ID: 1115129448

View in Genome Browser
Species Human (GRCh38)
Location 14:30037019-30037041
Sequence ACTTAAAAGAAGAAACTCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 673
Summary {0: 1, 1: 1, 2: 0, 3: 47, 4: 624}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115129448 Original CRISPR ACTTAAAAGAAGAAACTCAA GGG (reversed) Intronic
900008416 1:81451-81473 ACTGAAAATAAGAAACAGAATGG - Intergenic
900036642 1:415533-415555 ACTGAAAATAAGAAACAGAATGG - Intergenic
900058271 1:651281-651303 ACTGAAAATAAGAAACAGAATGG - Intergenic
900423331 1:2565019-2565041 CATGAAAAGAAGAAAATCAAGGG - Intronic
900849563 1:5131402-5131424 CCTTATAAGAAGAGACTCAGAGG + Intergenic
901393117 1:8960483-8960505 ACTCAAAAAAGGAATCTCAATGG + Intronic
901432731 1:9227236-9227258 TCTCCAAAGAAGACACTCAATGG + Intergenic
902358681 1:15928695-15928717 ACTGACAAGCAGAAACGCAAAGG + Exonic
902913116 1:19615904-19615926 AATTAAAAAAAAAAATTCAATGG - Intronic
903096168 1:20976626-20976648 ACTTACTATAAGAAACTGAATGG + Intronic
904273987 1:29368503-29368525 CCTTATAAGAAGAGACTCCAGGG - Intergenic
905181503 1:36169976-36169998 ATTTAAAAAAAGAGACTTAAAGG + Intronic
905486857 1:38305210-38305232 GCTCAAAAGAAGACACACAATGG + Intergenic
905519243 1:38585471-38585493 ACTTTTCAGAAGAAGCTCAAAGG + Intergenic
906067891 1:42995275-42995297 ACTTAAAAGAACAAATTCTGTGG + Intergenic
906992024 1:50749321-50749343 ACTTAAAAGAAGTTTCTTAAAGG + Intronic
908785665 1:67732443-67732465 TTTTAAAATAAGAAACCCAAGGG - Intronic
909396517 1:75176518-75176540 ATTTACAAGAAAAAAATCAAAGG - Intergenic
909701065 1:78523823-78523845 TGTTTAAAGAAGAGACTCAAAGG + Intronic
909887830 1:80964568-80964590 AGTTTCAAGAAGATACTCAAAGG - Intergenic
910888238 1:91989161-91989183 ACTAAAAAAAAAAAATTCAAGGG - Intronic
911292699 1:96077345-96077367 GCATAAAAGAATAAACTCCAAGG - Intergenic
911435251 1:97847550-97847572 GCTTAAATGAAGGGACTCAATGG + Intronic
912079162 1:105913448-105913470 ACTATAAAGAGGAAACTCATGGG - Intergenic
912112428 1:106359323-106359345 TTTTAAAATAAAAAACTCAATGG + Intergenic
912214712 1:107595339-107595361 CCTTGAAAGCAGAAACTGAAAGG - Intronic
912780426 1:112541600-112541622 ATTTAAATGAAAAAAATCAAAGG + Intronic
912835219 1:112990421-112990443 ACTTAAATGAACAAACTGAAAGG + Intergenic
913704693 1:121407634-121407656 ACTTAAAAAAATAAAATAAAAGG - Intergenic
914278072 1:146142943-146142965 ACGAAAAAAGAGAAACTCAAGGG + Intronic
915048915 1:153047303-153047325 AATTAAAAGAAGAAATTAATAGG + Intergenic
915071752 1:153274790-153274812 ACTCAAATGAAGAAACTGATGGG + Intergenic
915279007 1:154809710-154809732 ACGTAACAGAAGAAAATGAAAGG + Intronic
915805965 1:158850540-158850562 ACTGAAAAAAAGAAAAACAAAGG + Intergenic
916363197 1:163994207-163994229 AATTCCAAGAAGAAAGTCAACGG - Intergenic
916501670 1:165392860-165392882 GCTTAGAAGAGGAATCTCAAGGG - Intergenic
916576628 1:166072721-166072743 AATTCTAAGAAGGAACTCAAAGG - Intronic
917004928 1:170404173-170404195 ATTTATAAAAAGAAAGTCAAAGG - Intergenic
917037932 1:170769656-170769678 ACTCAAAAGATTAACCTCAAGGG + Intergenic
917508149 1:175647818-175647840 AATTGAAAGAAGAAACTGATGGG - Intronic
918009931 1:180577266-180577288 AATTCAAAGGAGAAATTCAAAGG - Intergenic
918427005 1:184420804-184420826 ATTTAAAAAAAAAAACTCATGGG - Intronic
918642265 1:186857188-186857210 TGTTAAAAGAAGAAACTGAATGG + Intronic
918813013 1:189144838-189144860 ACCTCAAAGAAGAAATTAAAAGG + Intergenic
919008866 1:191933811-191933833 AATTAAAATAAGAAATTAAAAGG + Intergenic
919111758 1:193228694-193228716 ACTTAAAAGCTGAAACTGTAAGG + Intronic
919113840 1:193256099-193256121 ACTGAAAAGCAGATAATCAAAGG - Intergenic
919445277 1:197697039-197697061 ACACAAAAGAAGAAACAGAATGG + Intronic
919600268 1:199613709-199613731 ACATAAAAAAAGGAACACAAAGG - Intergenic
920887224 1:209941104-209941126 ACTTAAAAGTCTAGACTCAAGGG - Intronic
921534430 1:216328556-216328578 AGTTAAAAGAAAAAACACATTGG - Intronic
921633617 1:217465215-217465237 AATTAAAAAAAGAAATTAAAAGG + Intronic
921649678 1:217662031-217662053 TCTTAAAAGAAGCAAATGAAAGG - Intronic
923108222 1:230870235-230870257 GATTATAAGAAGAAACTCAGGGG + Intergenic
923913668 1:238479018-238479040 ATTTTAAAGAAGAAATGCAAAGG - Intergenic
924169487 1:241323072-241323094 ATTTAAACGATGAAACTAAATGG - Intronic
1063245643 10:4215349-4215371 ACTTGAAAAAAGAGGCTCAAGGG - Intergenic
1063400400 10:5738524-5738546 ATTTAAAACAGCAAACTCAAAGG - Intronic
1063601410 10:7484522-7484544 AGTTCAAAGAATAGACTCAATGG - Intergenic
1063956952 10:11276099-11276121 ATTTAAAAAAAGAAACAGAAAGG - Intronic
1064018256 10:11789455-11789477 ATTTAAAAAAACAAGCTCAATGG - Intergenic
1064166456 10:12990459-12990481 ACTTAAAAGAATGAAATGAAGGG + Intronic
1064748803 10:18504543-18504565 AATAAAATGAAGAAAATCAAAGG - Intronic
1064924459 10:20554967-20554989 ACTCAAAAGAAGAAATTTCAAGG - Intergenic
1065076217 10:22082085-22082107 AATTGAAAGGAGAGACTCAAGGG + Intergenic
1066442670 10:35453660-35453682 ACTTGAAAGAAGTAATTTAAAGG - Intronic
1067153570 10:43755972-43755994 TCTTAAAAGATGGAACTAAAAGG - Intergenic
1068092909 10:52454923-52454945 ACTTAAAATAAGGAAGTCTAAGG - Intergenic
1068386002 10:56328239-56328261 AGGTAAAAGAAGAAAATAAAAGG - Intergenic
1069577020 10:69538048-69538070 CCTTATAAGAAGAGACTCCAGGG - Intergenic
1071015352 10:80990441-80990463 AATAAAAAAAAGAAACTCAAAGG - Intergenic
1071035866 10:81244608-81244630 AATTAAAAGCAGGAAATCAATGG + Intergenic
1071147453 10:82591536-82591558 ATTTAAAAGAAAAAATTCAAAGG - Intronic
1072476085 10:95761128-95761150 ACTTAAAAGAATAGACTCTATGG - Intronic
1073228838 10:101948997-101949019 AAGTCAAAGAAGAAATTCAAGGG + Intronic
