ID: 1115119676

View in Genome Browser
Species Human (GRCh38)
Location 14:29925927-29925949
Sequence CCTTTTCCACATCAGTATTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 185}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115119676_1115119678 27 Left 1115119676 14:29925927-29925949 CCACAATACTGATGTGGAAAAGG 0: 1
1: 0
2: 1
3: 16
4: 185
Right 1115119678 14:29925977-29925999 GACAAAACGTGTCATTTTCTTGG 0: 1
1: 0
2: 1
3: 16
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115119676 Original CRISPR CCTTTTCCACATCAGTATTG TGG (reversed) Intronic
901189806 1:7402888-7402910 CCTTTTCCACAGCAGGAATGGGG + Intronic
903165376 1:21516526-21516548 CCGTTTCCTCATCTGTAATGTGG - Intronic
905962452 1:42055416-42055438 CCTTTTCCTCATCTTTAATGTGG - Intergenic
907285051 1:53374487-53374509 CCTTTTCCACTTAATTATTTGGG - Intergenic
908558121 1:65278272-65278294 CCTTTTTCAAATCAATATTATGG + Intronic
909066719 1:70943816-70943838 CCCTTTTCACATCTGTATTTAGG - Intronic
909993102 1:82247717-82247739 CTTTCTCCCCATCAGTCTTGGGG + Intergenic
910518598 1:88091555-88091577 AGTTTTCCACATAAGTGTTGAGG - Intergenic
912153779 1:106890475-106890497 CCTATTTCACATCTCTATTGGGG - Intergenic
912216446 1:107618657-107618679 CATTTTCCTCATCTGTAATGTGG - Intronic
919054979 1:192559320-192559342 CTTTCTCCACATCAGCAGTGAGG + Intergenic
920192646 1:204203306-204203328 CATTATCCACATCAGTATCAAGG + Intronic
921363095 1:214348368-214348390 CCTTTTCCACATCAACAGTTTGG + Intergenic
921486520 1:215721600-215721622 CCTTTTGCTCAACATTATTGGGG - Intronic
921488607 1:215746325-215746347 CCTTTTCCAGTTCAGGGTTGGGG - Intronic
921955623 1:220980565-220980587 CCTTTTCCTCCTCTGTATTTTGG + Intergenic
1064814339 10:19241101-19241123 ACTTTTCCACAAAAGTAATGAGG - Intronic
1066215867 10:33286627-33286649 CATTTTCCACATCTATTTTGAGG + Intronic
1066561014 10:36669801-36669823 CCTTTGTCACATCACTATTATGG + Intergenic
1068524413 10:58111690-58111712 CAGTTTCCACATCAGCATTTGGG - Intergenic
1069725969 10:70578908-70578930 ACTTTTCCAGATTAGTAATGAGG + Intergenic
1070572287 10:77649503-77649525 CAGTTTCCACATCTGTATAGTGG - Intergenic
1071701943 10:87948487-87948509 CCTTTTCCACTTTAATTTTGAGG - Intronic
1071813139 10:89205315-89205337 CCTTTTCCACATGAGGAATCAGG + Intergenic
1074155859 10:110798806-110798828 CCTTTTCCCCTGCAGCATTGAGG + Intronic
1074471789 10:113733869-113733891 CCATGTCCACCTCAGTACTGTGG - Intergenic
1080751770 11:35157192-35157214 CCATATCCACTTCAGTATTGGGG + Intronic
1084152465 11:67296216-67296238 CATTTTCCACTTCAGTTATGAGG - Intronic
1086336277 11:85803810-85803832 CCATTTCCTCATCAGTAAAGTGG + Intronic
1086896941 11:92324147-92324169 CCTTTTCCATATCAGCAATAAGG + Intergenic
1086990455 11:93297800-93297822 AATATGCCACATCAGTATTGAGG + Intergenic
1087191097 11:95255484-95255506 CCTTTTTCATTTCAGTAATGAGG - Intergenic
1087292493 11:96335298-96335320 CCTTTTCCACATTAGTATACAGG + Intronic
1087861936 11:103168804-103168826 GCTTTACCACATCAATATTATGG - Exonic
