ID: 1115119874

View in Genome Browser
Species Human (GRCh38)
Location 14:29927191-29927213
Sequence GGGCAGCGCCCCCTGCGCCG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 468
Summary {0: 1, 1: 1, 2: 5, 3: 49, 4: 412}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115119860_1115119874 24 Left 1115119860 14:29927144-29927166 CCAGCCGAGCCCCGGGAGCCGGA 0: 1
1: 1
2: 3
3: 19
4: 183
Right 1115119874 14:29927191-29927213 GGGCAGCGCCCCCTGCGCCGCGG 0: 1
1: 1
2: 5
3: 49
4: 412
1115119864_1115119874 14 Left 1115119864 14:29927154-29927176 CCCGGGAGCCGGAAAGTTGGCGC 0: 1
1: 0
2: 0
3: 4
4: 50
Right 1115119874 14:29927191-29927213 GGGCAGCGCCCCCTGCGCCGCGG 0: 1
1: 1
2: 5
3: 49
4: 412
1115119868_1115119874 6 Left 1115119868 14:29927162-29927184 CCGGAAAGTTGGCGCGGAGAGGG 0: 1
1: 0
2: 0
3: 7
4: 75
Right 1115119874 14:29927191-29927213 GGGCAGCGCCCCCTGCGCCGCGG 0: 1
1: 1
2: 5
3: 49
4: 412
1115119865_1115119874 13 Left 1115119865 14:29927155-29927177 CCGGGAGCCGGAAAGTTGGCGCG 0: 1
1: 0
2: 0
3: 4
4: 37
Right 1115119874 14:29927191-29927213 GGGCAGCGCCCCCTGCGCCGCGG 0: 1
1: 1
2: 5
3: 49
4: 412
1115119861_1115119874 20 Left 1115119861 14:29927148-29927170 CCGAGCCCCGGGAGCCGGAAAGT 0: 1
1: 0
2: 1
3: 6
4: 82
Right 1115119874 14:29927191-29927213 GGGCAGCGCCCCCTGCGCCGCGG 0: 1
1: 1
2: 5
3: 49
4: 412
1115119863_1115119874 15 Left 1115119863 14:29927153-29927175 CCCCGGGAGCCGGAAAGTTGGCG 0: 1
1: 0
2: 0
3: 2
4: 34
Right 1115119874 14:29927191-29927213 GGGCAGCGCCCCCTGCGCCGCGG 0: 1
1: 1
2: 5
3: 49
4: 412

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115119874 Original CRISPR GGGCAGCGCCCCCTGCGCCG CGG Intronic
900134149 1:1107085-1107107 GGGCACCACCCCCTGCTCCGCGG + Intronic
900245104 1:1632930-1632952 CGGCCGCGCCCCCTCCCCCGGGG - Intronic
900256335 1:1700089-1700111 CGGCCGCGCCCCCTCCCCCGGGG - Intronic
900349284 1:2227321-2227343 CGGCGGCCCCCGCTGCGCCGTGG - Intergenic
900631225 1:3636613-3636635 GGGCAGTGCCCTCTGTGCCTGGG + Intronic
900644603 1:3703250-3703272 GGACAGCGTCCCCTGGGCAGAGG + Intronic
901045934 1:6395812-6395834 GAGCACCGCCCCCTGCTCCACGG - Intergenic
902856522 1:19210198-19210220 CGGCAGCGGCTCCGGCGCCGGGG - Exonic
903539132 1:24086953-24086975 GGGCAGAGCCCCATGCTCAGGGG - Intronic
903925125 1:26826605-26826627 CCGCAGCGCCCCCTCCGCCTGGG - Intergenic
904782958 1:32964455-32964477 GGGCGGCGGGCCCTGGGCCGCGG + Exonic
905345745 1:37309894-37309916 GTGAACCGCCCCCTGCCCCGAGG + Intergenic
905944360 1:41889464-41889486 GGGCAGCACCCCCTTCTCCTTGG + Intronic
906563465 1:46778556-46778578 GAGCACCGCCCCCTGCTCCACGG - Intronic
906877665 1:49556746-49556768 GGACCTCGCCCCCTGCTCCGAGG - Intronic
908301166 1:62761853-62761875 GGGCACGGCCCCCTGCTCCATGG + Intergenic
908401150 1:63774095-63774117 GAACAGCGCACCCTGCGCCCAGG - Exonic
909317980 1:74247938-74247960 GGGCACCACCCCCTGCTCCACGG - Intronic
910676499 1:89821378-89821400 GGGCCGCGGCGCCTGCGCCAGGG - Intronic
911853996 1:102854098-102854120 GGGCGCCGCCCCCTGCTCCAGGG + Intergenic
912538706 1:110396367-110396389 GAGCACCGCCCCCTGCTCCACGG - Intergenic
915260112 1:154671084-154671106 GAGCACCGCCCCCTGCTCCATGG + Intergenic
915261282 1:154678371-154678393 GAGCACCGCCCCCTGCTCCATGG + Intergenic
916115084 1:161479303-161479325 GGGCACCGCCCCCTGCTCCATGG + Intergenic
917093943 1:171381722-171381744 AGGCGCCGCCCCCTGCTCCGTGG - Intergenic
919167903 1:193918950-193918972 GAGCACCACCCCCTGCTCCGCGG - Intergenic
919419725 1:197355433-197355455 GAGCACCACCCCCTGCTCCGCGG - Intronic
920260538 1:204685270-204685292 GGGCAGCGCCGCCGCCGCCGGGG - Intronic
920363644 1:205436480-205436502 GGTCAGTGCCCACTGTGCCGGGG - Intronic
920881982 1:209888989-209889011 GAGCGCCGCCCCCTGCTCCGCGG - Intergenic
921096306 1:211889733-211889755 GAGCACCGCCCCCTGCTCCAGGG + Intergenic
921138702 1:212285557-212285579 GGGCAGCGCCCCGGGCGATGAGG + Exonic
922166089 1:223117000-223117022 GGGCGCCGCCCCCTGCTCCACGG - Intronic
922767276 1:228162689-228162711 GGGCTGCGACCCCTACGCCCAGG + Intergenic
922798813 1:228354576-228354598 GGGCAGCGCCCACCCCGCAGAGG - Intronic
922855844 1:228774026-228774048 GAGCGGCGCCCCCTGCTCCACGG + Intergenic
923631123 1:235650003-235650025 TGGCCGCGCCCACTCCGCCGCGG + Intronic
924034745 1:239924803-239924825 GGGCACTGCCCCCTGCTCCGTGG - Intergenic
