ID: 1115114838

View in Genome Browser
Species Human (GRCh38)
Location 14:29867698-29867720
Sequence GTACAGAGGCAGAATGAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 316
Summary {0: 1, 1: 0, 2: 3, 3: 23, 4: 289}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115114833_1115114838 2 Left 1115114833 14:29867673-29867695 CCCATGGCTGTGCCATGAAGGAG 0: 1
1: 0
2: 1
3: 11
4: 186
Right 1115114838 14:29867698-29867720 GTACAGAGGCAGAATGAGCCAGG 0: 1
1: 0
2: 3
3: 23
4: 289
1115114834_1115114838 1 Left 1115114834 14:29867674-29867696 CCATGGCTGTGCCATGAAGGAGT 0: 1
1: 0
2: 3
3: 13
4: 208
Right 1115114838 14:29867698-29867720 GTACAGAGGCAGAATGAGCCAGG 0: 1
1: 0
2: 3
3: 23
4: 289
1115114837_1115114838 -10 Left 1115114837 14:29867685-29867707 CCATGAAGGAGTGGTACAGAGGC 0: 1
1: 0
2: 0
3: 10
4: 188
Right 1115114838 14:29867698-29867720 GTACAGAGGCAGAATGAGCCAGG 0: 1
1: 0
2: 3
3: 23
4: 289

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115114838 Original CRISPR GTACAGAGGCAGAATGAGCC AGG Intronic
900093900 1:932630-932652 CTGCAGAGGCAGAAGGACCCAGG - Intronic
900294839 1:1943651-1943673 GGACACAGGCAGGGTGAGCCTGG - Intronic
900388131 1:2419877-2419899 GTTCCGAGGCAGAAAGGGCCTGG - Intergenic
900476199 1:2877521-2877543 GCACAGAGGCAGAGTGACCTGGG + Intergenic
900595761 1:3479489-3479511 GACCAGAGACAGCATGAGCCAGG - Intronic
900676538 1:3890690-3890712 GTGCAGAAGCAGAATGAGCCAGG - Exonic
901321783 1:8344456-8344478 GTGCTGAGGTAGAGTGAGCCTGG + Intergenic
902116023 1:14121911-14121933 GCCCAGAGGCAGAAGGTGCCTGG + Intergenic
902638233 1:17749254-17749276 GTTCAAAGGCTGAATGAGCCAGG - Intergenic
902836664 1:19051844-19051866 GGGAAGGGGCAGAATGAGCCTGG - Intergenic
903228740 1:21909134-21909156 GGACAGAGCCAGAAGGAGTCAGG + Intronic
903432021 1:23311913-23311935 GTACAGAGCCAGAAAAGGCCTGG + Intronic
904041836 1:27589939-27589961 CTCTGGAGGCAGAATGAGCCTGG - Intronic
904345903 1:29869160-29869182 GCACACAGCCAGAATGAACCTGG + Intergenic
904633827 1:31864213-31864235 GTCAAGAGGCAGAAGGAGCAGGG + Intergenic
905733728 1:40312649-40312671 GTAGAGAGGAAGTAGGAGCCGGG - Intronic
906052794 1:42888446-42888468 GTACAGACGCAGGCTGTGCCGGG + Intergenic
906230424 1:44157961-44157983 GGACACAGGCAAAAAGAGCCTGG - Intergenic
908890187 1:68837693-68837715 CTACAAAGGCAGATTGAGCTTGG - Intergenic
908934142 1:69354064-69354086 GTAAAAATGCAGAATTAGCCAGG - Intergenic
909457371 1:75865514-75865536 GTCGAGAGGCAGAAGGAGCAAGG + Intronic
912091056 1:106076906-106076928 GGATTGAGACAGAATGAGCCAGG + Intergenic
912609429 1:111028273-111028295 GTACAGAGACAGAAGGAGGGGGG - Intergenic
913369144 1:118077588-118077610 ATATAGAGTCAGAATAAGCCAGG - Intronic
913446947 1:118960164-118960186 AAACAGAGGCAGAAATAGCCAGG - Intronic
914240306 1:145848663-145848685 GGAAAGGTGCAGAATGAGCCAGG + Exonic
915892442 1:159784219-159784241 GAACAGAGGCAGAAAGGGCAAGG - Intergenic
