ID: 1115114292

View in Genome Browser
Species Human (GRCh38)
Location 14:29861138-29861160
Sequence AGGTGCTAGTCATAGTTTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 94}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115114292_1115114294 30 Left 1115114292 14:29861138-29861160 CCAACAAACTATGACTAGCACCT 0: 1
1: 0
2: 0
3: 6
4: 94
Right 1115114294 14:29861191-29861213 CAGCTTTGAAGAAAAAAAAATGG 0: 1
1: 1
2: 37
3: 204
4: 1710

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115114292 Original CRISPR AGGTGCTAGTCATAGTTTGT TGG (reversed) Intronic
901039611 1:6356033-6356055 AGGTGACATTCATAGTTTCTGGG - Intronic
904984625 1:34534773-34534795 AGGTGATAGTCATCTTTGGTGGG - Intergenic
911880481 1:103232322-103232344 TGGTGCTAGTTATAGATTTTAGG + Intergenic
916376266 1:164156763-164156785 AGGTGCCAATCATAGTGTTTAGG - Intergenic
918431201 1:184462626-184462648 AGCTGCTATTCATATTTTTTTGG + Intronic
1068046073 10:51887855-51887877 AGGTGGTAGCCAGAGGTTGTGGG + Intronic
1073976566 10:109108550-109108572 AGGTCCTAGGCAGAGTTTGATGG - Intergenic
1081393943 11:42562794-42562816 AGGTGCTAGTGAAGGTTTGTAGG - Intergenic
1083480907 11:62946100-62946122 AGGTGCTAGGAAAAGTTTGAAGG + Intronic
1086938677 11:92771592-92771614 AGCTGAGAGACATAGTTTGTAGG + Intronic
1087140951 11:94765648-94765670 AAGTGCTAGGCACAGCTTGTGGG - Intronic
1098010743 12:66048650-66048672 AGGCGCTGGTCATATATTGTAGG - Intergenic
1099243788 12:80170401-80170423 ATTTTCTACTCATAGTTTGTTGG + Intergenic
1102042289 12:109808635-109808657 AGGTACTAGCTATAGTTTGTTGG - Intronic
1106478911 13:30122161-30122183 AGATGCAAGTCTTTGTTTGTAGG - Intergenic
1113241381 13:108341717-108341739 AGGTGCTAGTAAGAATTTGGAGG - Intergenic
1114841442 14:26267342-26267364 AGGTGCCAGGCATAGTTTTGAGG + Intergenic
1115114292 14:29861138-29861160 AGGTGCTAGTCATAGTTTGTTGG - Intronic
1116086053 14:40239155-40239177 AGGTTCTACACATACTTTGTTGG - Intergenic
1117492729 14:56268043-56268065 AAATGCAAGTCCTAGTTTGTTGG - Intronic
1125092698 15:35812855-35812877 GGCTGGTAGTCACAGTTTGTGGG - Intergenic
1125111242 15:36037294-36037316 AGTTGCTGGTCATAGGATGTAGG - Intergenic
1133758308 16:8778890-8778912 AGGTCCTAGTCATAGGTTCCAGG + Intronic
1135379818 16:21986297-21986319 AGGTGCTTGGTATTGTTTGTGGG + Intronic
1137625763 16:49907339-49907361 AGGAGATAATCATAGTTTTTAGG - Intergenic
1144254021 17:13447783-13447805 AGGTGCTTGCCATAGTGTCTTGG - Intergenic
1144382330 17:14714504-14714526 AGGAGCTAGTCTTTTTTTGTTGG + Intergenic
1154047352 18:10918686-10918708 ATGTGCTGGTCTTAGTGTGTGGG - Intronic
1154173956 18:12070406-12070428 ATGTGCTGGTCTTAGTGTGTGGG + Intergenic
1156466205 18:37349116-37349138 AGGTGCTGGACACAGTTTGAAGG + Intronic
1162120202 19:8460784-8460806 AGGTGGTAGTCATAGCTGGTAGG + Intronic
1163116722 19:15193184-15193206 AGGTCCTAGTCACAGGTTCTGGG - Intronic
928044875 2:27920046-27920068 AGGGTCTAGCCATAGTTTTTAGG + Intronic
934473717 2:94578338-94578360 AGATGGTAGTCATTGATTGTAGG - Intergenic
935862987 2:107354015-107354037 AGGTTTTAGTCATAATTTCTTGG - Intergenic
939594038 2:144102983-144103005 AGGTGATAGTGAAAGTTTGGTGG - Intronic
947610954 2:231524910-231524932 AGGTGCTGGTCAGAATTTCTAGG + Exonic
1170586112 20:17735388-17735410 ATGTGCTTGTCAAAGTTTGAAGG + Intronic
1170714950 20:18823553-18823575 AGGTACTAAGCATAGTTTTTAGG + Intronic
1173870145 20:46336492-46336514 AGGTGCTAGGCTTAGTATCTGGG + Intergenic
1176151966 20:63596031-63596053 AGGTGCCCGTCAGAGTCTGTGGG + Intronic
1178901219 21:36600776-36600798 AGGTGCTATTCATGGTTTCTGGG + Intergenic
1182328094 22:29529616-29529638 AGGTGAGAGTCATTGTTTCTGGG - Intronic
956501350 3:69888932-69888954 AGGTGCTTGTCAAAGTGTATTGG + Intronic
957506500 3:81127557-81127579 TGGTTGTTGTCATAGTTTGTTGG - Intergenic
960457203 3:117886974-117886996 AGGTTGTAGTCATAGTTAGCAGG - Intergenic