1063300344 10:4844952-4844974 GAGCACCGCCCCCTGCTCCATGG - Intronic
1063769748 10:9183671-9183693 GAGCACCGCCCCCTGCTCCACGG + Intergenic
1063848758 10:10161215-10161237 GGGCACTGCCCCCTGCTCAGTGG + Intergenic
1064461074 10:15535259-15535281 GCGCACCGCCCCCTGCTCCACGG + Intronic
1065099861 10:22321779-22321801 GGGGAGCCCCCCCCGCGCCCCGG + Intronic
1065983800 10:30930093-30930115 GGGCACCGCCCCCTGCTCTGCGG - Intronic
1066022779 10:31319593-31319615 CGGCCGCCCGCCCTGCGCCGGGG - Intronic
1066615015 10:37285206-37285228 GGGCACCGCACCCTGCTCCACGG - Intronic
1067275182 10:44827720-44827742 GGGCAGCTCCCCCTGGCCCCTGG - Intergenic
1068040871 10:51822782-51822804 GGGCAGTGCACCCTGCCCAGGGG + Intronic
1068863220 10:61867966-61867988 GAGCACCGCCCCCTGCTCCACGG + Intergenic
1069090737 10:64196727-64196749 GGGCAGCTCCACCTGCGGCCCGG - Intergenic
1072341794 10:94459532-94459554 GGGCACCGCCGCCTGCTCCATGG - Intronic
1073511067 10:104042647-104042669 GGGCAGTCCCGCCTGCCCCGGGG - Intronic
1075940637 10:126387993-126388015 GGGCACCGCACGCTGCGCCTGGG - Intronic
1075999964 10:126906091-126906113 GGCCAGCGCCCCTTGCCCCTCGG + Intronic
1076149254 10:128149795-128149817 CGCCCGCGCCCCCTGCGCAGCGG + Intergenic
1076149261 10:128149809-128149831 GCGCAGCGGCCCCTCCGCAGCGG + Intergenic
1077183475 11:1226545-1226567 GGGTAGCCTCCCCTGGGCCGAGG - Intronic
1077485190 11:2835223-2835245 GGGCAGGGCTCCCTGCGGCTGGG + Intronic
1077815649 11:5683226-5683248 GAGCACCGCCCCCTGCTCCACGG + Intronic
1078246079 11:9574062-9574084 GGGCAGCGGCCACAGCACCGGGG + Exonic
1078762074 11:14259577-14259599 GTGCAGCGCCACCTGCGGCATGG + Exonic
1079128441 11:17734614-17734636 GGCGGGCGCCCCCAGCGCCGAGG + Intergenic
1079131632 11:17750176-17750198 GGGCAAAGCCCCCAGCACCGTGG + Intronic
1079190939 11:18276174-18276196 GAGCACCGCCCCCTGCTCCAGGG - Intergenic
1079555378 11:21753180-21753202 GAGCACCGCCCCCTGCTCCACGG - Intergenic
1080428107 11:32174455-32174477 GGGCAGAGCCCCCAGCCCCTTGG + Intergenic
1080458373 11:32434666-32434688 GGGGAGCGCCCCCTACGCGCGGG - Intronic
1080557643 11:33431782-33431804 GAGCACCGCCCCCTGCTCCACGG - Intergenic
1081329659 11:41788263-41788285 GAGCACCGCCCCCTGCTCCAGGG - Intergenic
1081705637 11:45180806-45180828 GCGCGCCGCCCCCTGCCCCGTGG - Intronic
1082807725 11:57461028-57461050 GGGCCGCGCCCCCGCCGCCAGGG + Intronic
1083728800 11:64642481-64642503 GGGAAGCGCCCCCCGCCCCCGGG + Intronic
1083838923 11:65291820-65291842 GGGCAGCTCCCCCTGCCCTGTGG - Intronic
1083886706 11:65576603-65576625 GGGCAGCCTTCCCTGCGCGGGGG + Intronic
1083933859 11:65860365-65860387 GGACAGCGCCCCCTGTGACGGGG - Intronic
1084153124 11:67300406-67300428 GGGAAGGGCCCCCAGCGACGTGG + Intronic
1084259176 11:67963545-67963567 GAGCACCGCCCCCTGCTCCACGG + Intergenic
1084637250 11:70399916-70399938 GGCCAGCCCCTCCTGCGCCACGG - Intronic
1085205795 11:74731291-74731313 GGCCGGCGCCCCCTGCTCGGTGG + Intronic
1086087642 11:82971083-82971105 AGGCAGCTCCACCTGCGCCCCGG + Intergenic
1086484740 11:87286558-87286580 GGGCGCCGCCCCCTGCTCTGTGG - Intronic
1087682298 11:101231373-101231395 GAGCACCGCCCCCTGCTCTGTGG - Intergenic
1089694915 11:120211062-120211084 GGGCAGCGCCGTCTCCGCCTCGG + Exonic
1090558097 11:127898607-127898629 GGGCACCGCCCCATGCTCCGTGG - Intergenic
1091152221 11:133339431-133339453 GGGCAGCCCTCCCTGCCACGTGG - Intronic
1091286587 11:134411849-134411871 GGGCAACGGCCCCTACGCCCCGG + Intronic
1091762455 12:3096044-3096066 GGGCGGCGCTCCCGGCGCGGCGG + Intronic
1092410885 12:8252229-8252251 GAGCACCGCCCCCTGCTCCAGGG - Intergenic
1092430488 12:8404550-8404572 GAGCACCGCCCCCTGCTCCACGG + Intergenic
1093189452 12:16057697-16057719 GAGCACCGCCCCCTGCTCCACGG + Intergenic
1094703923 12:32896789-32896811 CGCCAGCGCCCCCAGCTCCGTGG - Intronic
1095944303 12:47745428-47745450 GGGCAGGGCCCCCTGGGCCAAGG - Intronic
1096789218 12:54034672-54034694 GGGCAGCGCCGACAGCCCCGCGG - Exonic
1098168166 12:67719270-67719292 GAGCAACGCCCCCTGCTCCACGG - Intergenic
1100211834 12:92406556-92406578 GAGCACCGCCCCCTGCTCCACGG - Intergenic
1103238886 12:119397752-119397774 GGGCGCTGCCCCCTGCTCCGTGG - Intronic
1103363864 12:120368920-120368942 GGCCCGCGCCCCCTGCGCCCTGG - Intronic
1103850254 12:123928376-123928398 CTGCAGGGCCACCTGCGCCGGGG - Exonic
1104757904 12:131280389-131280411 GGTCAGGGCCTCCTGCGCTGGGG - Intergenic