1073575937 10:104623179-104623201 ACTGAAAATAAAAATCTCAAAGG + Intergenic
1073767099 10:106694677-106694699 CTTTAAAAGAGAAAACTCAACGG - Intronic
1073917607 10:108424860-108424882 ACATATAAGAATAAACTCAAAGG - Intergenic
1073940864 10:108696177-108696199 ATTAAAAAGAGGAAAATCAATGG + Intergenic
1074858887 10:117494515-117494537 AATAAAAAGAAGAAAATAAAAGG + Intergenic
1075260111 10:120955970-120955992 ACTTAAAATGAGACTCTCAATGG + Intergenic
1076191786 10:128488308-128488330 CCTTAAAAGAAGAGACACCAGGG - Intergenic
1076208188 10:128620008-128620030 ATTTTAAAAAAGAAAATCAATGG + Intergenic
1076230153 10:128813554-128813576 ACTTAGGAGAAGAAAGTAAAAGG - Intergenic
1077231649 11:1460505-1460527 ACGTCAAAGAAGTTACTCAATGG - Intronic
1077761056 11:5098840-5098862 ACAAAAAAGAACAAACACAACGG - Intergenic
1077987004 11:7362792-7362814 AATTAAAAGATGAAACTGATTGG - Intronic
1079032563 11:16996634-16996656 ACTTAAAAGCTGAATCTCAGAGG + Intronic
1079162884 11:18011339-18011361 CCTTAAAAGAAGAGACACCACGG + Intronic
1079508518 11:21182927-21182949 ACTTACAAGAAGAAGCTAAAAGG + Intronic
1079588672 11:22156037-22156059 AGTTAAAAAAAGAAATTCATAGG - Intergenic
1079744105 11:24103029-24103051 ACATTAAAGAAAAAAATCAAAGG + Intergenic
1080157240 11:29126058-29126080 ACTTAAAAGAAGAGATTTATAGG - Intergenic
1080421480 11:32114908-32114930 ACCTAAAAGAAAAGAATCAAGGG - Intergenic
1080678321 11:34448652-34448674 AATTAAAAAAAAAAAGTCAATGG - Intronic
1080728952 11:34928250-34928272 ATTTCAAAGAAGCAACTAAATGG - Intronic
1081362696 11:42199926-42199948 ACTTATAAGAAGGAACTTAATGG + Intergenic
1082215064 11:49559077-49559099 ACTAAAAAAAAAAAACTCAGAGG + Intergenic
1082216331 11:49574402-49574424 ACTTAAATGAATAAAATGAATGG + Intergenic
1082781200 11:57288877-57288899 ACTGAACATAACAAACTCAAGGG + Intergenic
1083120211 11:60504874-60504896 ACTTCAAAGAACATACTCTAGGG - Intronic
1084346534 11:68553811-68553833 ATTTAAAACATGACACTCAAAGG - Intronic
1084628415 11:70327887-70327909 ACTGAAAAGCAGACATTCAACGG - Intronic
1084754365 11:71225637-71225659 ACTGAAAAAAAGAAAATCAATGG + Intronic
1084917201 11:72437745-72437767 AAATAAAATAAGAAAATCAATGG - Intergenic
1085409972 11:76285047-76285069 ACTTATAAAAAGAGACTCCAGGG + Intergenic
1085601393 11:77859172-77859194 ACTCAAAAGAAGAAATAGAATGG - Intronic
1085916987 11:80902373-80902395 AATTAAAAGAAAAAAAGCAATGG + Intergenic
1086237508 11:84649480-84649502 AATTAAACAAAGAAACCCAAAGG + Intronic
1086562537 11:88184658-88184680 AATTTAGAGAAGATACTCAAAGG - Intergenic
1087291811 11:96328308-96328330 TCTTAACAGAAGAAATTCTAAGG + Intronic
1087300215 11:96424403-96424425 TCTTAAAACCAGAGACTCAAGGG - Intronic
1087300589 11:96429487-96429509 AATTAATAGAAGAAAATAAATGG + Intronic
1087942700 11:104118274-104118296 CCTTATAAGAAGAGACACAAGGG + Intronic
1088035960 11:105316096-105316118 ACTTAAAAGGAGTAAGACAAAGG - Intergenic
1088336939 11:108715944-108715966 ATTTAAAAGAAAGAGCTCAAAGG + Exonic
1088766675 11:112988371-112988393 ATATAAAAGTAAAAACTCAATGG - Intronic
1090484782 11:127103401-127103423 ATTTAAAAAAAGAAAGTGAAGGG + Intergenic
1090527331 11:127551520-127551542 TCTTAGAAGAAGAAAAACAATGG - Intergenic
1092631033 12:10378096-10378118 ATTAAAAAGAAGAGACTCATTGG + Intronic
1092769819 12:11886312-11886334 AGTTAAAAGCACAAAGTCAATGG + Intronic
1092966212 12:13645954-13645976 AATGATTAGAAGAAACTCAAAGG + Intronic
1093324983 12:17762427-17762449 ACTTCAAAAAAGAAAGTAAAGGG - Intergenic
1093537670 12:20241927-20241949 ACTTTCAAGAAGACACTCTAAGG - Intergenic
1093805892 12:23432524-23432546 AATTAAAAGAAGAAATTCTGTGG - Intergenic
1094031983 12:26022536-26022558 ATTTAACAGAAAAAACTTAAAGG + Intronic
1094359539 12:29615399-29615421 ATTTAAAAGAAGGCACTCGAGGG - Intronic
1094544149 12:31388636-31388658 ACTTAAAAAAAGAAATCTAAAGG + Intronic
1095218147 12:39574582-39574604 ACTTGAAAGAAGAAAGGGAAAGG - Intronic
1095445934 12:42282285-42282307 AGCTAAAAGAAGTAAATCAAGGG - Intronic
1095448625 12:42306205-42306227 TATTAAAAGTAGAAACTCACTGG - Intronic
1095473233 12:42559067-42559089 ACTTCTAAAAAGAAAATCAAAGG + Intronic
1095695900 12:45143826-45143848 ACTTATAAGAAGAGACTCCAGGG - Intergenic
1096586344 12:52622822-52622844 AATCAAAATAAAAAACTCAATGG + Intergenic
1097045124 12:56181898-56181920 CCTTAACAGAAAAAGCTCAAGGG + Intronic
1097303056 12:58038726-58038748 AGTAAAAAGAACAAAGTCAAAGG - Intergenic
1097789428 12:63798505-63798527 ATCTAAAAGAAGAAACTTTAAGG - Intronic
1098165556 12:67694031-67694053 TCTCAAAAGGAGAAACTCAACGG + Intergenic
1098661312 12:73098093-73098115 ACTAGAAAGAAAAAACACAAGGG - Intergenic
1098676785 12:73299515-73299537 AATAAAAAGAAGAAAATGAAAGG - Intergenic
1099389229 12:82058403-82058425 ACTGAAAAGAAATGACTCAAGGG + Intergenic
1099443087 12:82722150-82722172 ACTTAAAAAAGAAAAATCAAAGG + Intronic
1099587419 12:84536881-84536903 ATGTAAAAGAAGACACTGAACGG - Intergenic
1099680391 12:85820757-85820779 AACTTAAAGAAGACACTCAAAGG - Intronic
1100952002 12:99861311-99861333 AAATAAGAGAAGAAAATCAATGG + Intronic
1101121245 12:101582687-101582709 CTTTAGTAGAAGAAACTCAAAGG - Intronic
1101350512 12:103926192-103926214 ACTTAAAACAAAAAACCCTAGGG + Intergenic
1101550406 12:105756276-105756298 AATTAAAAAAAGAAAGTCATGGG - Intergenic
1103362522 12:120362273-120362295 ACCTAAAAGAAGAAAGACCAGGG + Intronic
1104040915 12:125129963-125129985 ACTCAAAAGACGACACCCAAGGG - Intronic
1104431571 12:128720671-128720693 ACTTAAAAGAAAAAACTGGCCGG + Intergenic
1104819802 12:131669475-131669497 GGGTAAAAGAAGAAACACAAAGG + Intergenic
1106317988 13:28612120-28612142 ACTTACAAGTAAAAACACAATGG - Intergenic
1106395395 13:29375131-29375153 ACTTTTAATAAGAAACTCACTGG + Intronic