916270111 1:162931744-162931766 CTATACAGGCAGAATGAGCAGGG - Intergenic
916858261 1:168774493-168774515 GTAGAGAGACAGAAAGAGTCTGG + Intergenic
916887249 1:169081870-169081892 GTACAGTGGGAGAATAAGCCTGG + Intergenic
921328758 1:214014701-214014723 GGGCAGAGGCAGATCGAGCCAGG + Intronic
922517036 1:226215283-226215305 GTACAAATGCAGAATGTGCCAGG - Intergenic
922677630 1:227562238-227562260 ATAGAGAGGCAGAGTGAGTCAGG - Intergenic
923097867 1:230789741-230789763 GTACAGAGGAAGACTCAGTCTGG + Intronic
924816496 1:247446473-247446495 GTACTGGGGCAGAATAAGCAAGG - Intronic
924908766 1:248486144-248486166 GTACAGAAGAAGAATGAACAGGG + Intergenic
924915341 1:248561918-248561940 GTACAGAAGAAGAATGAACAGGG - Intergenic
1062785111 10:258164-258186 TTACAGAGGCAGAATGAAGGAGG + Intergenic
1065282197 10:24150893-24150915 GTACTGAGGCAGCATGCTCCTGG + Intronic
1065980189 10:30887282-30887304 GTCAGGAGGCAGAAGGAGCCAGG - Intronic
1066256511 10:33684510-33684532 CTACAGAGGGAGCATCAGCCAGG - Intergenic
1069725422 10:70574481-70574503 GTGCAGAGGCAGAATGAACCTGG + Intergenic
1069773954 10:70916170-70916192 GCACAGAGGAAGCATGAGGCTGG - Intergenic
1070427598 10:76304579-76304601 GTGCAGAGGCTGACTTAGCCTGG + Intronic
1070736516 10:78867028-78867050 GTCCTGAGGCAGCAGGAGCCTGG - Intergenic
1071218548 10:83435545-83435567 GTGCACAGGCAGAATGAACCTGG + Intergenic
1074448307 10:113538392-113538414 GTCCAAAGGGAGAATCAGCCTGG + Intergenic
1074904577 10:117850223-117850245 GTACACCTGCAGAATGAACCTGG + Intergenic
1075218017 10:120555626-120555648 GTGCAGAGACAGAAAGAGCACGG + Intronic
1076464360 10:130668141-130668163 GGACAGAGGCAGAATGCAACAGG + Intergenic
1077278241 11:1728038-1728060 GGTCAGGGGCAGGATGAGCCAGG - Intergenic
1080461516 11:32458883-32458905 CTGCAGAGCCATAATGAGCCTGG - Intergenic
1081295335 11:41379705-41379727 GTACTGAGGCACACTGAGGCAGG - Intronic
1081545874 11:44071220-44071242 GTACAGAGGCAGAGTTAGCATGG - Intronic
1083180047 11:60979398-60979420 TTAAAGAGGCACCATGAGCCAGG + Intronic
1083986121 11:66216664-66216686 GTACAGGGACAGAATGAGGGTGG - Intronic
1084599356 11:70135740-70135762 GGAGAGAGGCTGAAGGAGCCCGG + Intronic
1084726753 11:70946841-70946863 GTGGAGAGGGAGGATGAGCCTGG - Intronic
1084726802 11:70947023-70947045 GTGCAGAGGGAGGTTGAGCCTGG - Intronic
1085273660 11:75284606-75284628 ATAGAGAGGCAAAATGGGCCGGG + Intronic
1086332131 11:85764603-85764625 GTACAGAGGGAGAAACAGCAGGG - Intronic
1088288049 11:108207547-108207569 GGACCGAGGCAGCATGAGGCTGG + Intronic
1088430461 11:109752874-109752896 ATACACAGGCAGAATGATACAGG - Intergenic
1089281236 11:117376100-117376122 GTAAAGAGGATGAATGGGCCAGG - Intronic
1089536307 11:119162478-119162500 AATCAGAAGCAGAATGAGCCTGG - Exonic
1090161024 11:124495665-124495687 GAACAGAAGCAGATTGATCCTGG - Intergenic
1090205671 11:124882774-124882796 GTTGAGAGGCTGAATGAGGCAGG - Intergenic
1090674797 11:128981434-128981456 GTTCAGCGGCAGAATCAGCATGG - Exonic