1088399983 11:109412798-109412820 TCTTATCCACACCAGTAATGGGG - Intergenic
1091014224 11:132035553-132035575 CCTTTGAAACATCACTATTGTGG - Intronic
1093647117 12:21599655-21599677 GCTTATCCACATCAGTAATTAGG + Intronic
1095828364 12:46554873-46554895 TCTCTTCCCCATCAGAATTGAGG - Intergenic
1098635884 12:72782725-72782747 CCTTTTCCAAGTCATTAATGAGG + Intergenic
1098689294 12:73466420-73466442 CCTTATCTAAACCAGTATTGTGG + Intergenic
1101469207 12:104979904-104979926 CCTTTGACATATCAGTGTTGTGG + Intergenic
1101577302 12:106009574-106009596 CCTTTTAAAAATCAGTATTTAGG + Intergenic
1102479916 12:113215185-113215207 TCGTTTCCACTTCAGTAATGAGG - Intronic
1102574430 12:113847116-113847138 CCGTTTCCTCATCCCTATTGGGG + Intronic
1102740061 12:115199154-115199176 ACTTTTCTACATCAGTATGTTGG + Intergenic
1104632029 12:130411375-130411397 CCTTTTCCACATCATACTGGAGG - Intronic
1105922601 13:24979076-24979098 TCTTTACTACATCAGTATAGTGG + Intergenic
1107750280 13:43557855-43557877 CTTTTTTCTCATCATTATTGAGG - Intronic
1112228922 13:97568491-97568513 CATTTTCCATATCAGTAAAGTGG + Intergenic
1112360156 13:98709983-98710005 TCTTTTCCAAATCAGGAATGAGG + Intronic
1114054605 14:18956595-18956617 CCCTTTCCACATCTGAATTTTGG + Intergenic
1114107949 14:19445336-19445358 CCCTTTCCACATCTGAATTTTGG - Intergenic
1114376870 14:22155992-22156014 CCTTTTCCACATCTTTTTTATGG + Intergenic
1115119676 14:29925927-29925949 CCTTTTCCACATCAGTATTGTGG - Intronic
1117030046 14:51659198-51659220 CTTTTTCCTCATCAGTAAAGTGG + Intronic
1117734621 14:58756089-58756111 TCTTTGCCACATGAATATTGTGG - Intergenic
1119164737 14:72482689-72482711 CCTTTTCCACATGGGGATAGTGG + Intronic
1121904989 14:97731553-97731575 CCTATTCCTCATCAGTATTATGG - Intergenic
1127165170 15:56237876-56237898 CATTTTGCATATCCGTATTGAGG - Intronic
1128376329 15:67078836-67078858 CCTTTTCCTCATCAGTAAAATGG + Intronic
1130854458 15:87829341-87829363 CCATTTATACATCTGTATTGAGG - Intergenic
1133045498 16:3086437-3086459 GCTTTTCCACATCTGGAATGTGG - Intergenic
1134608432 16:15589333-15589355 CCTTTTCAGCATCAGAATGGTGG - Intronic
1135189407 16:20342701-20342723 CAATTTCCACATCAGTATAATGG + Intronic
1136674453 16:31889867-31889889 ACTTTTCAACATGAGTTTTGTGG + Intronic
1140128672 16:72138345-72138367 CCATTTCAGCATCAGTCTTGGGG + Intronic
1144789190 17:17848057-17848079 CATTTTCCAGATCAGCACTGGGG + Intronic
1146157936 17:30539676-30539698 CCTACTCCACATGCGTATTGGGG - Intergenic
1148067994 17:44887210-44887232 CCTTTTTCCCATCAGCAGTGTGG - Intronic
1151506094 17:74528245-74528267 ATTTTTCCACATCAGGAGTGGGG - Intronic
1156595040 18:38539024-38539046 CCTTTTCTACATCATGATGGGGG + Intergenic
1157317293 18:46603034-46603056 CCTTTTCAACCTCAGCATTGCGG - Intronic
1165210295 19:34230496-34230518 CCTGTAGCACATCAGCATTGTGG + Intergenic
1168272089 19:55255540-55255562 CCCTTTGCACACCAGTTTTGTGG - Intronic
925824633 2:7835525-7835547 GCTTTGTCACATCACTATTGTGG + Intergenic
925865158 2:8220753-8220775 CATTTGCCACATCAGAAGTGTGG + Intergenic