1106523742 13:30521258-30521280 ACTTAAAATGAAAAATTCAATGG + Intronic
1106703613 13:32256549-32256571 ATTTAGAAGAAGAAACTCACGGG + Intronic
1106962132 13:35010950-35010972 ACTTAAAAAAAAAAAATCATTGG - Intronic
1107205591 13:37782413-37782435 ACTTAAAGAAAGAAACAAAAAGG - Intronic
1107741594 13:43455928-43455950 ACTTAAAAAAAGAAGTTTAATGG - Intronic
1107748293 13:43536550-43536572 ACTTAAAAAAAAAAACTCCATGG + Intronic
1107911980 13:45114025-45114047 ACTGAACAGAAGCAATTCAACGG + Intergenic
1108201379 13:48047474-48047496 ACTTAAAAAATGATACTCACTGG - Intergenic
1108700832 13:52942706-52942728 ATTTTAAAAAAGAAATTCAATGG + Intergenic
1108760632 13:53559427-53559449 ATTTAAAACAAAAATCTCAAAGG + Intergenic
1109019458 13:57068676-57068698 ACTGAAAAGAAGAAGGTGAATGG + Intergenic
1109257896 13:60105840-60105862 ACTTAAGAGAATTAACACAAAGG + Intronic
1109581100 13:64335474-64335496 ACTTAGAAGATGTAACTCAGAGG + Intergenic
1110025228 13:70529382-70529404 AAATAAAAGCAGAAACACAAAGG - Intergenic
1110125271 13:71934343-71934365 ACTTAAAACAAGTGACTAAAGGG + Intergenic
1110903797 13:80860291-80860313 ACTTGAAAGAAGAAAGTTTAAGG - Intergenic
1110923482 13:81119817-81119839 AGTTAAAAAAAGAAAATGAAAGG - Intergenic
1111183819 13:84702440-84702462 ACTTACAAGACGAAAGTCTAGGG - Intergenic
1111788313 13:92819597-92819619 ACTTAAGTGAAAAAAATCAATGG - Intronic
1111992121 13:95126932-95126954 TTTTTAAAGAAGAAATTCAATGG - Intronic
1112135399 13:96573282-96573304 AGTTAAAAGAAAAAAATAAAAGG - Intronic
1112213918 13:97410680-97410702 GCTTAGAGGAAAAAACTCAAAGG - Intergenic
1112481852 13:99783346-99783368 AATTAAAATAAAAAACTCAGAGG - Intronic
1112810172 13:103209232-103209254 ACTAAAAAAAAGAAACTTAGAGG - Intergenic
1112820280 13:103326244-103326266 ACTTAATGGAAGAAAACCAAAGG + Intergenic
1113662577 13:112117549-112117571 ACTTAAAACAAGATACCTAAGGG + Intergenic
1113986196 13:114317777-114317799 ACTTCAAAGAAGAAATTGAATGG + Intronic
1114509864 14:23249534-23249556 AATTAAAAAGAGATACTCAATGG + Intronic
1114810009 14:25887697-25887719 ACTTAATAGAAAAAACACATAGG - Intergenic
1114836129 14:26204855-26204877 ACTTTAAAGGACAAACTAAATGG - Intergenic
1114960366 14:27880085-27880107 AATTAAAAGAAGAAAACCACAGG - Intergenic
1115129448 14:30037019-30037041 ACTTAAAAGAAGAAACTCAAGGG - Intronic
1115458748 14:33635409-33635431 AGTTAGAAGAAGAAAAGCAAGGG + Intronic
1115554458 14:34533341-34533363 TCTTAAAAGACCAAACTCAGAGG + Intronic
1116033524 14:39601202-39601224 AATTCTATGAAGAAACTCAATGG - Intergenic
1116204635 14:41848081-41848103 ATTTAAAATATGAAAATCAAAGG + Intronic
1116306114 14:43257972-43257994 ATTTTAAAGAAGAAAATCAAGGG - Intergenic
1116621419 14:47208769-47208791 ATTTAAAAGAAGTAAATCTATGG - Intronic
1116923801 14:50611626-50611648 ACAAAAAAGAATAAACACAAAGG + Intronic
1116939583 14:50777678-50777700 AATTAAAAAAAAAAAATCAATGG + Intronic
1117540296 14:56740511-56740533 AGTTTAAAAATGAAACTCAATGG + Intergenic
1117770477 14:59129354-59129376 ACTTAAAAGAAGAAGCTACCAGG + Intergenic
1117992708 14:61450395-61450417 AATAAAAAGAAGAGACTCAGAGG - Intronic
1118255793 14:64204687-64204709 ACTTAAAAAAAAAAAATTAATGG + Intronic
1120890808 14:89489408-89489430 ATTTAAAAGGAGAATCTCAAGGG - Intronic
1120903013 14:89591946-89591968 AAGAAAAACAAGAAACTCAAAGG + Intronic
1121932684 14:97987454-97987476 ACTTAAAAAAAAAAAAGCAAAGG - Intergenic
1122351787 14:101099941-101099963 ACCAAAAGGAACAAACTCAAAGG - Intergenic
1122763934 14:104051734-104051756 TCTCAAAAGAAGACACTGAAGGG - Intronic
1124001451 15:25763891-25763913 ACTTAAAAGAAGACACAGAGAGG - Intronic
1124044273 15:26134138-26134160 CCACAAATGAAGAAACTCAAAGG + Intergenic
1124722740 15:32124822-32124844 CCTTATAAGAAGAGACACAAGGG + Intronic
1124907789 15:33887674-33887696 ACAGAAAAAAAGAAACTTAAAGG + Intronic
1125004383 15:34800645-34800667 ACTTCCAAGCAGAAACTCATGGG - Intergenic
1125239354 15:37555854-37555876 AATTAAAAAAAAAAACACAAGGG + Intergenic
1125254745 15:37750607-37750629 ACTCAAAAGAAGACATACAAGGG + Intergenic
1126350491 15:47740626-47740648 ACTTAAAAGAAGGGTTTCAAAGG + Intronic
1127394293 15:58531257-58531279 CCTTAAAAGAAGATACACAAAGG - Intronic
1127667384 15:61161817-61161839 ACTTAAAAACAGAAACTCATGGG + Intronic
1127829964 15:62742112-62742134 GAATAAATGAAGAAACTCAAGGG - Intronic
1128423211 15:67514459-67514481 ACTTAAAAACAGATACTCACAGG - Intergenic
1128424318 15:67524249-67524271 ACTTCAAAGCTGAAAATCAATGG - Intronic
1128989352 15:72245885-72245907 ACAGAAAAGAAGAATCTCAGTGG + Intronic
1130024681 15:80260907-80260929 TCCTAAATGAAGATACTCAAGGG + Intergenic
1130418364 15:83715482-83715504 ACTTAATAAGAGAATCTCAAAGG - Intronic
1130710403 15:86275058-86275080 AAATAAAAAAAGAAACTAAAAGG - Intronic
1131702931 15:94959432-94959454 ACTTAAAAAAAAAAAAACAAGGG + Intergenic
1131755476 15:95556234-95556256 ACTTACAAGAAGAGCTTCAATGG - Intergenic
1132012397 15:98287567-98287589 ATTTGAAATAAGAAATTCAAGGG - Intergenic
1132035413 15:98479774-98479796 ACTTTAAAGAAGAAAACCAGTGG + Intronic
1132445140 15:101910664-101910686 ACTGAAAATAAGAAACAGAATGG + Intergenic
1132721487 16:1318492-1318514 GCTTCAAAGAAGGAACACAAAGG - Intronic
1133510522 16:6453099-6453121 AATTAAAAAAAGAAAGTCAGGGG - Intronic
1133906836 16:10030028-10030050 ATATACAAAAAGAAACTCAATGG + Intronic
1134781415 16:16900357-16900379 ACATCAATGAAGAAACTAAAAGG - Intergenic
1135095429 16:19560885-19560907 ATTTAAAAAAAAAAACACAAAGG - Intronic
1135823693 16:25707220-25707242 ACTTAAAAGAAGCACTTCATGGG - Intronic
1136314284 16:29441898-29441920 ACTTAAAAAAAAAAACACACGGG + Intergenic
1136327723 16:29543663-29543685 ACTTAAAAAAAAAAACACACGGG + Intergenic
