ID: 1115116465

View in Genome Browser
Species Human (GRCh38)
Location 14:29886074-29886096
Sequence CGTATCACTGCTACGTGAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 27
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 25}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115116465_1115116472 15 Left 1115116465 14:29886074-29886096 CCCCTTCACGTAGCAGTGATACG 0: 1
1: 0
2: 0
3: 1
4: 25
Right 1115116472 14:29886112-29886134 TTAGAACAGGCATTAAATGACGG 0: 1
1: 1
2: 1
3: 27
4: 252
1115116465_1115116470 2 Left 1115116465 14:29886074-29886096 CCCCTTCACGTAGCAGTGATACG 0: 1
1: 0
2: 0
3: 1
4: 25
Right 1115116470 14:29886099-29886121 TCCAGGAGGAACTTTAGAACAGG 0: 1
1: 0
2: 1
3: 8
4: 154
1115116465_1115116474 22 Left 1115116465 14:29886074-29886096 CCCCTTCACGTAGCAGTGATACG 0: 1
1: 0
2: 0
3: 1
4: 25
Right 1115116474 14:29886119-29886141 AGGCATTAAATGACGGAAGGAGG 0: 1
1: 0
2: 1
3: 10
4: 134
1115116465_1115116473 19 Left 1115116465 14:29886074-29886096 CCCCTTCACGTAGCAGTGATACG 0: 1
1: 0
2: 0
3: 1
4: 25
Right 1115116473 14:29886116-29886138 AACAGGCATTAAATGACGGAAGG 0: 1
1: 0
2: 0
3: 11
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115116465 Original CRISPR CGTATCACTGCTACGTGAAG GGG (reversed) Intronic
901595113 1:10378760-10378782 CTTATCACTGCATTGTGAAGAGG + Intronic
907942312 1:59100220-59100242 TGTAACACTGCTATGTGAATAGG + Intergenic
911603834 1:99877811-99877833 TGTACCTCAGCTACGTGAAGAGG - Exonic
916725742 1:167521372-167521394 CGAATCACCATTACGTGAAGTGG + Intergenic
916891967 1:169120868-169120890 GGTATTACTGTTACATGAAGTGG - Intronic
921291407 1:213661229-213661251 CCAATTACTGCTACGTGAACTGG + Intergenic
1076029553 10:127145808-127145830 ACTATCACTGCTACGTTTAGTGG - Intronic
1112397894 13:99050295-99050317 TGTATCACTGCAAGGGGAAGTGG - Intronic
1115116465 14:29886074-29886096 CGTATCACTGCTACGTGAAGGGG - Intronic
1133169948 16:3976514-3976536 CGTATCACTGGTAGGTGCTGAGG - Intronic
1144240216 17:13303185-13303207 CATGTCACTGCTAGGTGAAATGG + Intergenic
1144909814 17:18672021-18672043 CTCATCACTGCTGCGTGACGTGG + Intronic
1166371984 19:42307021-42307043 CGCCCCACAGCTACGTGAAGTGG + Intronic
1166487608 19:43226913-43226935 TGTATCACTGCTACTTCACGTGG + Intronic
929728470 2:44458830-44458852 CGTATTACTGCAACTAGAAGAGG - Intronic
1179813702 21:43889254-43889276 TGTTACACTGCTAAGTGAAGTGG + Intronic
949482928 3:4511116-4511138 CCAGTCACTGTTACGTGAAGAGG - Intronic
954199557 3:49016157-49016179 CTTCTCACTGCTACATGATGAGG - Exonic
964604042 3:158539899-158539921 CTTATCTCTGCTACCTGAAGAGG + Intronic
985343992 4:188983046-188983068 GTTAACACTGTTACGTGAAGAGG + Intergenic
991722392 5:69505989-69506011 CTTGTGGCTGCTACGTGAAGTGG - Intronic
999664348 5:153897148-153897170 CTTAACACTCCTACATGAAGAGG - Intergenic
1006339316 6:33437973-33437995 GGTACCACTGCTCTGTGAAGTGG - Exonic
1013283851 6:108663717-108663739 CTCATCACTGCTGCGTGACGTGG - Exonic
1018304611 6:162442290-162442312 GGTATCACTGCTCCGCGCAGGGG - Intronic
1187138047 X:16567381-16567403 GGTATCACTTCTCCATGAAGTGG + Intergenic
1201359116 Y:13127246-13127268 CGTAACAGTGCTAAGGGAAGTGG - Intergenic