960642407 3:119839064-119839086 TTGTACTAGTCAAAGTTTGTTGG + Intronic
962417917 3:135200778-135200800 AAGTGCTAATCATATTTTGGGGG + Intronic
967784483 3:193476175-193476197 TGGTGTTAGTCATTGTTTCTAGG - Intronic
972112454 4:35581365-35581387 AGGAGATAATCATAGTTTCTTGG - Intergenic
974258799 4:59497746-59497768 AGCTGCTACTCATTGTTTATGGG + Intergenic
978161893 4:105558500-105558522 AGGTGTGTGTCATAGTTTGAAGG + Intronic
981348934 4:143706272-143706294 AGCTACTGGTCATATTTTGTAGG - Intergenic
983130332 4:164011721-164011743 AGGTGCTATTCTTAGTTTTTTGG - Intronic
987076668 5:14388979-14389001 AGTTGCCAGTCATAATTAGTAGG - Intronic
988659401 5:33248243-33248265 AGGTCCTAGTCATACTTGTTAGG - Intergenic
989373224 5:40731854-40731876 AAGTGGTACTCATAGTTAGTGGG - Intronic
1000832230 5:166117057-166117079 AGGTAGTAGTCAAAGTTTCTGGG + Intergenic
1002997049 6:2296733-2296755 ATATGTTAGTGATAGTTTGTGGG - Intergenic
1005058643 6:21755532-21755554 TGGTGCTAGACGTTGTTTGTAGG + Intergenic
1005074703 6:21895588-21895610 AAGGGCAAGTTATAGTTTGTGGG + Intergenic
1007000239 6:38305012-38305034 ATGTGCTAGGCATTGTTTCTTGG - Intronic
1008497653 6:52149451-52149473 ATGTGCTAGGCATATTTGGTGGG - Intergenic
1011360612 6:86520256-86520278 AGGGGCTAATCAAAGTCTGTTGG - Intergenic
1013188684 6:107783758-107783780 AGGTGCTGGTCTGAGTTTGGAGG + Intronic
1013805325 6:113990039-113990061 AGGTGCTGAAAATAGTTTGTTGG + Intronic
1016560366 6:145389616-145389638 ATGTGCTAGGCATTGTTTCTAGG - Intergenic
1020454693 7:8358641-8358663 AGGTGCTACTCAAAGTGTGGAGG - Intergenic
1023546180 7:41319682-41319704 AAGTGGAAGTCATAGTTGGTTGG + Intergenic
1028819679 7:95192690-95192712 AGGTGGTATTTATAGTTTGGTGG + Intronic
1030628765 7:111872695-111872717 GAGGGCTAGTCATAGTTTGTGGG - Intronic
1032499421 7:132388916-132388938 AGCTGCCAGTCATGGCTTGTGGG - Intronic
1034407260 7:150913323-150913345 AGGTGCTAAGCAGAGTTTCTGGG - Intergenic
1034640834 7:152601152-152601174 AGGAACTAGTCAGAGTTGGTTGG + Intergenic
1041658090 8:60374551-60374573 AGGTGATAGTTATAGGTGGTGGG + Intergenic
1042395351 8:68285737-68285759 AGGTCCTAGTCTAATTTTGTAGG + Intergenic
1042999720 8:74743016-74743038 AACTGCTAGTTATAGTTAGTGGG - Intronic
1048214468 8:132481614-132481636 AGGTGCTATTCAAAGATTGGGGG - Intergenic
1053684613 9:40510174-40510196 AGATGGTAGTCATTGATTGTAGG + Intergenic
1053934579 9:43138452-43138474 AGATGGTAGTCATTGATTGTAGG + Intergenic
1054279113 9:63114791-63114813 AGATGGTAGTCATTGATTGTAGG - Intergenic
1054297707 9:63345636-63345658 AGATGGTAGTCATTGATTGTAGG + Intergenic
1054395723 9:64650147-64650169 AGATGGTAGTCATTGATTGTAGG + Intergenic
1054430367 9:65155342-65155364 AGATGGTAGTCATTGATTGTAGG + Intergenic
1054500013 9:65866179-65866201 AGATGGTAGTCATTGATTGTAGG - Intergenic
1056272601 9:84961137-84961159 AGGTTCTAGACATAGTTTACAGG - Intronic
1056691112 9:88809326-88809348 AGGTTCCAGTCATACTTTCTAGG + Intergenic
1186381383 X:9063834-9063856 AGCTTCAAGTCATTGTTTGTAGG + Intronic
1186430049 X:9497591-9497613 AGGTGCTAATCACAGATAGTTGG + Intronic
1189141786 X:38614627-38614649 AGGTGCTTCTCACACTTTGTGGG - Intronic
1193141252 X:78029475-78029497 GGGTGCTATTGATAGTTTGGTGG - Intronic
1193273783 X:79561122-79561144 ATATGCTAGTCATTGTCTGTGGG - Intergenic
1194202043 X:90964080-90964102 AGGTACTAGTCTTAGTATCTCGG + Intergenic
1194766796 X:97851320-97851342 AGGTGGAAGTCACAGTATGTTGG - Intergenic
1195842329 X:109187851-109187873 AGGTGGTAGTAGTAGTGTGTAGG - Intergenic
1197146537 X:123178432-123178454 AGGGGCTAGTTTTAGTTTGGGGG + Intergenic
1197810063 X:130433361-130433383 AGGTGCTAGTAAATATTTGTGGG - Intergenic
1198480331 X:137034363-137034385 AGGGGCTATTCATACTTTGGAGG - Intergenic
1199379804 X:147157045-147157067 AGGTGTTAGTAGTAGTTTCTGGG - Intergenic
1200547880 Y:4539531-4539553 AGGTACTAGTCTTAGTATCTCGG + Intergenic
1200797168 Y:7351373-7351395 AGGTCCCATTCATAGGTTGTTGG + Intergenic