1137889145 16:52140168-52140190 TATGAAAAGAAGAAATTCAAAGG + Intergenic
1137895718 16:52209977-52209999 TCTTAAAAGAAGAAAACAAATGG + Intergenic
1138173275 16:54872993-54873015 AGTTAAAAGATGACAGTCAAAGG - Intergenic
1138761287 16:59547674-59547696 AGTAAAAAGAAGAAAGTAAAGGG - Intergenic
1140562096 16:75995433-75995455 ACATAAAAGAAGAGAGTTAACGG + Intergenic
1141121373 16:81360569-81360591 AATTAAAAAAAAAAAATCAATGG - Intronic
1141285691 16:82669439-82669461 ACTTAAAATAAAAGGCTCAATGG - Intronic
1203071211 16_KI270728v1_random:1076292-1076314 ACCTAAAAGGAGAAAATCCAGGG - Intergenic
1143071370 17:4296844-4296866 ACTTAAAAGCAGGAACTTATAGG - Intronic
1143173709 17:4944811-4944833 ACCAAGAGGAAGAAACTCAAGGG + Exonic
1143208099 17:5160568-5160590 AGTTAAAAGAAGTTACTCCATGG + Intronic
1143459278 17:7090571-7090593 AATTGAAACAAAAAACTCAATGG + Intergenic
1143943923 17:10572664-10572686 ACTCAAAATATGAGACTCAAGGG - Intergenic
1144175627 17:12703817-12703839 ACTTAATAGAAGAATATCAAAGG - Intronic
1145186369 17:20798192-20798214 ATTTGAAAGTAGAAAATCAATGG - Intergenic
1146130288 17:30267527-30267549 ATTTCAAAGAAGAGACTGAATGG + Intronic
1146144588 17:30402156-30402178 AATTAAAAAAATAAACTGAATGG - Intronic
1146684212 17:34829718-34829740 AATTAAAAGCAGAAAATCAAAGG - Intergenic
1147328358 17:39681176-39681198 TCTTATAAGCAGAAACACAAGGG + Intronic
1147706802 17:42431193-42431215 ATTTAAAAAAAGAAAATGAAAGG - Intergenic
1148410745 17:47464655-47464677 ATTTGAAAGTAGAAAATCAATGG + Intergenic
1148937793 17:51177803-51177825 ATTTAAAATATGAAAATCAAAGG + Exonic
1149271379 17:54981891-54981913 ACATAAAAGAAGATACTGAATGG + Intronic
1149707627 17:58709375-58709397 ACTTTAAAAAAGTAATTCAAAGG - Intronic
1149977136 17:61277700-61277722 TCTTCAAAGAAGATACACAATGG + Intronic
1150669993 17:67185781-67185803 ACTTAAAAGTAAAATCTTAAAGG + Intronic
1151447123 17:74174497-74174519 ATTTAGAAGAAGAAACTCCTCGG + Intergenic
1152315373 17:79577497-79577519 ACTTGAAGAAATAAACTCAAAGG + Intergenic
1152983317 18:299378-299400 ATTCAAAAGATGAAACACAAAGG - Intergenic
1153570626 18:6469438-6469460 ACAGAAAAGAAGAAGCTAAATGG - Intergenic
1155469583 18:26177012-26177034 AGTAAAAAGAACAAACACAAAGG - Intronic
1155552333 18:26977914-26977936 ACTTAAAAAAAAAAATTCACAGG + Intronic
1156066993 18:33155265-33155287 GGTTAAAAAAAGAAACTGAATGG + Intronic
1156086013 18:33403618-33403640 TCTTAAAAGAAAAAGCTGAACGG + Intronic
1156431907 18:37084249-37084271 AGTTAAAACAAGAATCTTAAGGG + Intronic
1156455298 18:37289852-37289874 ACCCAAAAGATGAAACTCCAGGG - Intronic
1156742849 18:40353563-40353585 ACTTAAAAAAAAAAAGGCAAAGG + Intergenic
1156837894 18:41577128-41577150 ACTTAAGATCAGAAACTGAATGG + Intergenic
1156897387 18:42261622-42261644 AATTCGAAGGAGAAACTCAAAGG - Intergenic
1156968403 18:43124956-43124978 AATTAAAAAAAAAAACTCACAGG - Intergenic
1157188224 18:45558789-45558811 TCAAAAAAAAAGAAACTCAAAGG - Intronic
1158133177 18:54175538-54175560 ACTTAAAAGAAGAAGTCCCAGGG - Intronic
1158291541 18:55950451-55950473 AATTAGAAGTAGAAACTAAAAGG + Intergenic
1158669407 18:59461463-59461485 ATTTGAAAGTAGAAACTCAAGGG - Intronic
1159203928 18:65225738-65225760 ACTTAGAAGAGAAAACTGAATGG + Intergenic
1159501003 18:69269824-69269846 GTTCAAAAGAAGAAATTCAAAGG + Intergenic
1159691939 18:71499262-71499284 AATAAAAAGAAGAAATTCAAGGG - Intergenic
1159716070 18:71824789-71824811 ATGCAAAAAAAGAAACTCAATGG + Intergenic
1159984236 18:74822792-74822814 ACTTCTGTGAAGAAACTCAATGG + Intronic
1160640171 19:123043-123065 ACTGAAAATAAGAAACAGAATGG - Intergenic
1162720274 19:12657974-12657996 AAAAAAAAGAAGAAACTCGAGGG + Intronic
1164663056 19:29995520-29995542 AAATAAAAGAAGAAAGTAAAAGG - Intronic
1164738938 19:30562417-30562439 AATTAAAAGAAAATCCTCAATGG - Intronic
1166016267 19:39981439-39981461 ACTTCTAAGAAGAAATTAAATGG - Exonic
1166192315 19:41183213-41183235 ACCTAAAAGAAAGAAGTCAAGGG - Intergenic
1167131213 19:47587124-47587146 AATTAAAAAAAGAAAATTAAGGG + Intergenic
1167816896 19:51890773-51890795 ACATAAGAGAATACACTCAAGGG - Exonic
925991123 2:9255182-9255204 ACATCAAAGAAGATACACAATGG - Intronic
926581859 2:14639316-14639338 ACTAAAAGGAAAAAATTCAAAGG + Exonic
926711284 2:15883475-15883497 AATTAAAAGAAGAAAAGGAAGGG + Intergenic
927358816 2:22207904-22207926 ACTAAAAAGGAGAAATTCAGAGG - Intergenic
927373174 2:22381400-22381422 ATTTAAAAGGAGAAACCCAGTGG - Intergenic
928256781 2:29729597-29729619 TCTAAAAAGAGGAAATTCAATGG + Intronic
928312825 2:30224473-30224495 TCTTTAAAAAAGAAACTCAGGGG + Intergenic
928454812 2:31410403-31410425 ATTTAAAAAAAGAATATCAATGG + Intronic
928491822 2:31792340-31792362 ACTCAGAAGCAGAAAGTCAATGG + Intergenic
928628783 2:33169169-33169191 ACATGAAAGAAGAAACACACTGG - Intronic
928631889 2:33202110-33202132 ACTTAAAAGAATAAGCTTAATGG + Intronic
928732888 2:34253140-34253162 TCTTAAAAGAAGAACCACTAAGG - Intergenic
928833170 2:35513210-35513232 AATTATATGAAGAAAGTCAATGG + Intergenic
929561546 2:42959506-42959528 AGTTAAAACAAAAAAATCAATGG + Intergenic
930179739 2:48342057-48342079 AATTAAAACAATAAGCTCAAGGG - Intronic
930950255 2:57133283-57133305 AAATCAAAGAAGGAACTCAATGG - Intergenic
933114509 2:78450791-78450813 ATATAAAAGAACAAACTAAAAGG - Intergenic
933485995 2:82924486-82924508 ACTTAAGGAAAGAAAATCAAAGG + Intergenic
934118709 2:88819726-88819748 AAATAAAAAAAGAAATTCAAGGG + Intergenic
935351175 2:102152758-102152780 ACATCATAGCAGAAACTCAAAGG - Intronic
935427873 2:102940165-102940187 CCTTTAAAGAAGAAACACCAGGG + Intergenic
936249314 2:110855015-110855037 ATTTAAAAGAAGACTCTCAAAGG - Intronic
936779297 2:116012970-116012992 ATTTAAAAAAAAAAACTAAATGG + Intergenic