1091334365 11:134755324-134755346 GTCCAGATGCAGCATGAGCAGGG - Intergenic
1091621565 12:2093137-2093159 TTACAGAGTCAGAAAGAGCAAGG + Intronic
1092004630 12:5058893-5058915 ATACACAGGGTGAATGAGCCAGG - Intergenic
1092222362 12:6723784-6723806 GAACAGACACAGAATGGGCCGGG + Exonic
1094220324 12:27985960-27985982 ATTCAGAGGAAGGATGAGCCTGG + Intergenic
1096718773 12:53506185-53506207 GCCCAGAGGCAGAAAGAGCAGGG - Exonic
1098167478 12:67713231-67713253 GTACAGAGACAGAAGGAGCAGGG - Intergenic
1099656349 12:85497182-85497204 GTACAGAGGCAGCAGGAGAGTGG - Intergenic
1100073138 12:90746195-90746217 GTACAGGTGCAAAATGAGCAAGG + Intergenic
1101373302 12:104149975-104149997 GTGCTGAGGCAGGCTGAGCCTGG + Intergenic
1101456091 12:104832278-104832300 CTACATAGGAAGAAAGAGCCAGG - Intronic
1101905907 12:108826352-108826374 GAACAGAGGCAGAGTGTTCCAGG - Intronic
1102382555 12:112479870-112479892 GTAAAGAGGAAGAATGAGACAGG - Intronic
1102547865 12:113669819-113669841 GGAAAGAGCCAGAATGAGCCCGG + Intergenic
1102762312 12:115398696-115398718 GTTCAGAGGCAGCAGGAGCTGGG - Intergenic
1103359762 12:120346638-120346660 GAACGGAGGCAGGAGGAGCCCGG - Intronic
1106230187 13:27815476-27815498 GTGAAGAGGCTGGATGAGCCAGG - Intergenic
1106356912 13:28991898-28991920 GTACAGAGACAGAATCACACTGG - Intronic
1107723683 13:43276299-43276321 TTACAGAGGCAGGATGGGGCGGG - Intronic
1110827743 13:79992172-79992194 GGACAGAGGGAGAAGGAGCCAGG - Intergenic
1111969051 13:94891590-94891612 GTGGAAAGGCAGAAAGAGCCTGG - Intergenic
1112029971 13:95447963-95447985 AAGCAGAGGCAGAAAGAGCCTGG - Intronic
1113803274 13:113097138-113097160 GTCCAGAGGCAGAAGCAGCACGG - Intronic
1114390012 14:22297468-22297490 GTTCAAAGGCAGAATGTGCCAGG - Intergenic
1114701523 14:24683259-24683281 ATAAAGAGACAGACTGAGCCTGG - Intergenic
1114962979 14:27918317-27918339 GTACAGAGACAGAATGGGTGGGG - Intergenic
1115114838 14:29867698-29867720 GTACAGAGGCAGAATGAGCCAGG + Intronic
1116182714 14:41555402-41555424 GTACAGAGGTAGAAAGAAACAGG - Intergenic
1117187171 14:53251975-53251997 GTCCACAGGCAGAAAGACCCTGG - Intergenic
1117843294 14:59883087-59883109 GTCCATAGACAGAAGGAGCCTGG - Intergenic
1119371012 14:74143251-74143273 TGACAGAAACAGAATGAGCCTGG + Intronic
1120532312 14:85646825-85646847 GTCAAGAGGCAGAACCAGCCTGG - Exonic
1122427280 14:101619460-101619482 GGCCAGAGGCTGAATGTGCCAGG + Intergenic
1123059343 14:105587426-105587448 GTACAGAGGGAAACTGAGGCAGG - Intergenic
1123083675 14:105707657-105707679 GTACAGAGGGAAACTGAGGCAGG - Intergenic
1126755697 15:51923089-51923111 GTGAAGAGGCAGAAGGGGCCAGG + Intronic
1126786004 15:52178503-52178525 GAAGAAAGGCAGAAGGAGCCTGG + Intronic
1127285121 15:57525919-57525941 GCACAGAGGCAGAAGGATTCAGG + Intronic
1127381956 15:58438229-58438251 GGAGAGAGGCAGAAAGAGGCTGG + Intronic
1127553712 15:60066428-60066450 GCAGAGAGACAGAATGAGCCAGG - Intergenic
1127588877 15:60402832-60402854 GTACAAAGCATGAATGAGCCTGG - Intronic