1104929226 12:132329436-132329458 GGGCCGCGCCCTCTGAGCGGGGG - Intergenic
1106517226 13:30465614-30465636 GGGCAGCGTTCCCGGCGCCCGGG + Intronic
1106956333 13:34942682-34942704 GGGGAGCGGGCCCGGCGCCGCGG + Exonic
1108435395 13:50396911-50396933 GAGCACCGCCCCCTGCTCCAGGG + Intronic
1108996049 13:56735885-56735907 GAGCACCGCCCCCTGCTCCAGGG + Intergenic
1109446561 13:62447937-62447959 GAGCACCGCCCCCTGCTCCAGGG - Intergenic
1110596556 13:77326662-77326684 GAACAGCGCCCCCGGCGCCGGGG + Exonic
1111220941 13:85205181-85205203 GCCCAGCGCCCCCCGCCCCGTGG + Intergenic
1111951731 13:94713341-94713363 GGAAGGGGCCCCCTGCGCCGCGG - Intergenic
1112505285 13:99971255-99971277 GGGCAGCTACCCCTGCGGCGGGG - Exonic
1113680328 13:112239053-112239075 AGGCACCGCCCCCTGCTCTGTGG + Intergenic
1113779727 13:112969181-112969203 GGGGGGCGCGCGCTGCGCCGCGG - Intronic
1114483252 14:23048057-23048079 CGGCGGCGCCCCCGGCCCCGCGG - Exonic
1114957816 14:27845696-27845718 CGGCACCGCCCTCTGCTCCGCGG + Intergenic
1115119874 14:29927191-29927213 GGGCAGCGCCCCCTGCGCCGCGG + Intronic
1115538069 14:34391915-34391937 GGGCAGAGCCCACTGCACCTTGG + Intronic
1116390596 14:44385148-44385170 AGGCAGCTCCACCTGCGCCCCGG + Intergenic
1116828295 14:49693230-49693252 ACGCAGCGGCCACTGCGCCGTGG + Exonic
1117449858 14:55839789-55839811 GAGCACCGCCCCCTGCTCCACGG + Intergenic
1118932469 14:70255165-70255187 GAGCACCGCCCCCTGCTCCAGGG + Intergenic
1118971672 14:70642543-70642565 GCGCCGCGCCCCCCGCGCCGCGG + Intronic
1119539297 14:75428210-75428232 AGGCGGCGCCCCCGGGGCCGGGG - Intronic
1122514582 14:102298011-102298033 GAGCACCGCCCCCTGCTCCAGGG + Intronic
1122623209 14:103071324-103071346 GGGCAGCGCCGCCAGCCCTGGGG - Intergenic
1122797316 14:104212528-104212550 GGGGAGCGCCCGCTGTGCCAGGG - Intergenic
1122887567 14:104717224-104717246 CGGCAGCGCACCCTGCCCGGGGG - Intronic
1122887583 14:104717263-104717285 CGGCAGCGCACCCTGCCCGGTGG - Intronic
1122887597 14:104717300-104717322 CGGCAGCGCGCCCTGCCCGGGGG - Intronic
1122887611 14:104717338-104717360 CGGCAGCGCACCCTGCCCGGGGG - Intronic
1202902440 14_GL000194v1_random:51441-51463 GGGCAGCGCCACCTGGGCCTGGG + Intergenic
1124387812 15:29224831-29224853 GTGCACCGCCCCCTGCTCCACGG - Intronic
1125565706 15:40676965-40676987 GAGCACCGCCCCCTGCTCCATGG - Intergenic
1125631662 15:41152045-41152067 AGGCAGCTCCACCTGCGCCCCGG + Intergenic
1126134556 15:45378082-45378104 GGGCGGCGCCCCCTGCGCCGTGG + Intronic
1126997570 15:54462554-54462576 GGCCAGTGCCCCCGGCCCCGGGG + Intronic
1127868163 15:63048426-63048448 TGGCGGCGCCCCCTGCGGCCAGG - Intronic
1128119232 15:65133547-65133569 CGCCAGCGCCGCCTCCGCCGCGG + Exonic
1128594035 15:68928909-68928931 AGGCAGCTCCACCTGCGCCTGGG - Intronic
1129659032 15:77542888-77542910 GGGCTGTGCCCACTGCCCCGCGG + Intergenic
1131144623 15:90002635-90002657 GGCCACCGCCCCCTTCACCGCGG + Intronic
1131472785 15:92711097-92711119 GAGCACCGCCCCCTGCTCCAAGG - Intronic
1131517531 15:93089079-93089101 GGGGAGCGCCTCCTGCTCCCGGG + Intronic
1131846064 15:96491871-96491893 GAGCACCGCCCCCTGCTCCACGG - Intergenic
1131846081 15:96491922-96491944 GCGCACCGCCCCCCGCCCCGGGG - Intergenic
1132111672 15:99106083-99106105 GGGCAGCGGCCCCTTCACCAGGG + Intronic
1132320194 15:100919610-100919632 GGGCCGCGGCCCCTGCGCAACGG - Intronic
1132365126 15:101251565-101251587 GGGCAGCGCCGCCGCCGCCGCGG + Exonic
1132549471 16:548410-548432 GGGCAGCACCCTCCGCCCCGAGG + Intronic
1132662008 16:1065813-1065835 GGGCAGCGCATCCTCCGCGGAGG + Intergenic
1132685742 16:1161387-1161409 GGGCAGAGCCCCCTGGCCGGAGG + Intronic
1132691131 16:1182431-1182453 GAGCACCGCCCCCAGCGCAGGGG - Intronic
1132756487 16:1487806-1487828 CGCCAGCTCCCCCTGCACCGAGG + Exonic
1132848022 16:2009612-2009634 TCGCAGCGGCCCCAGCGCCGTGG + Exonic
1133212983 16:4273354-4273376 GGGCTGGGCTCCCTGCGCGGTGG - Intergenic
1133286749 16:4694254-4694276 GGGCCCCGCCCCCCGCCCCGGGG + Intronic
1134149697 16:11796589-11796611 GGGCGGCGCCCCCGCCTCCGCGG + Intronic
1136146837 16:28321010-28321032 CCGCTGCGCCCCCTGCCCCGCGG - Exonic
1137300476 16:47143821-47143843 GGGCGCCGCCTCCTGCTCCGCGG + Exonic
1137988671 16:53131124-53131146 GAGCAGCGGCCGCTGCCCCGCGG - Intronic
1140927621 16:79599293-79599315 GGCCGGCGCGCCCGGCGCCGCGG - Exonic
1141132404 16:81445084-81445106 GGGCAGCGCCCCCTCCCCTGCGG + Intergenic