936786804 2:116103206-116103228 AATTATATGAAGAAAGTCAATGG + Intergenic
936845284 2:116823555-116823577 ACTTAAAAGCACAAACTCTGAGG + Intergenic
937610101 2:123850732-123850754 CCTCAAAAAAAGAAATTCAAAGG + Intergenic
938001569 2:127744227-127744249 ACTCCTAAGAATAAACTCAATGG - Intronic
938672519 2:133599646-133599668 ACTGAAAAGAAGAGACTGATGGG + Intergenic
938746658 2:134285038-134285060 ACGGTAAAGAAGAAAATCAAAGG - Intronic
938836615 2:135109880-135109902 ACTCAAAAGAAAATACACAAAGG - Intronic
939146011 2:138415605-138415627 ATTTTAAAGAAGAAACAGAAAGG + Intergenic
939542945 2:143515766-143515788 ACTTATATGTAGAAAATCAATGG + Intronic
939726089 2:145723329-145723351 ACTTAAAACAAGAATCTGATAGG - Intergenic
941653606 2:168119883-168119905 GACTAAAAGAAGAAACTAAATGG + Intronic
941733254 2:168943785-168943807 TCTTAGAAGAAAAAACTCACTGG - Intronic
941789217 2:169532803-169532825 ACTTAAAACAGGAAAAGCAAAGG + Intronic
942788046 2:179723999-179724021 AATTAAAAGAAGCAATTTAAAGG + Intronic
943100004 2:183476363-183476385 ACGTAAAAAAAGAAACTGAATGG - Intergenic
943102331 2:183503138-183503160 AATTAAAAAAATAAACTGAATGG - Intergenic
943195867 2:184748412-184748434 TCTCAAAAGAAGACATTCAAGGG - Intronic
943294685 2:186121984-186122006 ACTTAAAAGAAGAAAAAAATTGG - Intergenic
943399846 2:187394063-187394085 TCTTAAAAGAAGAAAAGAAAGGG + Intronic
944008038 2:194935590-194935612 ACTCAAAAGAAGAAACACATAGG - Intergenic
944050878 2:195468114-195468136 ACATAAAAAAAGAAACTAAAAGG - Intergenic
944927416 2:204479407-204479429 ACTTAAAGGAAGAAAGGGAAAGG - Intergenic
944947593 2:204707837-204707859 GCTTAAAACATGAAACTCATAGG - Intronic
944962947 2:204897052-204897074 ACTTAAAATAAGAATATCTATGG - Intronic
945293586 2:208148783-208148805 ACTTAAAGGAAGTTACTCTAGGG - Intergenic
946629431 2:221650069-221650091 ACATAAAAAAATTAACTCAAAGG - Intergenic
946815306 2:223571134-223571156 ACATAAGAGGAGAAACTCAATGG + Intergenic
946999217 2:225434029-225434051 ACTGAATAGAAGAAACTCATGGG - Intronic
947242903 2:228015816-228015838 ACTTGAAAGGAGAGACTCTATGG + Intronic
947962454 2:234251038-234251060 TTTTAAAAGAAGAAAATCATGGG + Intergenic
948359435 2:237408933-237408955 ACTTAAAAGAGGCTACTCCAAGG + Intronic
949002159 2:241621498-241621520 ACTGAAATGAAGAATCTCTAAGG + Intronic
1169591796 20:7151400-7151422 ACTTAAGAGAACAAATTCGATGG + Intergenic
1169787413 20:9374849-9374871 ACTTAAAGAAAGAATCTGAATGG - Intronic
1170229568 20:14029870-14029892 ACATTAAGAAAGAAACTCAATGG - Intronic
1170455745 20:16531199-16531221 ACTTAAAAATAAAAACTCAGTGG + Intronic
1171110325 20:22474676-22474698 AAGTATAAGAAGAAACTAAACGG + Intergenic
1173360631 20:42341448-42341470 TTTTAAAACAAGAAATTCAAAGG - Intronic
1173896455 20:46554743-46554765 ACTTAAAAAACCAAACTCATTGG + Intergenic
1174188229 20:48722031-48722053 ACTCAAATGCAGAAACTCAACGG + Intronic
1174818343 20:53705708-53705730 AATAATAAGAAGAAAATCAAAGG - Intergenic
1175003309 20:55653995-55654017 ACTAAAAAAAAAAAACTTAATGG + Intergenic
1175541887 20:59753149-59753171 AATTAAAAAAAAAAAATCAAGGG + Intronic
1177105648 21:16952249-16952271 TCTTAAAAGAAGACACACAAAGG + Intergenic
1177591016 21:23167901-23167923 AATTATATGAAGAAAGTCAATGG + Intergenic
1177857739 21:26418797-26418819 TCTTATAAGAAGAAACATAAGGG + Intergenic
1179182356 21:39056652-39056674 AGTAAAGAGAAGAAACTGAAGGG - Intergenic
1181599908 22:23944118-23944140 ACAAAAATGAAGAAACTAAAAGG + Intergenic
1181973320 22:26710366-26710388 AATTAAAAAAAGAAAATCAATGG - Intergenic
1182265693 22:29113393-29113415 ATTTAAAAGACAAAAATCAAAGG - Intronic
1182269060 22:29142047-29142069 ATCTTTAAGAAGAAACTCAAGGG + Exonic
1183788781 22:40048027-40048049 ACTTAAATGGAGCAACTCATGGG + Intronic
1184410597 22:44323832-44323854 ATTTAAAAGCAGAAACACCAAGG - Intergenic
949324639 3:2849637-2849659 ACTTTACAGAAGAAGATCAAGGG + Intronic
949377218 3:3404198-3404220 ACCTAAAAGTAGTAACACAAAGG + Intergenic
949452603 3:4203463-4203485 ACTTACATGAAGACACACAAAGG - Intronic
951497300 3:23344452-23344474 ACTGAAAAAAAAAAATTCAAAGG - Intronic
951797822 3:26560740-26560762 CCTTCAGAGAAGAAACTCTAAGG + Intergenic
952355651 3:32581038-32581060 ACTGAAAAGAAGAAAGAAAAAGG + Intergenic
952746833 3:36789627-36789649 ACATAAAAGAAGTATCTAAAAGG + Intergenic
955295473 3:57730713-57730735 AATTAAAAGAAGAAAAGAAATGG + Intergenic
955466402 3:59242130-59242152 GCTTAAAAGAATAAACTAGAAGG - Intergenic
955496267 3:59536248-59536270 ACTTAACAGAGGAAACTAATGGG + Intergenic
955657282 3:61258328-61258350 AATTAAAAAAAAAAAATCAAGGG - Intergenic
955863535 3:63357522-63357544 AGTTAAAAGAAGGAACTCAGTGG - Intronic
956575126 3:70744220-70744242 AATTAAAAAAAGAAAGTCAGAGG + Intergenic
956924358 3:73967532-73967554 TCTTAAAGGAAGAAACTTAGAGG - Intergenic
957253699 3:77809628-77809650 ACTTAAAAGCAGCAGCTGAAAGG + Intergenic
957388656 3:79532284-79532306 AATAAAAAGAAGAAAATAAAGGG + Intronic
958925104 3:100149116-100149138 ACAAACAAGAAGAAAATCAAGGG - Intronic
959249582 3:103924839-103924861 ACTTGAAAAAAAAAAATCAAGGG + Intergenic
959616440 3:108353435-108353457 ACATAAATGAAGAAAGCCAAAGG - Exonic
959645072 3:108690036-108690058 ACTTCAAAGGGGAAAGTCAATGG - Intronic
959790114 3:110349615-110349637 AATTAAAATAATGAACTCAAAGG - Intergenic
960364385 3:116752976-116752998 GCTTCAAAGAAGAAATTAAACGG + Intronic
960973004 3:123152379-123152401 ACAGAAATGAAGAAACTCTAAGG - Intronic
961238609 3:125390327-125390349 ACTCAAAAAAAGAAAGTTAAGGG - Intergenic
961429285 3:126869559-126869581 TCTCAAAAGAAGAAATACAAAGG - Intronic
961449635 3:126996695-126996717 ACACACAAGATGAAACTCAATGG - Intronic
961580564 3:127877684-127877706 AGTTGAAAGAAGAAAATAAAGGG - Intergenic