1128523439 15:68390626-68390648 CCACAGAGGCAGGAAGAGCCTGG + Intronic
1128551406 15:68600323-68600345 GCACAGTGGCAGAATGGGGCTGG - Intronic
1128772591 15:70293274-70293296 ATACAGATATAGAATGAGCCTGG + Intergenic
1128922948 15:71628864-71628886 GGAAACAGGCAGAATGAGGCTGG + Intronic
1129726546 15:77904425-77904447 GCAGAGAGGCAGCATGACCCTGG - Intergenic
1130174575 15:81554898-81554920 GGACAGGGGCAGAAAGAGTCAGG - Intergenic
1131479626 15:92769701-92769723 GTAAAAAGGCAGAATGAGATCGG - Intronic
1131564122 15:93470365-93470387 GTACAGAGGCAGAGGGAGGGGGG - Intergenic
1131829080 15:96343005-96343027 GACCCGAGGCAGAATGGGCCTGG + Intergenic
1132755975 16:1485735-1485757 GAACAGAGACAGAGAGAGCCTGG - Intergenic
1132900270 16:2250379-2250401 GTTCAGAGGCACCAGGAGCCTGG + Intronic
1133078586 16:3299699-3299721 ATTCAGAGGAAGGATGAGCCGGG + Exonic
1133489779 16:6256375-6256397 GGACTGAGGCAGAAGGAGGCAGG + Intronic
1133771137 16:8867803-8867825 GAACAGAGGCAGAGAGAGGCTGG + Intronic
1134666830 16:16024833-16024855 GTAGAGAGGGAGGCTGAGCCAGG + Intronic
1135522594 16:23188953-23188975 GGGCAGAGGCAGAGTGAGCTGGG + Intronic
1136472479 16:30490509-30490531 GTGAAGAGGCAGGAGGAGCCAGG - Intronic
1136654812 16:31703444-31703466 GCACAGGGCCAGAAAGAGCCAGG - Intergenic
1137507168 16:49064245-49064267 GCACAGAGGCAGAGGGAACCTGG - Intergenic
1138815732 16:60200882-60200904 CTTTAGAGGCAGGATGAGCCAGG - Intergenic
1141158842 16:81616001-81616023 GCACTGGGGCAGAAGGAGCCGGG + Intronic
1141306343 16:82867402-82867424 ATACAGAGACAGGATGAGCTTGG - Intronic
1142604389 17:1073562-1073584 GTTCAGTGGAAGACTGAGCCTGG - Intronic
1142683998 17:1566822-1566844 GAACAGAGAGAGAATGAGACAGG - Intergenic
1142976570 17:3648240-3648262 GTGCAGAGACAGAAGGAGCTGGG - Intronic
1143101288 17:4506151-4506173 GGACAGAGGCTGCAGGAGCCAGG - Intronic
1143270585 17:5672115-5672137 GGACACAGGCAGATTGAGCGGGG - Intergenic
1143925046 17:10362175-10362197 CTACAGAGGCAAAAAGCGCCAGG - Exonic
1143930519 17:10418702-10418724 CTACAGAGGCAAAAAGCGCCAGG - Exonic
1144127962 17:12220450-12220472 GTACAGAGACAGAAGGAGGGGGG + Intergenic
1144345540 17:14346026-14346048 GTACACAGGCAGGAAGAGACAGG - Exonic
1146011617 17:29198909-29198931 GTACAGTGGCATGATGAGCTCGG - Intergenic
1146506024 17:33406053-33406075 GTCAGGAGGCAGAAGGAGCCAGG - Intronic
1146561080 17:33871201-33871223 GTTCAGAAGCTGAATGAGGCTGG + Intronic
1147367873 17:39971172-39971194 GTGAAGAGGAAGAAGGAGCCAGG + Intronic
1148018076 17:44536573-44536595 GGACAGAGGGAGAATGAGCCAGG - Intergenic
1148100626 17:45088456-45088478 GGAAAGAGGCAGATTGAGGCTGG + Intronic
1148835699 17:50464700-50464722 GAACAGAGGAAGGATGATCCTGG + Exonic
1148911878 17:50947230-50947252 GTCCTGAGGAAGCATGAGCCTGG - Intergenic
1149065090 17:52469763-52469785 ATACAGAGTGAGAAAGAGCCTGG + Intergenic
1151139139 17:71975233-71975255 GGAAAGAGGCAGAAGGAGTCTGG + Intergenic
1151198064 17:72445882-72445904 GGACAGAGGCAGTATGTGCCCGG - Intergenic