1141425310 16:83940934-83940956 GGGCTGCCCCCACTGCACCGGGG - Intronic
1141465697 16:84204653-84204675 GAGCACCGCCCCCTGCTCCATGG - Intergenic
1141830918 16:86509787-86509809 GGGAAACGCTCCCTGGGCCGGGG - Intergenic
1142136215 16:88453148-88453170 CGGCTCCGCCCCCAGCGCCGCGG - Intergenic
1142222974 16:88864456-88864478 GGGCAGGACCCCATGCTCCGGGG - Intronic
1142550056 17:732792-732814 GGGCAGCGCCCCGGGCCTCGGGG - Intronic
1143135226 17:4709130-4709152 GAGCACCGCCCCCTGCTCCAAGG - Intergenic
1143544773 17:7589542-7589564 GGGCAGCGTCCCGGGGGCCGCGG + Exonic
1144208565 17:12996121-12996143 AGGCCGAGCCCCCTGCGCCATGG + Intronic
1147193231 17:38748911-38748933 GGCCAGCGCCCCTGCCGCCGAGG - Intronic
1147792477 17:43022098-43022120 CGGCAGCGCCCCCGGCCCCTGGG - Exonic
1147997582 17:44369126-44369148 GAGCGGCGCCCCCTGCTCCACGG + Intergenic
1148115601 17:45172859-45172881 GGGCAGCACCCCCTGGGGCCTGG - Intergenic
1148128075 17:45247058-45247080 GGGCAGCCCCTCCTCCGCTGTGG + Exonic
1148685052 17:49496333-49496355 GGGGAGTGCCCACTTCGCCGGGG + Intronic
1148824244 17:50380512-50380534 GGGCAGTGACCCCTGAGCCCTGG - Intronic
1149840925 17:59964542-59964564 CCCCAGAGCCCCCTGCGCCGCGG + Intronic
1150792277 17:68208136-68208158 GAGCACCGCCCCCTGCCCCACGG + Intergenic
1151756203 17:76076559-76076581 GGGCCGCGACCCCTGCACCTCGG - Intronic
1151825731 17:76523224-76523246 GGGAGCCGCCTCCTGCGCCGCGG - Intergenic
1152125548 17:78444572-78444594 GGGCGGGGCCCCCGGCGCGGCGG + Intronic
1152174982 17:78781796-78781818 GGACTGCGACCCCTGCCCCGGGG + Intronic
1152807495 17:82363152-82363174 GGGCAGCTCCCCCATGGCCGAGG - Exonic
1154097556 18:11432320-11432342 AGGCGCCGCCCCCTGCTCCGAGG - Intergenic
1154231108 18:12557184-12557206 GGGCGCCACCCCCTGCTCCGCGG - Intronic
1155611665 18:27673927-27673949 GAGCACCGCCCCCTGCTCCAGGG - Intergenic
1156242988 18:35271690-35271712 GGGTGCCGCCCCCTGCTCCGTGG - Intronic
1156629009 18:38944445-38944467 AGGCACCGCCCCCTGCTCCACGG - Intergenic
1156651987 18:39235658-39235680 AGGCACTGCCCCCTGCTCCGTGG + Intergenic
1159167904 18:64725677-64725699 GAGCACCGCCCCCTGCTCCAGGG - Intergenic
1160193755 18:76736471-76736493 GGGCTGCACCCCATGCGCAGAGG - Intergenic
1160458946 18:79022831-79022853 GGGCAGCGGGTCCTGGGCCGTGG + Intergenic
1160566351 18:79788671-79788693 GGGCAGACCCACCTGCGCCCTGG - Intergenic
1161006765 19:1941103-1941125 GGCGCGCGCCCCCGGCGCCGTGG + Intergenic
1161166516 19:2790768-2790790 GGGCAGCGCCACCTGCTCCCAGG + Intronic
1161394451 19:4037822-4037844 GGGCAGCGGCGCTTGGGCCGGGG - Exonic
1161401265 19:4067041-4067063 GGGCTTCGCCCGCTGCGCCGGGG + Intergenic
1161770615 19:6228847-6228869 GGGCAGAGCGCCCAGCGCCTGGG + Intronic
1162029266 19:7910304-7910326 GGGCAGCGGCACCTGCGGCCAGG + Exonic
1162312003 19:9913452-9913474 CGGGAGCGCCCCCCGCGCGGCGG + Intronic
1162566414 19:11447593-11447615 GGGCTGCTCCCCCTGCACCTCGG - Exonic
1162802353 19:13118444-13118466 GGGCCGCCTCACCTGCGCCGTGG - Exonic
1163241070 19:16064300-16064322 GGGCAGGGCCCCCAGCGTCCGGG + Intergenic
1163366831 19:16880142-16880164 GGGCAGAGCCACCTGGGCCCCGG + Exonic
1163664984 19:18598954-18598976 GGGCAGCAACCCCTCAGCCGAGG - Intronic
1163701810 19:18789983-18790005 GCGCTGCGGCCCCTGCCCCGCGG - Exonic
1164576701 19:29409344-29409366 GGGCAGCCCCTCCTGCGGCAGGG - Intergenic
1165058729 19:33194744-33194766 GGGCGCCGCCTCCTGCCCCGCGG - Exonic
1166449319 19:42884644-42884666 GGGAAGGGCCCCCTGTGCAGTGG - Intronic
1167045386 19:47046196-47046218 GGGCAGCGCCTCGTACGCCGTGG - Exonic
1167495713 19:49817634-49817656 GGGCAGCGGGCCCGGCGCGGTGG + Intergenic
924977430 2:191396-191418 GGGCACCGCCCCCTGCTCCGTGG - Intergenic
925533026 2:4884538-4884560 GGGCACCACGCCCTGCTCCGCGG + Intergenic
925928339 2:8685882-8685904 GGGCAGCGCGGCTGGCGCCGCGG - Intergenic
927567190 2:24123485-24123507 GCACTCCGCCCCCTGCGCCGCGG - Exonic
927596574 2:24402959-24402981 GGCCAGGGCCGCCAGCGCCGGGG + Intergenic
929558891 2:42943298-42943320 GGGCAGAGCACCCTGCCCCGTGG + Intergenic
929604991 2:43227672-43227694 GTGCAGCCCCACCTGCGCCGCGG - Intergenic
930593439 2:53356753-53356775 AGGCACCGCCCCCTGCTCCACGG + Intergenic
930651843 2:53971136-53971158 GGGCTGCGCCTTCTTCGCCGTGG + Intronic
930847798 2:55923939-55923961 GGTCCGCGCCCCCTGCTCCAGGG + Exonic
931719442 2:65056569-65056591 GGCCACCGCCCCCAGCGCCGCGG - Intronic