961658252 3:128454886-128454908 ACTTACAAGAGGAAACAGAAGGG + Intergenic
962122760 3:132580319-132580341 AGTTAAAAGGATAAACTCCATGG + Intronic
962787032 3:138778154-138778176 ATTTAAAAGGAGAAACCGAAAGG + Intronic
963224643 3:142849616-142849638 ACTTGAATGAAGAAATTAAAAGG - Intronic
963523371 3:146384481-146384503 ACTTTAATGAAGAAACTGATGGG + Intergenic
964314894 3:155433470-155433492 ACCGTTAAGAAGAAACTCAAAGG + Intronic
964355012 3:155842516-155842538 TAGTAAAAGAAGAAACACAAGGG - Exonic
964544241 3:157815948-157815970 ACATAAAAGAAGAACCTACAAGG - Intergenic
964546240 3:157837037-157837059 ACCTCAAAGGTGAAACTCAATGG + Intergenic
965094433 3:164206525-164206547 ATTTAGAAGAAGAAACACAGAGG - Intergenic
965416594 3:168402492-168402514 CACTAACAGAAGAAACTCAAAGG - Intergenic
965970863 3:174554986-174555008 CCTTGTAAAAAGAAACTCAAAGG - Intronic
965984254 3:174732870-174732892 ATATAAAAGAAAAAACCCAATGG - Intronic
966167737 3:177039999-177040021 AATTTAAAGAAAAAACTTAAAGG + Intronic
966723008 3:183083207-183083229 ACTTTAAAGAAGAAACTTATTGG - Intronic
966987099 3:185190958-185190980 ACTTAAAATATACAACTCAATGG + Exonic
967281140 3:187824869-187824891 ACTTAAAAAAAGAAAAGAAAAGG + Intergenic
967338319 3:188369237-188369259 GCCTAAAACAAGAAACTCAGAGG - Intronic
969905302 4:10388201-10388223 AGTTAAAAAAACAAAATCAAAGG - Intergenic
970293268 4:14600235-14600257 ATTTCAAAGGAGAAACTTAAAGG + Intergenic
971601736 4:28600541-28600563 ATTTGAAAGAAGAAAGTCAGGGG - Intergenic
971778325 4:30996793-30996815 GTGTAAAAGAAAAAACTCAATGG - Intronic
972007712 4:34132165-34132187 AATTAAACGCAGAAACCCAAGGG + Intergenic
974634924 4:64550459-64550481 ACTATAAAGCAGAAAATCAAAGG - Intergenic
974726814 4:65809407-65809429 ATGTAGAAGAAGAAACCCAAAGG + Intergenic
974918462 4:68206198-68206220 TCTTAAAAAATGAAACTAAATGG + Intergenic
975850200 4:78564361-78564383 ACTTGAAGGAAGCAACTCATCGG + Intronic
975949433 4:79750478-79750500 ACTAAAAATAAGTAACACAAAGG + Intergenic
976103919 4:81596027-81596049 AGATAACAAAAGAAACTCAAGGG + Intronic
976854975 4:89592937-89592959 AGGTAAAAGAAGAAACCCCAAGG - Intergenic
977095831 4:92742830-92742852 AATAAAAAGAAGAAAATAAAAGG + Intronic
977130867 4:93235141-93235163 AATTAAAAGAAGAGAATCAGAGG - Intronic
977602155 4:98944908-98944930 TCTTAAAAAAAAAAAATCAAAGG - Intergenic
978037531 4:104014129-104014151 ACTAAAAATAAAAATCTCAAAGG + Intergenic
978182428 4:105814955-105814977 ACTTAAAAGTTAACACTCAAAGG - Intronic
978396107 4:108281718-108281740 ATTTAAAAGCAGGAACTCCAAGG - Intergenic
979385987 4:120066448-120066470 ACTTAAAGGAAGAAACGCTCCGG + Intronic
979963067 4:127044590-127044612 ACTTATAAGAAGAAAAACTAAGG - Intergenic
980296165 4:130920853-130920875 ACTAAAAATAAGAAACAGAATGG + Intergenic
980497406 4:133604421-133604443 ACTTAAAAGTAGGAGCCCAAAGG + Intergenic
980827712 4:138092160-138092182 AATTAAAAAAAAAAACTGAAAGG + Intergenic
981469788 4:145118975-145118997 ACATAAAAACATAAACTCAAAGG - Intronic
981649050 4:147035419-147035441 CTTTAGAAGTAGAAACTCAAGGG - Intergenic
981971212 4:150664327-150664349 ATTGAAAAGAGAAAACTCAAGGG - Intronic
982067954 4:151671324-151671346 ACTTAAGAGGAGAAAATGAAGGG + Intronic
982573762 4:157082039-157082061 ACTAAAAAGAAGAAAAACATTGG - Intronic
983206335 4:164914140-164914162 ACTTAAAAAAAAAGACTGAAAGG + Intergenic
983248246 4:165313613-165313635 ACTAAAAACAAAAAACTAAAAGG - Intronic
983295015 4:165856348-165856370 ATTTAAAAAAAAAAACTCCATGG + Intergenic
983742156 4:171149340-171149362 ATTTGAAAGAAGAAACTTAGTGG + Intergenic
984113736 4:175651651-175651673 AATTTAAAGTAGAAAGTCAAGGG - Intronic
984350710 4:178588501-178588523 AATTAAAATAAAAAATTCAATGG + Intergenic
984514220 4:180718684-180718706 ACTTGGAAGAGGAAACTCAGTGG + Intergenic
984519580 4:180785783-180785805 ACTTAAAAGCAGAAAATGAGGGG - Intergenic
984582761 4:181529438-181529460 ACTTCAAACAGAAAACTCAAGGG + Intergenic
984640040 4:182154151-182154173 CCTTAAAAGAAAGATCTCAAAGG + Intronic
984977995 4:185247222-185247244 ACATAAAAAAAAAAAATCAAAGG - Intronic
985198716 4:187461924-187461946 ACTTCAAAGAAGAATATAAATGG + Intergenic
985910687 5:2878207-2878229 ACCTGAAAGAAGAAAAACAAAGG + Intergenic
986055280 5:4130475-4130497 CCCTAAAAGAGAAAACTCAATGG + Intergenic
986187795 5:5461115-5461137 AGGAAAAAGAAGATACTCAAGGG + Exonic
987185916 5:15419025-15419047 ACTTGTAAGAAGAAAATGAAAGG - Intergenic
987280370 5:16407647-16407669 ACTTAAAATAAGAGACTTCAAGG + Intergenic
988088183 5:26498810-26498832 CCTTATAAGAAGAGACACAAAGG + Intergenic
988221497 5:28352282-28352304 TCTTAAAAGAAGACATACAAAGG + Intergenic
989425603 5:41292067-41292089 AAATAAAAGTAAAAACTCAAGGG - Intergenic
989548742 5:42706824-42706846 ACTAAAAAGAATAAACCCAGGGG - Intronic
989725819 5:44585247-44585269 ATTTAAAAGCAAAGACTCAAGGG + Intergenic
989974040 5:50561027-50561049 ACTTAAAAAAATAAAATAAAAGG + Intergenic
990084635 5:51959325-51959347 ACAGAGAAGAAGTAACTCAATGG + Intergenic
991037019 5:62137588-62137610 CCTTAAAAAAAAAAAATCAATGG + Intergenic
991422482 5:66455330-66455352 ACTTAAAAGAAGAAAAAGAGAGG - Intergenic
991768440 5:70015359-70015381 ACTTAAAAAAAAAAACCCACTGG + Intergenic
991847678 5:70890441-70890463 ACTTAAAAAAAAAAACCCACTGG + Intergenic
992248236 5:74850711-74850733 TCTAAAAAGAAAAAACTCAGAGG + Intronic
992500803 5:77340975-77340997 ACTAGAAAAAAGAAACACAAGGG - Intronic
992924296 5:81565983-81566005 ACTTAGTAGAAAGAACTCAAAGG + Intronic
993582800 5:89683887-89683909 TCTCAAAAGAAGACACACAAAGG + Intergenic
993602071 5:89938852-89938874 AATTAAAAAAAGACACACAAAGG + Intergenic
993714970 5:91267311-91267333 AATAAAGAGAAGAAATTCAAAGG + Intergenic