1151236731 17:72725732-72725754 GTAGTGTGGCAGGATGAGCCAGG + Intronic
1158896744 18:61921352-61921374 GTGCAGAGGCAGGATCAGCCAGG - Intergenic
1160063804 18:75556004-75556026 GGAGATAGGCAGAATGAGACAGG - Intergenic
1160295519 18:77633428-77633450 GGACAGATGCAGCAGGAGCCAGG + Intergenic
1160852362 19:1198811-1198833 ATAAAGAGGCAGAGTGAGCCGGG - Intronic
1161495544 19:4584124-4584146 GGACAGTGGCAGGATGGGCCAGG + Intergenic
1161678074 19:5664199-5664221 GTTCTCAGTCAGAATGAGCCAGG - Intronic
1164154908 19:22587539-22587561 GTACAGTGGTAGACTGAGCTTGG + Intergenic
1164398353 19:27885758-27885780 GTACAGAGACAGAGTGAGGGGGG - Intergenic
1165466804 19:35979422-35979444 GGACAGAGCCAGCATGAGGCAGG + Intergenic
1166108878 19:40610966-40610988 CTACAGAGACAGAACCAGCCAGG + Intronic
1166168527 19:41009721-41009743 TCACAGAGGCAGAAAGAGACGGG + Intronic
1167081020 19:47276057-47276079 GGACAGAGGCTGAATCACCCAGG + Intergenic
1167462274 19:49631900-49631922 TTGCAGAGGAGGAATGAGCCCGG - Intergenic
1167870247 19:52363059-52363081 GTACAGAGACAGAGTGAGGGGGG + Intronic
1168583004 19:57570805-57570827 GTAGAGAATCAGAAGGAGCCTGG - Intergenic
925313346 2:2903572-2903594 GTACAGAGCCAGCAGCAGCCGGG - Intergenic
926420163 2:12688003-12688025 CTCCAGAGTCAGAATGTGCCAGG - Intergenic
926647989 2:15310738-15310760 GTTTAGAGGCAGAAGGAGCCAGG - Intronic
927803691 2:26125498-26125520 GTACAGAGGCATGATGATCATGG + Intronic
929040343 2:37738417-37738439 GTCAGGAGGCAGAAGGAGCCAGG + Intronic
931696399 2:64873786-64873808 GTACACAGGCAGAAGCAGGCTGG - Intergenic
931850918 2:66249703-66249725 GGACAGAGTCAGATTGGGCCAGG - Intergenic
933661589 2:84931836-84931858 GTCAAGAGGCAGAGTGAGCCAGG - Intergenic
935790527 2:106585866-106585888 GAACAGAGGTGGAAGGAGCCAGG - Intergenic
937148903 2:119672389-119672411 GGAGGGAGGCAGAAGGAGCCAGG + Intergenic
937235067 2:120426189-120426211 GGACAGAGACAGAGAGAGCCAGG - Intergenic
938112391 2:128577655-128577677 GTACAGAGACAGAAGCAGCAAGG - Intergenic
939896550 2:147798713-147798735 TTAGAGTGGCAGAATTAGCCAGG + Intergenic
941586599 2:167366910-167366932 GCACAAAGGCAGAAGGTGCCAGG + Intergenic
942314468 2:174684541-174684563 GTACAGAAGCAGAGAAAGCCGGG - Intergenic
943745135 2:191454365-191454387 GTGCACAGACAGAATGAGCTTGG + Intergenic
946811353 2:223529271-223529293 GCACAGAGACAGCTTGAGCCAGG + Intergenic
947914252 2:233821554-233821576 GTACAGAGGCACAGAGAGCGGGG - Intronic
947996144 2:234529502-234529524 GGACAGAGGCAGCCTGTGCCGGG - Intergenic
949059681 2:241949595-241949617 GGACGGAGGCAGAGGGAGCCAGG + Intergenic
1169503335 20:6182849-6182871 GTAGAGAGTAAGAATGAGCTGGG + Intergenic
1170209156 20:13830619-13830641 GTACAGAGGCATAATTATTCTGG - Intergenic
1172223312 20:33288259-33288281 GAGCAGAGGAAGAAGGAGCCAGG - Intronic
1172299962 20:33842463-33842485 ATTCACTGGCAGAATGAGCCAGG + Intronic
1172619135 20:36307782-36307804 GCTCAGAGGCAGAGAGAGCCAGG - Intronic