933712113 2:85334451-85334473 GAGCACCGCCCCCTGCTCCACGG - Intergenic
934504232 2:94878959-94878981 GGGCAGTGCCACCTGGGCCTGGG - Intergenic
934978547 2:98822664-98822686 GGGCGGCGGCCTCTGCGTCGAGG + Exonic
935171052 2:100611862-100611884 GGGCAGCCCCCTCTGCCCCAAGG + Intergenic
935790389 2:106584819-106584841 GGGCAGCTCCACCTGCACCTGGG + Intergenic
935866482 2:107392608-107392630 GAGCGCCGCCCCCTGCTCCGCGG + Intergenic
935896802 2:107747376-107747398 GAGCGCCGCCCCCTGCTCCGGGG - Intergenic
936029483 2:109059688-109059710 GGGCAGAGGCCCCTGTCCCGGGG - Intergenic
938931168 2:136088108-136088130 GAGCACCGCCCCCTGCTCCACGG - Intergenic
939085725 2:137716116-137716138 GGGCGCCGCCCCCTGCTCCATGG + Intergenic
939898962 2:147827182-147827204 GAGCACCGCCCCCTGCTCCACGG + Intergenic
941476543 2:165957101-165957123 GGGCGCCGCCCCCTGCTCCACGG - Intergenic
941878554 2:170459666-170459688 GGGCACCACCCCCTGCTCCATGG - Intronic
942043371 2:172085256-172085278 GGGCTGCGGCGTCTGCGCCGGGG - Exonic
943024278 2:182608803-182608825 AGGCAGCTCCCCCTGCGCTCTGG + Intergenic
943106114 2:183546716-183546738 GAGCACCGCCCCCTGCTCCACGG - Intergenic
944114249 2:196170968-196170990 AGGCAGGGCCCCCTTCGCGGCGG - Intronic
944413847 2:199464615-199464637 GGGCACCGGCCCCTGCGACCCGG - Intronic
945664175 2:212721106-212721128 GGGCATCTCCCCCTGCTCCGCGG - Intergenic
946152716 2:217787303-217787325 GGGCACCGCCCCCTGCTCCGTGG - Intergenic
946865594 2:224039052-224039074 GGGCAGCGCCGGCCGCGCCCGGG + Intronic
947171961 2:227320946-227320968 GGGCACCGCCCCCTGCTCCACGG + Intergenic
947800853 2:232927957-232927979 CTTCAGCGCCGCCTGCGCCGTGG - Intronic
948115720 2:235493701-235493723 GGGCAGCCTCCCCCGTGCCGGGG + Intergenic
948463037 2:238139346-238139368 GGGCAGAGCCGCCTTCACCGGGG + Intronic
1169266850 20:4172273-4172295 GGGCCGCGCCAGCTGCGACGGGG - Intronic
1171382218 20:24742524-24742546 TGGCAGGGCACCCTGCCCCGAGG + Intergenic
1172275021 20:33674553-33674575 GGGCGCCTCCCCCTCCGCCGTGG - Intergenic
1173726013 20:45298264-45298286 GGGCCGTGCACCCTGCGCCTCGG + Exonic
1173778814 20:45736214-45736236 GGGCACCGCCCCCTGCTCCATGG + Intergenic
1175267006 20:57709331-57709353 GGGCAGCGCCCGCCGCGCCCCGG - Intronic
1175660580 20:60808851-60808873 GGGCAGAGCCCCTTGCGTGGGGG + Intergenic
1175946838 20:62562850-62562872 CAGCAGCGTCCCCTGCCCCGGGG - Intronic
1176233238 20:64042444-64042466 GGGCAGAGCCGCGTGCGCTGGGG + Intronic
1176621808 21:9066208-9066230 GGGCAGCGCCACCTGGGCCTGGG + Intergenic
1176867634 21:14062928-14062950 GGGCTGCACCGCCTGCGGCGGGG + Intergenic
1177318759 21:19493865-19493887 GAGCACCGCCCCCTGCTCCACGG + Intergenic
1180014560 21:45074059-45074081 GGGCAGCGCCCGCTGCAGGGAGG + Intronic
1180179668 21:46112316-46112338 GGGCACCGTCCACTTCGCCGTGG + Exonic
1184747576 22:46465170-46465192 GAGCAGCGGCCCCTGCCCAGGGG + Intronic
1184897981 22:47423390-47423412 GGGGAGAGCCCCCTGCGCCTTGG + Intergenic
1185024000 22:48397186-48397208 GGGAAGGGCCCCCTGCGCTTGGG + Intergenic
1185032333 22:48450611-48450633 GGGCAGCGCCACCCACCCCGAGG - Intergenic
1185045199 22:48525250-48525272 GGGGAGCATCCCCTGGGCCGAGG - Intronic
1185229071 22:49670239-49670261 GAGCGCCGCCCCCTGCTCCGCGG - Intergenic
950068889 3:10136390-10136412 AGGCAGCTCCACCTGCGCCCCGG - Intergenic
950256915 3:11513283-11513305 GAGCACCGCCCCCTGCTCCACGG - Intronic
950540250 3:13608186-13608208 GGGCAGCTCCGCCTGCTCCAGGG - Intronic
951185011 3:19702850-19702872 GGGCACCGCCCCCTGCTCCGTGG + Intergenic
951323152 3:21271658-21271680 GGGCACTGCCCCCTGCTCCGCGG - Intergenic
951551830 3:23882569-23882591 GGGGACCACCCCCTGCTCCGCGG - Intronic
954200797 3:49022039-49022061 CTGCAGCGCCCCCTGCGTCCCGG - Exonic
954912661 3:54122295-54122317 GGGCAGGGCGCGCTCCGCCGCGG + Intergenic
956195782 3:66651850-66651872 GAGCACCGCCCCCTGCTCCACGG + Intergenic
956459273 3:69454751-69454773 GGGCACCACCCCCTGCTCCGTGG + Intronic
956658976 3:71581620-71581642 GGGCAGCGGCAGCGGCGCCGGGG - Intronic
956792808 3:72693212-72693234 GGGCAGCCAGGCCTGCGCCGAGG - Intergenic
957056124 3:75444472-75444494 GAGCACCGCCCCCTGCTCCAGGG - Intergenic
958108491 3:89107849-89107871 GGGCAGAGCTCCGTGCGTCGCGG - Intronic
958798670 3:98732657-98732679 GGGAAGCTCCTCCTGCTCCGCGG - Intronic
958810718 3:98858010-98858032 GAGCACCGCCCCCTGCTCCATGG - Intronic
960120872 3:113947885-113947907 GTGCCCCGCCCCCGGCGCCGGGG - Exonic