925989337 2:9241406-9241428 CCTTATCCATATCAGGGTTGGGG + Intronic
930481822 2:51957890-51957912 TCTTTTCAAAAACAGTATTGGGG - Intergenic
933406158 2:81862370-81862392 CCGTTTCCACAGCAGTGTTCAGG - Intergenic
933527735 2:83464854-83464876 CTATTTCCCCTTCAGTATTGTGG - Intergenic
937004275 2:118496972-118496994 CCTTTTCCTCATCTGTAAAGTGG + Intergenic
940618805 2:156084446-156084468 CCTTTTCCACGTCCGTAGTTGGG + Intergenic
941501798 2:166288285-166288307 CTTTTTCCACACCAGAAATGAGG + Intronic
942257895 2:174124498-174124520 GCCTTTCCTCATCAGTTTTGTGG + Intronic
942488037 2:176459676-176459698 CCTTTTTCAGATAAGAATTGGGG - Intergenic
943151456 2:184118592-184118614 CATTTTCCACATTATTATTTTGG + Intergenic
944834198 2:203562196-203562218 CATTTTCCAAATCAGTTGTGTGG + Intergenic
945763030 2:213938248-213938270 CCTTTTAGTCATCAGCATTGAGG - Intronic
945839366 2:214869402-214869424 CCTTTTAAACATCAAAATTGGGG - Intergenic
946823844 2:223656472-223656494 CAATTTCCACATCTGTATTGAGG + Intergenic
1170086107 20:12534011-12534033 CCTTGTCCTCACCAGTAATGAGG + Intergenic
1170411416 20:16096260-16096282 CCAGTTCCACCTCAGTGTTGGGG + Intergenic
1173703331 20:45092436-45092458 CTTTCTCCACATCAGTATTAGGG + Exonic
1176739094 21:10582125-10582147 TCTTTACTACATCAGTATAGGGG - Intronic
1178068056 21:28928730-28928752 GTTTTTCCACATTAGTATTAGGG - Exonic
1179976557 21:44871617-44871639 CGTTTTAAACATCAGTACTGCGG + Intronic
1180473074 22:15678987-15679009 CCCTTTCCACATCTGAATTTTGG + Intergenic
1182863798 22:33584500-33584522 GCTTTTCCTCATCTGTATTCTGG + Intronic
951113074 3:18828613-18828635 TTTTTTCCACATCATTATTACGG + Intergenic
951608812 3:24468276-24468298 CTTTTTCCACATTAGAAATGAGG + Intronic
953216318 3:40922258-40922280 CCTTTGCCACCTCAGGACTGGGG - Intergenic
953477720 3:43220054-43220076 CATTTACCACATCAGTATTAGGG + Intergenic
955517912 3:59746466-59746488 CCCATTCCACATTAGAATTGAGG - Intergenic
956730093 3:72188496-72188518 CCTTTTCCTCATCAGTAAAATGG - Intergenic
956840041 3:73130769-73130791 TCTTTTCCACATTTTTATTGAGG + Intergenic
957437192 3:80193777-80193799 CTTTTTCCACATCAGCAATTGGG - Intergenic
960401546 3:117205659-117205681 CTTTTTCCACATCAGCATTAAGG - Intergenic
962805154 3:138921883-138921905 CCTTTTCCTCATCTGGAATGTGG + Intergenic
966243861 3:177784302-177784324 CCTTTTCCATAAAAGGATTGGGG + Intergenic
967075305 3:185996477-185996499 CCTTTTCCCCATCTCTCTTGTGG - Intergenic
968434978 4:579800-579822 CCTTTTCCACTTCTGTTTTTAGG - Intergenic
968755394 4:2413327-2413349 CTTTTTCCACATCAGCACTCAGG - Intronic
970567715 4:17348747-17348769 CTTTTTACACTTCAGTGTTGTGG - Intergenic
971215573 4:24659257-24659279 CCTCTTCCAGATCATTAATGAGG + Intergenic
971330096 4:25674873-25674895 CCTTTTCCACATCTATATCAAGG - Intronic
972812053 4:42600809-42600831 CCTTTTTCACATCATTTTTGTGG - Intronic
973128193 4:46615212-46615234 CCTTTTCCACATCAGCAATAAGG - Intergenic
975910634 4:79262406-79262428 CCTTTGCCACATCTTTAATGAGG + Intronic
978009625 4:103663649-103663671 CCCTTTCTACAACAGTATTTTGG - Intronic