1172942041 20:38660726-38660748 GTACAGAGGCATCAGCAGCCTGG - Intergenic
1174079021 20:47957851-47957873 GCAGAAAGGCAGAAGGAGCCAGG - Intergenic
1174356287 20:50000252-50000274 GAACAGAGAAAGAATAAGCCTGG + Intergenic
1175006508 20:55689231-55689253 GAAGAAAGGCAGAAGGAGCCTGG - Intergenic
1175581761 20:60105168-60105190 GGCCAGAGGGAGAATCAGCCTGG - Intergenic
1175795273 20:61766918-61766940 GTGCAGAGTCAGAATCAGGCAGG - Intronic
1180694581 22:17743693-17743715 CTGCAGAGGCAGAGTGATCCCGG + Intronic
1180763042 22:18223479-18223501 GCACCGAGGCAGGAGGAGCCAGG + Intergenic
1180772601 22:18401068-18401090 GCACCGAGGCAGGAGGAGCCAGG - Intergenic
1180803981 22:18650684-18650706 GCACCGAGGCAGGAGGAGCCAGG - Intergenic
1180806782 22:18718765-18718787 GCACCGAGGCAGGAGGAGCCAGG + Intergenic
1181217738 22:21344575-21344597 GCACCGAGGCAGGAGGAGCCAGG + Intergenic
1182069678 22:27454834-27454856 GTTCAGAGGCAGAAGGAGTGTGG - Intergenic
1183649053 22:39144034-39144056 GTTAAAAGGCAGAAAGAGCCTGG + Intronic
1184001160 22:41674640-41674662 GTTGAAAGGCAGAAAGAGCCAGG - Exonic
1184400403 22:44270614-44270636 TCACAGAGGCAGGATGGGCCTGG - Intronic
1203234439 22_KI270731v1_random:142056-142078 GCACCGAGGCAGGAGGAGCCAGG - Intergenic
950563422 3:13749186-13749208 GGCCTGAGGCAGAGTGAGCCAGG - Intergenic
952224227 3:31357798-31357820 AGACACAGGCAGAATGAGCTTGG + Intergenic
953563619 3:44013308-44013330 AGACAGAGGCAGAATGAGGATGG - Intergenic
953838632 3:46369844-46369866 CTACAGAGGCAGACTAACCCAGG - Intergenic
954003549 3:47576231-47576253 TTACAAAGGCAAAATGAGGCCGG - Intronic
954335321 3:49913046-49913068 AGCCAGATGCAGAATGAGCCTGG + Intronic
954468081 3:50668919-50668941 GTACAGAGGGAGCCTCAGCCAGG - Intergenic
955931976 3:64066495-64066517 GTAGAGTGGCAGAAAGAGCAGGG + Intergenic
956028114 3:65005697-65005719 AGACAGATGCAGAATGAGTCAGG - Intergenic
957015317 3:75056343-75056365 GTACAATGGCAAAATTAGCCTGG + Intergenic
957252798 3:77795371-77795393 TTACAGAGGCACAATGACCAGGG - Intergenic
959069248 3:101687264-101687286 TAAGAGAGGCAGAATGGGCCGGG - Intergenic
961463162 3:127065861-127065883 CTACAGCGGCAAAATGAGCTGGG - Intergenic
961880667 3:130059317-130059339 GTTTTGAGCCAGAATGAGCCAGG - Intergenic
962787702 3:138783701-138783723 GTACAGGGGCAGAATGGTACTGG + Intronic
962831885 3:139149760-139149782 GCATTGAGGCAGAATGTGCCTGG + Intronic
965349603 3:167597142-167597164 GCACAGAGGCAGCAGGACCCTGG - Intronic
968748090 4:2371268-2371290 GTACAAAAGAAGAATGTGCCAGG - Intronic
972613835 4:40679569-40679591 GTAAAGAGCCAGAATGATTCTGG + Intergenic
973006742 4:45017334-45017356 GTAGATAATCAGAATGAGCCAGG - Intergenic
974412227 4:61556394-61556416 CCACTAAGGCAGAATGAGCCGGG + Intronic
976635111 4:87279564-87279586 GAGGAGAGGCAGAATGAGGCGGG + Intergenic
977751935 4:100620354-100620376 GTACAGAGACAGAGGGAGCAGGG + Intronic
978672686 4:111269928-111269950 GTACAGGGCCAGATAGAGCCAGG + Intergenic