994634584 5:102328641-102328663 ACTTAGAAGATAAAACTGAATGG + Intergenic
994817573 5:104603828-104603850 TCTCAAAAGAAGAAAAACAATGG + Intergenic
994977239 5:106825196-106825218 AGGTACAAGAAGCAACTCAAGGG - Intergenic
995284586 5:110372538-110372560 ACTTAAAAAAGGACACTTAAGGG + Intronic
995353317 5:111207883-111207905 ACTTAGAATATAAAACTCAAGGG - Intergenic
995772153 5:115682897-115682919 ACTTAAAAGAAAACAGTTAAGGG - Intergenic
996044745 5:118858909-118858931 ACTTAAAAGAAGGAATTGGATGG - Intronic
996462044 5:123756487-123756509 AATCAAAAGAACAAACACAAAGG + Intergenic
998265312 5:140663725-140663747 ATTTAAAAAAAGAAATTCAGGGG + Intergenic
998544158 5:143011763-143011785 ACTTAAAAGAGGAAACACAGTGG - Intronic
998721000 5:144948881-144948903 ACTGAAAAGAAAAAAGCCAAAGG - Intergenic
998888897 5:146725191-146725213 ACTCAAAAGAAGAATCACCATGG - Intronic
999355214 5:150922234-150922256 ACATAAAAGAATAAATTCATTGG + Intergenic
999613550 5:153397372-153397394 ACTTAAAAAAAGAAAGAGAAGGG - Intergenic
1000000323 5:157132128-157132150 ACTAAAATGAAGAAACTCAGAGG - Intronic
1000709950 5:164561033-164561055 ACTTAAAAGAAACAGCCCAAGGG + Intergenic
1000841771 5:166228738-166228760 ACCCAAAAGAAGAGACTTAAAGG - Intergenic
1000876677 5:166647848-166647870 ATTTAAGAGAAGAAATTCATTGG - Intergenic
1000889963 5:166790460-166790482 AATTAAAAAAAGAAATTAAATGG - Intergenic
1000943829 5:167396123-167396145 AATTAAAATCAGAATCTCAAAGG + Intronic
1000944570 5:167404813-167404835 ACTTAAAATACAAAATTCAATGG + Intronic
1002376877 5:178795276-178795298 CCTTAATAAAAGAAACTGAACGG - Intergenic
1002737179 5:181403329-181403351 ACTGAAAATAAGAAACAGAATGG + Intergenic
1002747520 6:71450-71472 ACTGAAAATAAGAAACAGAATGG - Intergenic
1004591576 6:17056748-17056770 ACTTAGAAGAAGAAAAGCATCGG - Intergenic
1004802396 6:19164101-19164123 AATTTAAAAAAGAAAATCAATGG - Intergenic
1006264427 6:32906514-32906536 ACATAAAAGAAGATCATCAATGG + Intergenic
1006830624 6:36965769-36965791 ATTTAAAATATGCAACTCAACGG + Intergenic
1008110909 6:47493501-47493523 ATTTAATGGAAGAAAATCAAAGG - Intronic
1008865846 6:56208639-56208661 AATTCAGTGAAGAAACTCAATGG - Intronic
1009295108 6:61937199-61937221 AATTGAAATAAAAAACTCAATGG - Intronic
1009597303 6:65752202-65752224 ACTTCTATGAAGAAAGTCAATGG - Intergenic
1009847058 6:69146971-69146993 ACTGATAAGCAGAAATTCAAAGG - Intronic
1010063407 6:71651316-71651338 ACTTAAAGTAAAAAACTGAAAGG - Intergenic
1010320877 6:74508418-74508440 ATTTAAAAAAAGAAACAAAAGGG + Intergenic
1010371995 6:75121231-75121253 ACTTAAAAAGAGAAGTTCAAAGG + Intronic
1010465126 6:76158626-76158648 AATTATATGAAGAAAGTCAATGG + Intergenic
1010536845 6:77041150-77041172 TCTTCAAAGAATAAATTCAATGG - Intergenic
1010595802 6:77762488-77762510 ATATAATAGAAGAAACTAAAAGG + Intronic
1011490096 6:87882833-87882855 AATTTATAGAAGAAACTCAGAGG - Intergenic
1011936407 6:92784091-92784113 ACTAAAAAGAATAAAGTTAATGG - Intergenic
1011947157 6:92920306-92920328 ACTTAAATGAAGAAAATTCAAGG - Intergenic
1012610436 6:101212035-101212057 ACTTGATAGAAGAAATGCAACGG + Intergenic
1013373566 6:109491796-109491818 ACTCAGAGGAAGAAACTCTATGG + Intergenic
1013420230 6:109960526-109960548 CCTTAACAGAAGATCCTCAAGGG + Intergenic
1013508326 6:110820929-110820951 AAATAAAATAAGAAACTAAATGG + Intronic
1013540002 6:111098719-111098741 ACTTCAAAGCAGCATCTCAAAGG + Intronic
1013867311 6:114713979-114714001 AATTAACAGAATAAACTCATAGG + Intergenic
1014020546 6:116583317-116583339 GCATTAAAGAAGAAACTTAAAGG - Intronic
1014563651 6:122921353-122921375 AATTAAAAGAATAATTTCAAAGG - Intergenic
1015344642 6:132141543-132141565 ACTTAAAAGTAGAGCCTTAAAGG + Intergenic
1016684217 6:146863291-146863313 TCTTTAAAAAAGAAACTCACAGG - Intergenic
1017309975 6:152964670-152964692 ACATCAAAGAAGAAATCCAAAGG + Intergenic
1017409771 6:154155970-154155992 AATTAAGAGAAGAAGGTCAAAGG + Intronic
1017424677 6:154307968-154307990 ACTGAAAAGAAGAAAGGTAAGGG + Intronic
1017504609 6:155056470-155056492 ACTCAAAAGAAGAACCATAAGGG - Intronic
1017608402 6:156157840-156157862 ACTTTAAAAAAGATACTCCAGGG + Intergenic
1018579121 6:165292502-165292524 ACAAAAAAGCAGAAACTTAAGGG - Intronic
1019242275 6:170678895-170678917 ACTGAAAATAAGAAACAGAATGG + Intergenic
1019610182 7:1932604-1932626 ACTTCAGAGAAGAAACACAGAGG - Intronic
1020514156 7:9095099-9095121 ACATAAAAGAAGAAACTTTCTGG - Intergenic
1020964757 7:14851233-14851255 ATCTAAAAGAAAAAATTCAAGGG + Intronic
1021207337 7:17799077-17799099 ACTTAAAAGAAAGAAATCAGTGG - Exonic
1021940066 7:25670219-25670241 ATAAAAAAGAACAAACTCAAGGG - Intergenic
1022125753 7:27355266-27355288 GATTAAAAGAAGAAACCCAGAGG + Intergenic
1022844659 7:34197769-34197791 ACTTAAAAAAAGAAGATAAAAGG + Intergenic
1022890050 7:34687934-34687956 ATTTAAAAGCAGAAACTGGAAGG + Intronic
1023167831 7:37360506-37360528 ACTTAAAAGACAAAACTCTAGGG + Intronic
1024451345 7:49547384-49547406 ACATAGAAGATGGAACTCAATGG + Intergenic
1024714554 7:52061209-52061231 ACTTAAAAAAAGTATCTCTAAGG + Intergenic
1024951325 7:54863638-54863660 ATTTGAAAGAACAAACACAAAGG - Intergenic
1025161564 7:56665727-56665749 ACTTAAAAAAAAAAAATCACAGG + Intergenic
1025839436 7:65131053-65131075 AATTAAAAAAAGGAAATCAAGGG - Intergenic
1025883632 7:65564912-65564934 AATTAAAAAAAGGAAATCAAGGG + Intergenic
1025889814 7:65637694-65637716 AATTAAAAAAAGGAAATCAAGGG - Intergenic
1025958068 7:66197841-66197863 ACTTAAAAAAAAAAAAACAAAGG - Intergenic
1026538753 7:71262083-71262105 ATTTAAAAGAAGAAACCAACAGG - Intronic
1027480634 7:78692278-78692300 TCATAAAAGAAGAGACTGAATGG + Intronic
1029107148 7:98187304-98187326 AAGTGAAAGAAGAAACTGAAAGG + Intronic
1030337689 7:108343574-108343596 ACTCAAAAGAAGAAATAGAATGG + Intronic