978101992 4:104853356-104853378 CCTTGCCCAGATCAGTGTTGTGG - Intergenic
978123022 4:105104169-105104191 CTTTCTCCACATCAGCATTAAGG + Intergenic
980373209 4:131906818-131906840 CTTTCTTCACATCAGTATTTGGG - Intergenic
981670150 4:147277347-147277369 CCTCTTCCTCATCATTACTGAGG - Intergenic
982613465 4:157608804-157608826 CCTTTTTTTCCTCAGTATTGAGG + Intergenic
983134583 4:164064881-164064903 CCTTTTCTGCATCCTTATTGAGG + Intronic
986520829 5:8616396-8616418 CCTGTTCCACATCTGTCATGTGG - Intergenic
987237959 5:15962392-15962414 CTTTTTCCATATCAGTAATAAGG - Intergenic
988344489 5:30020462-30020484 CCTTTCCCACATCAGCAGTTGGG - Intergenic
989345393 5:40423663-40423685 CTTTTTCCACATACCTATTGTGG - Intergenic
989398097 5:40980113-40980135 ACATTTCCACATCAGGAATGTGG - Intronic
991991815 5:72347068-72347090 CATTTTCCACATCTATAATGTGG - Intronic
992753423 5:79882033-79882055 GCTTTTCCCCAGCAGTGTTGTGG - Intergenic
993771768 5:91937156-91937178 CTTTCTCCACATCAGCAATGAGG + Intergenic
993956148 5:94235297-94235319 CCTTTTCCATATCAGCAATAAGG - Intronic
995009307 5:107239894-107239916 CATTGTCCACATCAGCATTTTGG - Intergenic
998372194 5:141669131-141669153 GCTTTTCCACATCTGTAGGGTGG - Intronic
1000150141 5:158492200-158492222 CCTATTCCACATCTGCATTATGG - Intergenic
1001995967 5:176158471-176158493 CTTTTTCCCCACCAGAATTGCGG - Intergenic
1002792848 6:448296-448318 ACTTTTCAACATGAGTTTTGTGG - Intergenic
1003463303 6:6352384-6352406 GCATTTCCCCATCAGTTTTGGGG - Intergenic
1005849944 6:29813681-29813703 CCTTTACAACATCAGTATTGGGG + Intergenic
1008622375 6:53283288-53283310 CCTTTTCCACATAAAGATTTTGG - Intronic
1012524601 6:100162134-100162156 CCTTTTCTTCTTCAGTACTGTGG - Intergenic
1013267013 6:108509671-108509693 CCTTTTTCACATCACTATTAAGG + Intronic
1013970888 6:116017115-116017137 CTTTTTCCACAACAGTTCTGAGG - Intronic
1014456387 6:121639597-121639619 CGTTTTTAACATCAGTAATGAGG - Intergenic
1014703682 6:124720887-124720909 CCTTATCCTCAGCAGTATAGTGG + Intronic
1014774180 6:125489600-125489622 CTTCTTCCAAATCAGTACTGAGG - Intergenic
1016752013 6:147640744-147640766 GCTTTTCCACTTTGGTATTGAGG - Intronic
1016903296 6:149123492-149123514 CCTTTTCCATATCAACAATGAGG - Intergenic
1017570566 6:155740615-155740637 GCTTTTCCATATCAGCATTTTGG + Intergenic
1017625880 6:156348294-156348316 CCATTTCCACATCAGCCGTGTGG + Intergenic
1020882685 7:13782074-13782096 CGTTTTCAACATAAGAATTGAGG + Intergenic
1021863009 7:24925848-24925870 CCTTTTCCACATCACAAATCTGG - Intronic
1022149256 7:27582890-27582912 CCATTTCCACATCAGTAAAATGG + Intronic
1022984328 7:35635982-35636004 GTTCTTCCAAATCAGTATTGGGG - Intronic
1024221513 7:47291865-47291887 CCTTTTGCACTTCAGTATTCAGG - Intronic
1027294189 7:76750213-76750235 CCTTTTCCATATCAGCAGTAAGG - Intergenic
1028150566 7:87366735-87366757 GTTTTACCACATCAGTACTGGGG - Intronic
1031247054 7:119327062-119327084 CCTTTTAAACATTAGTAATGTGG - Intergenic
1031442727 7:121813453-121813475 ACTTTTTCACTTCAGTAATGGGG + Intergenic