979689845 4:123548342-123548364 GAACTGAGGCAGAATGAAACCGG - Intergenic
981980383 4:150784674-150784696 GTACAGAGACAGAGGGAGCGGGG - Intronic
982448545 4:155524113-155524135 GTACAGATGCAGAACAAGCAGGG - Intergenic
982504288 4:156197973-156197995 CTAAAGAGGCATAATGACCCAGG - Intergenic
983063197 4:163181046-163181068 GTACAGAGCCACAATAAGCCAGG + Intergenic
985907522 5:2852601-2852623 GAGCAGAGGCAGAAAGAGCAAGG - Intergenic
987045663 5:14105439-14105461 GTTCAAAGGCAGATTGGGCCGGG + Intergenic
987742394 5:21927128-21927150 GTAGAGAGGCAGAGTTAGCCAGG + Intronic
987999527 5:25330900-25330922 GCACTGAGGCAGCAGGAGCCTGG - Intergenic
988819648 5:34868901-34868923 AAACACAGACAGAATGAGCCTGG - Exonic
992261382 5:74973910-74973932 ATACAGAGGAAGAGTGAGCTTGG - Intergenic
992689858 5:79231663-79231685 GGGCAGAGGCAGAATCAGGCAGG - Intronic
993635539 5:90338543-90338565 GCATAGAGGCAGAAAGAACCTGG + Intergenic
994284992 5:97954449-97954471 ATACACAGGCATAATGAGCAGGG - Intergenic
995236568 5:109835911-109835933 GTACAGAGGAAGTAAAAGCCTGG + Intronic
995349384 5:111157517-111157539 GTAGGGAGGCAGATGGAGCCTGG - Intergenic
995738568 5:115329789-115329811 GTACAGAGACAGAGGGAGCGGGG - Intergenic
999255663 5:150208850-150208872 GGTCAGAGGCAGAAGGAGGCAGG + Intronic
999442829 5:151615617-151615639 GTGCTGAAGCAGAATGAGTCAGG + Intergenic
1001931965 5:175679501-175679523 GCACAGAATCAGAATGGGCCTGG + Intronic
1002473237 5:179450080-179450102 GTCCCGAGGCAGAAGGAGCAAGG + Intergenic
1002480984 5:179500573-179500595 GTCCCGAGGCAGAAGGAGCAAGG - Intergenic
1004158368 6:13191136-13191158 GGACAGAGGCAGAAGTAGCCAGG - Intronic
1006034546 6:31201334-31201356 GTGCAGAGCCAGAAGCAGCCAGG - Intronic
1006105831 6:31715706-31715728 GCCCAGAGCCAGACTGAGCCTGG - Intronic
1006391075 6:33759023-33759045 GTACAGAGGCAGGATGGGGGAGG + Intergenic
1006547577 6:34792372-34792394 GGAGAGAGGCAGACTGGGCCCGG - Intronic
1007524184 6:42476776-42476798 GTAGAGAAGAAGAATGAGGCTGG - Intergenic
1008493277 6:52107546-52107568 GTGGAGAGGTAGAAAGAGCCTGG + Intergenic
1011698672 6:89935378-89935400 GTAATGTGGCAGAATGATCCTGG - Intronic
1015793979 6:136992304-136992326 ATAGAGAGGCAGGAGGAGCCTGG - Intergenic
1015875743 6:137820307-137820329 GAACAGAGGCACACAGAGCCAGG + Intergenic
1018652482 6:166003684-166003706 GTTCAGAGGGAGAGGGAGCCTGG + Intergenic
1020046744 7:5046169-5046191 GTACAGCGGCAGCCTGGGCCAGG - Exonic
1021061407 7:16117425-16117447 TTACAGAGGCTGAGTGAGGCAGG + Intronic
1022297144 7:29066863-29066885 ACAGAGAGGCAGATTGAGCCAGG + Intronic
1022779031 7:33559466-33559488 GCATAGAAGCAGGATGAGCCAGG + Intronic
1023215506 7:37858615-37858637 ACACAGAGGCAGAATGGGCTTGG + Intronic
1024930764 7:54664917-54664939 GTACAGAGAGGGAAAGAGCCTGG - Intergenic
1029303264 7:99600790-99600812 GTACAGAGGCCAGAGGAGCCTGG + Intronic
1031478091 7:122247333-122247355 GTACACATTCAGAAAGAGCCAGG - Intergenic
1032167290 7:129555568-129555590 GTACAAAGACAAAATTAGCCGGG - Intergenic