961279966 3:125758663-125758685 GAGCACCGCCCCCTGCTCCATGG - Intergenic
961358335 3:126352572-126352594 GGGCAGCGGCCCCTGTGAAGGGG - Exonic
961408926 3:126704402-126704424 GAGCGGCGCCGCCTGGGCCGGGG + Intronic
961551508 3:127672739-127672761 GGGCGGCGCTTCCTGCGCCCCGG + Exonic
961932271 3:130547102-130547124 GGGCGTCGCCCCCTGCTCTGTGG - Intergenic
962383717 3:134916393-134916415 GAGCACCGCCCCCTGCTCCACGG - Intronic
963397941 3:144757218-144757240 GGGCACTGCCCCCTGCTCCATGG + Intergenic
964129315 3:153269044-153269066 GGGCGTCGCCCCCTGCTCCGCGG + Intergenic
964138301 3:153369789-153369811 GGGCACCGCCCCCTGCTCCATGG - Intergenic
965587025 3:170327747-170327769 GGGCACTGCCCCCTGCTCCATGG + Intergenic
965837420 3:172867105-172867127 GAGCACCGCCCCCTGCTCCACGG + Intergenic
966201075 3:177359896-177359918 CGGCAGCGACCCCGACGCCGCGG + Intergenic
966246029 3:177808980-177809002 GAGCACCGCCCCCTGCTCCACGG - Intergenic
967594869 3:191317050-191317072 GGGCACCACCCCCTGCTCCAAGG - Intronic
968455953 4:699941-699963 GGAGAGCTCCCCCTGCACCGTGG + Intergenic
969017744 4:4115677-4115699 GAGCACCGCCCCCTGCTCCACGG + Intergenic
969021705 4:4143552-4143574 GGGCGGCGCCTCCTCCTCCGCGG + Intergenic
969615186 4:8247881-8247903 GGACAGCCCTCCCTGTGCCGGGG + Intergenic
969671513 4:8592723-8592745 GGGGCGCCCTCCCTGCGCCGGGG + Exonic
969732162 4:8963863-8963885 GGGCGGCGCCTCCTCCTCCGCGG - Intergenic
969788182 4:9474461-9474483 GCGCGGCGCCCCCCGCGCTGCGG + Intergenic
969814971 4:9680163-9680185 GAGCACCGCCCCCTGCTCCAGGG + Intergenic
970691940 4:18630608-18630630 GGGCACCGCCCCCTGCTCTGCGG - Intergenic
971043304 4:22778645-22778667 AGGCACCGCCCCCTGCTCCATGG - Intergenic
971563610 4:28113101-28113123 GAGCACCGCCCCCTGCTCCACGG + Intergenic
971757573 4:30722025-30722047 CGACAGCGCCCCCTACCCCGGGG + Exonic
971905143 4:32716262-32716284 GAGCACCGCCCCCTGCTCCAGGG - Intergenic
972890514 4:43551535-43551557 GAGCACCGCCCCCTGCTCCGCGG + Intergenic
973037150 4:45420473-45420495 GAGCATCGCCCCCTGCTCCACGG + Intergenic
973878157 4:55241779-55241801 GAGCACCGCCCCCTGCTCCACGG + Intergenic
974186836 4:58457252-58457274 GGGCACCGCCCCATGCTCTGTGG + Intergenic
974299197 4:60042259-60042281 GGGCACTGCCCCCTGCTCCATGG - Intergenic
974696835 4:65387256-65387278 GGACAGCGCCCCCAGCTCCAAGG - Intronic
974781697 4:66561529-66561551 GAGCACCGCCCCCTGCTCCACGG - Intergenic
975160762 4:71121266-71121288 GGGCACTGCCCCCTGCTCCGTGG + Intergenic
975166715 4:71186589-71186611 GAGCCGCGCCGCCTCCGCCGGGG - Intergenic
975683403 4:76897540-76897562 GCGCAGCTCCCCCTGCACTGGGG + Exonic
976226398 4:82798275-82798297 CGCCGGCGCCCCCTGCGCCCCGG - Intronic
976389275 4:84492960-84492982 GGGCAGCGGCCTCAGCGCCCGGG - Exonic
977885698 4:102250250-102250272 AGGCAGCTCCACCTGCGCCCCGG - Intergenic
977906528 4:102483452-102483474 GAGCACCGCCCCCTGCTCCATGG + Intergenic
977960287 4:103076806-103076828 GGGCTGCCCGGCCTGCGCCGCGG - Intronic
979033178 4:115678538-115678560 GGGCACCGCTCCCTGCTCTGCGG - Intergenic
980228031 4:130013103-130013125 GAGCACCGCCCCCTGCTCCAGGG + Intergenic
981176541 4:141689895-141689917 GAGCACCGCCCCCTGCTCCACGG - Intronic
981280645 4:142954584-142954606 GGGCGCCACCCCCTGCTCCGCGG + Intergenic
982573201 4:157076123-157076145 GGGCCGCGGAGCCTGCGCCGTGG - Exonic
983425754 4:167581879-167581901 GGGCGCCACCCCCTGCTCCGTGG + Intergenic
983835345 4:172377574-172377596 GGGCACCGGCCCCTGCTCCACGG - Intronic
984770615 4:183433468-183433490 GAGCACCGCCCCCTGCTCCATGG + Intergenic
984862532 4:184253264-184253286 CGGCACCGCCCCCTGCTCAGGGG + Intergenic
985593568 5:777781-777803 GGGCAGCTCCGCCTGCTGCGGGG - Intergenic
985679257 5:1247332-1247354 GGGCAGCTCCCCCCCTGCCGTGG - Intergenic
985963919 5:3325061-3325083 GGGCAGCGGGCCCTGCGCCCTGG - Intergenic
986152074 5:5138192-5138214 AGGCAGCTCCACCTGCGCCCCGG + Intergenic
986626223 5:9725651-9725673 GAGCACCGCCCCCTGCTCCACGG + Intergenic
986919074 5:12662227-12662249 GGGCGCCGCCCCCTGCTCCGTGG + Intergenic
987315342 5:16718275-16718297 GAGCACCGCCCCCTGCTCCACGG + Intronic
987327942 5:16829220-16829242 GGGAAGGGCCCCCTGTGCCCTGG + Intronic
988143000 5:27267205-27267227 GGGCAGCTCCGCCTGCACCCCGG - Intergenic
988500193 5:31777439-31777461 GGGCGCCGCCCCCTGCTCCGTGG + Intronic
988883644 5:35531951-35531973 GAGCACCGCCCCCTGCTCCATGG + Intergenic
