGGG + Intergenic