1032544613 7:132731271-132731293 CCATTTCCACATCTTTATAGTGG - Intergenic
1033286125 7:140041985-140042007 GCTTTTTCAGATCAGTTTTGAGG + Intronic
1034016088 7:147588047-147588069 CTTTTTCTACATTAGTATTATGG - Intronic
1036742171 8:11372997-11373019 ACTTTTCAACATCAGTTTTTTGG + Intergenic
1038239500 8:25795667-25795689 CCCTTTCCTCATCAGTATGCTGG - Intergenic
1038634599 8:29275457-29275479 CCTTGTCCACATTATTCTTGGGG - Intergenic
1039364622 8:36916911-36916933 TCTTTTCCATCTCAGTAGTGAGG + Intronic
1039977976 8:42383377-42383399 CCTTTTACACACCAGTGTTCTGG + Intergenic
1040636296 8:49277553-49277575 TGTTTTCCACATCAGCAATGAGG - Intergenic
1042994762 8:74684160-74684182 GCTTTTACACAGCATTATTGAGG - Intronic
1044271305 8:90247358-90247380 CCTTTTCCCCAACAAGATTGTGG + Intergenic
1045008110 8:97933535-97933557 CCTATTCGACACCAGGATTGCGG - Intronic
1045068020 8:98469500-98469522 CCATGTCCACATTAGTAGTGAGG - Intronic
1048276046 8:133066940-133066962 CCCTTTCCCCATCAGATTTGAGG - Intronic
1048731306 8:137443696-137443718 CCTTTTCCTCATCAGTAAAATGG + Intergenic
1048773464 8:137920148-137920170 CCTTTTAAAAATCAGTACTGTGG - Intergenic
1048781815 8:138010058-138010080 CCCTTTTCTCATCATTATTGTGG + Intergenic
1048937525 8:139369327-139369349 CTTTTTCCACATCACCATTATGG - Intergenic
1052354996 9:27494847-27494869 CCTATTCCACATAAGAGTTGTGG + Intronic
1053638206 9:40036991-40037013 CTTTCTTCACATCAGTATTTGGG - Intergenic
1053767877 9:41428229-41428251 CTTTCTTCACATCAGTATTTGGG + Intergenic
1054318999 9:63633594-63633616 CTTTCTTCACATCAGTATTTGGG - Intergenic
1054546544 9:66339733-66339755 CTTTCTTCACATCAGTATTTGGG + Intergenic
1054860845 9:69951457-69951479 CCCTTTCCACATCACTTTTGAGG + Intergenic
1055216245 9:73866354-73866376 CCTTTTCCCCTTAAGTATAGAGG + Intergenic
1056053244 9:82792216-82792238 GCTTTTACAAATCAGAATTGAGG - Intergenic
1056147228 9:83744659-83744681 CCTTTTTCTCGTAAGTATTGTGG + Intronic
1058624548 9:106921188-106921210 CCTGTTCTACATCAGGATTTAGG - Intronic
1059997715 9:119928741-119928763 CTTTTTCCATCTCAGTAGTGTGG - Intergenic
1061569978 9:131471321-131471343 CCTTTTTAAAATCAGTATTTGGG + Intronic
1187255858 X:17641425-17641447 CCTGTTCCACAACATTCTTGTGG + Intronic
1188444489 X:30242254-30242276 CCTCTTCCTCATCTGTTTTGAGG + Exonic
1191779999 X:64854602-64854624 CCTTTTCCACTTCAGCAGTTGGG + Intergenic
1192103988 X:68295451-68295473 TGTTTTCCACATCAGTATAGTGG - Intronic
1192219992 X:69191345-69191367 CAGTTTCCACATCTGTAATGTGG + Intergenic
1193650102 X:84121523-84121545 CCTTTTCCCCATAAGTTCTGTGG + Intronic
1198375373 X:136033615-136033637 CCCTTTCCCCATCAGTGCTGTGG + Intronic
1198375375 X:136033621-136033643 CCTTTTCCACAGCACTGATGGGG - Intronic
1199220632 X:145311884-145311906 CCTTTTCAATATCAGCATTTTGG + Intergenic
1199579428 X:149346591-149346613 CCTTTCCCAAGTCAGTATTGGGG - Intergenic
1201935360 Y:19406051-19406073 CCTTCTCTTCATCAGTAATGTGG + Intergenic
1202043720 Y:20714674-20714696 CCATTTCCAGGTCAGTACTGGGG - Intergenic