989178723 5:38556223-38556245 GGGCAGCGCTCCCAGCTCTGCGG - Intronic
990165494 5:52989297-52989319 GGGCAGCTCCTGCAGCGCCGAGG - Intergenic
992048916 5:72925814-72925836 GGGTGCCGCCCCCTGCTCCGCGG + Intergenic
992102349 5:73419657-73419679 CGGCCGCGCCTCCTGCGCCCCGG - Intergenic
992802939 5:80310027-80310049 GGGCACCGCGCCCTGCTCTGCGG - Intergenic
993202166 5:84830354-84830376 GGGCATCGCCCCCTGCTCCACGG - Intergenic
995206588 5:109487803-109487825 GGGCAGCTCCGCCTGCGCCCTGG - Intergenic
995326373 5:110894064-110894086 GAGCACCGCCCCCTGCTCCAAGG - Intergenic
997760609 5:136444538-136444560 GAGCACCGCCCCCTGCTCCATGG + Intergenic
998117587 5:139549667-139549689 GGGCGCCACCCCCTGCTCCGCGG + Intronic
998374483 5:141681976-141681998 GGGCAGCGCAGGCTGCGACGAGG + Intronic
998374516 5:141682065-141682087 GGGGAGGGCCGCCGGCGCCGAGG + Intronic
999855235 5:155586789-155586811 GAGCACCGCCCCCTGCTCCACGG - Intergenic
1000014576 5:157266119-157266141 GGGCAGAGCATCCTGCGCCCCGG + Exonic
1000085919 5:157887167-157887189 GGGCACTGCCCCCTGCTCCATGG + Intergenic
1002570450 5:180136793-180136815 GGGCAGGGTCCCCTGCTCTGAGG - Intronic
1002645140 5:180649236-180649258 GGAGAGCTACCCCTGCGCCGAGG + Intronic
1003061850 6:2870105-2870127 GGGCGCCGCCCACTGCTCCGCGG - Intergenic
1003069721 6:2936142-2936164 GAGCACCGCCCCCTGCTCCAGGG + Intergenic
1003178550 6:3771999-3772021 GGGCAGCTCCACCTGCGCCCCGG + Intergenic
1003983923 6:11417033-11417055 GGGCACCGCCCCCTGCTCCGTGG - Intergenic
1004196537 6:13511072-13511094 GAGCGCCGCCCCCTGCTCCGTGG - Intergenic
1004220688 6:13743616-13743638 AGGCAGCTCCACCTGCGGCGGGG + Intergenic
1005042225 6:21609936-21609958 GAGCACCGCCCCCTGCTCCACGG - Intergenic
1005751258 6:28885171-28885193 GGGCGCCGCCCCCTGCTCCGCGG - Intergenic
1005766388 6:29015487-29015509 GGGCAGCTCCGCCTGCGGCCCGG + Intergenic
1006599034 6:35213765-35213787 GGGGAGCGGCCACCGCGCCGAGG + Intergenic
1008572478 6:52829220-52829242 GGGCACCGCCCCCTGCTCCGTGG - Intergenic
1009872317 6:69467534-69467556 GAGCACCGCCCCCTGCTCCACGG + Intergenic
1011129281 6:84037515-84037537 GGGCGCCGCCCCCTGCTCCATGG - Intronic
1011338309 6:86284855-86284877 GAGCACCGCCCCCTGCTCCACGG - Intergenic
1011620054 6:89234525-89234547 GAGCACCGCCCCCTGCTCCACGG - Intergenic
1012145097 6:95670449-95670471 GGGCAGCTCCGCCTGGGCCATGG + Intergenic
1012598904 6:101070584-101070606 GAGCACTGCCCCCTGCTCCGTGG + Intergenic
1014079517 6:117270781-117270803 GGGCGGCGCCCTCGGCGCCCAGG + Exonic
1014088329 6:117373327-117373349 GGGTGCCGCCCCCTGCTCCGTGG - Intronic
1014507809 6:122280904-122280926 GAGCACCGCCCCCTGCTCCACGG + Intergenic
1014586353 6:123202281-123202303 GGGCGCCGCACCCTGCTCCGCGG + Intergenic
1016433074 6:144008166-144008188 GGGAAGCGCCCCGCGCGCCAAGG + Intronic
1016738863 6:147508165-147508187 CCGCAGCGTCCCCAGCGCCGTGG + Intergenic
1018025266 6:159800581-159800603 GGCCAGAGCCCCGTGCGCCCAGG + Intronic
1019322098 7:420436-420458 GGGCAGCGGCCCCTTGGGCGGGG - Intergenic
1019617945 7:1975014-1975036 CGACAGCGGCCCCTGCGCCTGGG - Intronic
1021359361 7:19692287-19692309 GGGCAACACCCCCTGCTCCGCGG - Intergenic
1021969225 7:25950930-25950952 GGGCTGCGTCCCCCGGGCCGGGG + Intergenic
1022388597 7:29924465-29924487 GGGCAGGGCCACCTGTGCAGGGG - Intronic
1023879324 7:44309416-44309438 GGGCTGCGCCTCCAGCCCCGGGG + Intronic
1025249802 7:57344179-57344201 GGGCAGCCTCCCCTGAGCCACGG - Intergenic
1026769723 7:73187952-73187974 GGGCAGGGCGGCCTGCGCTGGGG + Intergenic
1026955810 7:74375929-74375951 GAGGAGCTCACCCTGCGCCGAGG + Exonic
1027010591 7:74741334-74741356 GGGCAGGGCGGCCTGCGCTGGGG + Intronic
1027077451 7:75204706-75204728 GGGCAGGGCGGCCTGCGCTGGGG - Intergenic
1027778997 7:82499894-82499916 GAGCACCGCCCCCTGCTCCAAGG + Intergenic
1028058680 7:86282188-86282210 GGGAACCGCCCCCTGCTCCAGGG - Intergenic
1031110009 7:117596433-117596455 GAGCACCGCCCCCTGCTCCACGG + Intronic
1032306114 7:130733793-130733815 GCGCGGCGCCGCCCGCGCCGGGG + Exonic
1032791533 7:135246473-135246495 GGGCAGCGCCGCCTCCTGCGGGG - Exonic
1033312383 7:140271381-140271403 GAGCACCGCCCCCTGCTCCACGG - Intergenic
1034270899 7:149803053-149803075 TGGCGGTGCCCCCTGCCCCGGGG + Intergenic
1034632096 7:152538924-152538946 GAGCACCGCCCCCTGCTCCACGG - Intergenic
1034819539 7:154204113-154204135 GGGCAGTGCCACCTGCGCAGTGG + Intronic