1035185728 7:157124724-157124746 ATACAAACGCTGAATGAGCCCGG - Intergenic
1035456368 7:159011587-159011609 GCACAGAGGCGGGAAGAGCCAGG + Intergenic
1036632583 8:10525744-10525766 GTACAGGGGCAGAAGGGGCATGG + Intronic
1037523890 8:19706303-19706325 ATACAGATACAGATTGAGCCTGG - Intronic
1038280674 8:26161405-26161427 GGAGAGAGGCAGAAGGTGCCAGG - Intergenic
1040350268 8:46559531-46559553 GAAAAGAGGCTGAAGGAGCCAGG + Intergenic
1040643975 8:49377095-49377117 GTCCAGAGTCAAAATGGGCCAGG + Intergenic
1040974876 8:53178825-53178847 GTGCAGAGGCAGATAGAGCAGGG + Intergenic
1041182467 8:55263054-55263076 GAACTGAGGCAGAAAGAGCAGGG - Intronic
1041392993 8:57363829-57363851 AGACAGAGCCAGATTGAGCCAGG - Intergenic
1042467544 8:69145078-69145100 GTACAAAATGAGAATGAGCCTGG + Intergenic
1045555869 8:103213862-103213884 GTGCACAGACAGAATGAACCTGG - Intronic
1045844675 8:106619912-106619934 ATACAGAGGCAGAAGCAGCAAGG - Intronic
1046262178 8:111782815-111782837 GTAACGAGGCAGATTTAGCCAGG + Intergenic
1046594437 8:116244702-116244724 GAACAAAGACAGAATGATCCAGG - Intergenic
1047909509 8:129512187-129512209 GTACAAAGGCAGAAAGAACGGGG + Intergenic
1048341751 8:133545352-133545374 TTACAAAGGCAGACTGGGCCAGG + Intronic
1049355247 8:142184480-142184502 GTACTCAGCCAGAATGAGCCAGG + Intergenic
1049815868 8:144599562-144599584 GTACACAGGCACATTCAGCCAGG - Intronic
1050313632 9:4378703-4378725 ATCCAGAGGCAGAATGAGAAAGG + Intergenic
1052069708 9:24067251-24067273 GTGCAAGGGCAGAAAGAGCCAGG + Intergenic
1052842356 9:33303473-33303495 GCCCAGAAGCAGCATGAGCCTGG - Intronic
1054759644 9:68992999-68993021 ATACAGAGGAAAAATTAGCCGGG + Intronic
1056425155 9:86468264-86468286 GTACATGGGCAAAATGAGCCTGG + Intergenic
1056536582 9:87533410-87533432 GTTCACAGGCAGCATCAGCCAGG + Intronic
1058054087 9:100432273-100432295 GTAGAGAGGCAGAGAGAGCTTGG + Intronic
1058973251 9:110102161-110102183 CTACAGAGGTAGAAAGAGGCTGG - Intronic
1058973347 9:110102887-110102909 CTGCAGAGGCAGAAAGAGGCTGG - Intronic
1061216490 9:129224786-129224808 GTACAGACCCAGAATGAGGGGGG - Intergenic
1061614925 9:131773330-131773352 GTCAAGAGGCAGAGGGAGCCAGG - Intergenic
1062065714 9:134525202-134525224 GTCCTGAGGCAGCAGGAGCCAGG - Intergenic
1062177512 9:135172167-135172189 GTCCAAGGGCAGAATGAGGCAGG + Intergenic
1185615561 X:1419630-1419652 GCACTGAGCCAGGATGAGCCTGG - Intronic
1186468497 X:9803244-9803266 GTAAAGAGGGAGAAAGAGCTGGG - Intronic
1196154626 X:112414763-112414785 ATACAGAGGCACAATGTGACAGG + Intergenic
1196595890 X:117545154-117545176 GGACAGAGGAAGAATAAGGCTGG + Intergenic
1197432047 X:126378021-126378043 GGGAATAGGCAGAATGAGCCTGG + Intergenic
1198308992 X:135411530-135411552 GCACACAGGCAGCATGAACCTGG + Intergenic
1198329174 X:135605879-135605901 GGACAGAGGCAGAGAGAGCCAGG - Intergenic
1198337371 X:135679700-135679722 GGACAGAGGCAGAGAGAGCCAGG + Intergenic
1198361823 X:135903114-135903136 GGTCAGAGGCAGAGAGAGCCAGG - Intronic