1035463826 7:159063099-159063121 GGGCAGCTCCGCCTGCGGCCCGG - Intronic
1035579612 8:731645-731667 GGGCAGTGCCCCCGGCCCCAAGG + Intronic
1035747780 8:1974162-1974184 GGGCAGCGCTGCCCGCGGCGGGG + Intronic
1036260509 8:7235974-7235996 GAGCACCGCCCCCTGCTCCATGG + Intergenic
1036306104 8:7603548-7603570 GAGCACCGCCCCCTGCTCCATGG - Intergenic
1036312546 8:7694530-7694552 GAGCACCGCCCCCTGCTCCATGG + Intergenic
1036356950 8:8051533-8051555 GAGCACCGCCCCCTGCTCCATGG - Intergenic
1036378307 8:8219196-8219218 GGGCACCACCCCCTGCTCCAGGG + Intergenic
1036788996 8:11705168-11705190 GGGCAGCGCGGCCCGCACCGTGG + Intronic
1036915025 8:12796587-12796609 GGGCGCCGCCCCCTGCTCCACGG + Intergenic
1036930461 8:12951508-12951530 GGGCCGCGCCCGCCCCGCCGGGG - Intronic
1037239463 8:16760577-16760599 GAGCACCGCCCCCTGCTCCATGG - Intergenic
1037263796 8:17036854-17036876 GAGCACCACCCCCTGCGCCACGG - Intronic
1037811479 8:22089411-22089433 GGGCAGGGACCCCCGGGCCGCGG + Intronic
1039921557 8:41897089-41897111 GGGCGGCGCGCCCCGCGCCCGGG + Intergenic
1041034613 8:53775937-53775959 GAGCACCGCCCCCTGCTCCACGG - Intronic
1042021976 8:64378205-64378227 GGGCGGAGCCCTCTGCGCAGCGG - Intergenic
1042136031 8:65633924-65633946 GGGAAGCGGCCCCTGTACCGAGG - Intronic
1043670705 8:82881092-82881114 AGGCAGCTCCACCTGCGACGGGG + Intergenic
1045510842 8:102810819-102810841 GGGCCCCGCCCGCTGCGCCCAGG + Intergenic
1045933780 8:107655922-107655944 GGGCACCACCCCCTGCTCCGTGG + Intergenic
1046251928 8:111643150-111643172 GAGCACCGCCCCCTGCTCCATGG + Intergenic
1046497818 8:115037015-115037037 AGGCACCGCCCCCTGCTCCATGG + Intergenic
1046661153 8:116949786-116949808 GAGCGCCGCCCCCTGCTCCGCGG - Intergenic
1048112899 8:131487352-131487374 GAGCACCGCCCCCTGCTCCAAGG + Intergenic
1048186843 8:132249695-132249717 GAGCACCGCCCCCTGCTCTGCGG - Intronic
1049090640 8:140511393-140511415 GAGCCGCGCCCGCTGCCCCGTGG - Exonic
1049597403 8:143491156-143491178 GGGCGGAGCCCCCTGTGCCTGGG - Intronic
1049616428 8:143577599-143577621 GGGATGGGCCCCCAGCGCCGGGG - Intronic
1049773027 8:144392471-144392493 ATGCAGCGCCCCGTGCGCCTGGG + Exonic
1049774244 8:144397267-144397289 GGGCAGCTCCCCCTGGCGCGTGG + Exonic
1049776583 8:144408787-144408809 GGGCAGCGCGCCCTTCCCGGTGG + Intronic
1049944465 9:580808-580830 GAGCACCGCCCCCTGCTCCGCGG - Intronic
1050090943 9:2016247-2016269 GGGCTGCGCCCCGGGCGCTGCGG + Intronic
1050300488 9:4253351-4253373 GGGCAGAGCCCACTGCACCTTGG - Intronic
1050749496 9:8920674-8920696 GGGCTGCGGCCCATGGGCCGTGG + Intronic
1053381223 9:37650942-37650964 GGGCTCCGCCTCCCGCGCCGAGG - Intronic
1053614025 9:39745032-39745054 GGGCAGCTGCCCTTGCGCCTGGG + Intergenic
1053811991 9:41862435-41862457 GAGCACCGCCCCCTGCTCCACGG - Intergenic
1053872055 9:42502973-42502995 GGGCAGCTGCCCTTGCGCCTGGG + Intergenic
1053900702 9:42793011-42793033 GGGCAGCTACCCTTGCGCCTGGG - Intergenic
1053928324 9:43089686-43089708 GGGCACTGCCCCCTGCTTCGTGG + Intergenic
1054239491 9:62597361-62597383 GGGCAGCTGCCCTTGCGCCTGGG - Intergenic
1054260945 9:62864531-62864553 GGGCAGCTGCCCTTGCGCCTGGG + Intergenic
1054553623 9:66631888-66631910 GGGCAGCTGCCCTTGCGCCTGGG - Intergenic
1054618604 9:67325004-67325026 GAGCACCGCCCCCTGCTCCACGG + Intergenic
1055985480 9:82054418-82054440 GAGCACCGCCCCCTGCTCTGCGG - Intergenic
1057907142 9:98992147-98992169 GGGGACCGCCCCCTGCTCTGCGG - Intronic
1058379526 9:104362939-104362961 GAGCGCCGCCCCCTGCTCCGCGG - Intergenic
1059810668 9:117852348-117852370 GAGCACCGCCCCCTGCTCCACGG + Intergenic
1060212940 9:121721547-121721569 GGGCAGCAGCCCCTGCACCATGG + Intronic
1060301850 9:122378583-122378605 GGGCAGGGCCCCCTGACCTGGGG + Intronic
1060550484 9:124482615-124482637 GGGCAGCGGCCTCTGGGACGGGG + Exonic
1061187133 9:129061157-129061179 GGGCAGGTGCCCTTGCGCCGTGG + Intronic
1062389290 9:136327648-136327670 CGGGAGCGCCCCCCGCGCCGTGG - Exonic
1203744990 Un_GL000218v1:36622-36644 GGGCAGCACCACCTGGGCCTAGG + Intergenic
1203565116 Un_KI270744v1:82862-82884 GGGCAGCACCACCTGGGCCTAGG - Intergenic
1185747405 X:2583975-2583997 GGGGGGCGCCCCCAGCGCCAGGG - Intergenic
1190045824 X:47111041-47111063 GAGCACCGCCCCCTGCTCCATGG - Intergenic
1199094792 X:143726272-143726294 GGGCACCACCCCCTGCTCCGCGG - Intergenic
1201158326 Y:11151661-11151683 GGGCAGCGCCACCTGGGCCTGGG + Intergenic