1030431976 7:109461323-109461345 ACTTAAAAGAACAAAATTACTGG - Intergenic
1030847990 7:114446277-114446299 AATTATAAGAAGTAACTCAGAGG - Intronic
1030968236 7:116020763-116020785 ACTTAAAAAAAAAAATCCAATGG - Intronic
1031505985 7:122583441-122583463 CCTTTTAAGAAGAAATTCAAGGG - Intronic
1031678142 7:124636287-124636309 CCTTAAAAGAAGAAATTATATGG - Intergenic
1031958626 7:127968475-127968497 CCTTACAAAAAGAAACTCAATGG - Intronic
1032417787 7:131750734-131750756 ATTTAAAAAAAAAAACTTAATGG - Intergenic
1032746770 7:134793982-134794004 ACCCAAAAGAAGGAAATCAAGGG - Intronic
1032849295 7:135779864-135779886 AATTTAAAAAAGAAAGTCAAGGG + Intergenic
1033649495 7:143330114-143330136 ACTTAAAAGGACCAACGCAAGGG - Intronic
1033729704 7:144164945-144164967 AATTAAAACAAGAAAAACAAAGG - Intergenic
1033871199 7:145755420-145755442 AGTTAAAAAAAGAACTTCAATGG - Intergenic
1034542335 7:151766468-151766490 ACTAAAAAGGAGAAAACCAAAGG + Intronic
1035130938 7:156652472-156652494 ACAGAAAATAAGAAAATCAAGGG - Intronic
1035495861 7:159325494-159325516 ACTTAAAAATATAAACACAAAGG + Intergenic
1035505843 8:129255-129277 ACTGAAAATAAGAAACAGAATGG - Intergenic
1035894226 8:3379363-3379385 AATTCAATGAAGAAAGTCAATGG - Intronic
1036653417 8:10660509-10660531 ACTTAAAAGAATACAATAAAAGG - Intronic
1037429135 8:18791193-18791215 AATTAAATGAAGAAGGTCAATGG - Intronic
1037586884 8:20283120-20283142 ACTGAAAAGAAGACACTTCATGG + Intronic
1037907143 8:22722179-22722201 ACTTAAAAAAAAAAAATCTATGG + Intronic
1038170065 8:25123213-25123235 ACTTATAAGAAGCAACTCTCTGG + Intergenic
1038923314 8:32110316-32110338 AGCTAAGAGAAGAAAGTCAAAGG + Intronic
1039148026 8:34471759-34471781 ACTTGAAAGAGTAGACTCAAAGG + Intergenic
1039367274 8:36943184-36943206 AATAAAAAGAACAAAGTCAAAGG + Intergenic
1040296517 8:46151810-46151832 ACTAACAGGAAGACACTCAAGGG - Intergenic
1040452323 8:47560486-47560508 ACTTATAAGCAGAAACTGGAAGG - Intronic
1041330156 8:56715574-56715596 ACGTAAATGAAGCAACTGAAAGG - Intergenic
1042411730 8:68474051-68474073 ACTTGAAAGAACAAAGGCAAAGG - Intronic
1042754550 8:72196356-72196378 ACCTAAAAGAAGAAAGTTAAAGG + Intergenic
1042766707 8:72330251-72330273 ACCAAAAAGAAGAAAGTTAAAGG + Intergenic
1043111203 8:76184695-76184717 AATTAAAATGAAAAACTCAAAGG - Intergenic
1043350073 8:79349730-79349752 ACTTAAAAAAACAAACTCGTTGG + Intergenic
1043869366 8:85414539-85414561 TTTCAAAAGAAGAAATTCAAGGG - Intronic
1044057710 8:87592720-87592742 TCTCAAAAGAGGAAATTCAAAGG - Intronic
1044269182 8:90220945-90220967 TCTTAAAGGAACAAACTCATTGG + Intergenic
1044721324 8:95151356-95151378 ACTTTAAAAAAAAAACTGAAAGG - Intronic
1046223437 8:111245275-111245297 AATTAAAAAAAGAAAATAAAAGG + Intergenic
1046547615 8:115670799-115670821 GCTTAAAAAAAGAAAATAAAAGG - Intronic
1046877375 8:119270451-119270473 GCTTAAAATAAGAAACTAATTGG - Intergenic
1047096128 8:121627924-121627946 AATTAAAACTAGAAACTCACAGG + Intronic
1047102842 8:121697325-121697347 ACTTAAAAAAATAAACTAAAAGG - Intergenic
1047379241 8:124342349-124342371 ACTCTAAGGAAGAAACTCATTGG + Intronic
1047556465 8:125936902-125936924 ACTTCTAAGAAAAAAATCAATGG + Intergenic
1048170878 8:132105012-132105034 ACTTAAATGCAAAAAGTCAAGGG + Intronic
1048622164 8:136145800-136145822 TCCTAATAGAAGAAACTTAAAGG - Intergenic
1049874935 8:145011052-145011074 ACTTAAAAGAGAAAACTCAGAGG + Intergenic
1050038956 9:1467332-1467354 ACATAAAAGAAGAATTTCACAGG + Intergenic
1050060473 9:1704301-1704323 ATATAAAAGAAGAAAATCATTGG - Intergenic
1050105404 9:2160845-2160867 ACTCAAAAGAAGAAAAATAAAGG - Intronic
1050401872 9:5264747-5264769 ACATAAAAGTAAAAACTCATAGG - Intergenic
1050467592 9:5946113-5946135 ACCTAATAGAAGAAATTTAAGGG - Intronic
1050922148 9:11217061-11217083 TCTCAAAAGAAGACATTCAAAGG - Intergenic
1051101457 9:13527049-13527071 ACTTAAAAAAAGAAAAAAAAAGG - Intergenic
1051383536 9:16482730-16482752 ATTTAAATGAATAAACTCAGAGG + Intronic
1051587430 9:18741539-18741561 ACTCAAAAGAACTAACTCAAGGG + Intronic
1051592445 9:18790226-18790248 AATTTATAGAAGAAACTTAAAGG + Intronic
1051881350 9:21842949-21842971 ACTTAAGAAAAGATACGCAATGG + Intronic
1051967523 9:22846544-22846566 AATTAAAACAAGTAATTCAATGG + Intergenic
1052044960 9:23783353-23783375 ACTTAAATGGAGTAACTCCAAGG + Intronic
1052100889 9:24445193-24445215 AATTAAAAAAAAAAAGTCAAAGG - Intergenic
1052614212 9:30817288-30817310 ACTGAAAAGAGGAAATACAATGG + Intergenic
1053455710 9:38231808-38231830 AATTCAAAGAAGACACTCGAAGG - Intergenic
1053525104 9:38821588-38821610 AATTAATAGAAGAAACTAAGAGG - Intergenic
1053728811 9:41031441-41031463 ACTAATAAGAAGAAAATGAATGG - Intergenic
1054197335 9:62046010-62046032 AATTAATAGAAGAAACTAAGAGG - Intergenic
1054641075 9:67542672-67542694 AATTAATAGAAGAAACTAAGAGG + Intergenic
1054699697 9:68400642-68400664 ACTAATAAGAAGAAAATGAATGG + Intronic
1054706264 9:68465376-68465398 TCTAAAAAGAAGAAACAAAATGG - Intronic
1054842699 9:69760230-69760252 ACTTAAAATAAGAAAATCGGAGG - Intergenic
1055179870 9:73372640-73372662 ACTTAAAAAAATAAACTGAAAGG - Intergenic
1055696091 9:78885985-78886007 ACTTACAAGAAGAAACTCAATGG - Intergenic
1055989213 9:82087358-82087380 ATTTAAAAGAAAGAGCTCAAAGG - Intergenic
1056056503 9:82829277-82829299 ACTCAAAATAAGATACTAAAAGG + Intergenic
1057269271 9:93639219-93639241 ACTTAAAAGATCAAAATAAATGG - Intronic
1058126315 9:101199279-101199301 ACTTAAAAACACAATCTCAATGG + Intronic
1058490894 9:105497798-105497820 ACTGAAAAGAGGGAAATCAATGG - Intronic
1059009127 9:110437613-110437635 AGTTAAAGGAAGAAAGTCACAGG - Intronic
1059113727 9:111581631-111581653 AATTAAAAAAAAAAATTCAAAGG - Intronic
1059118894 9:111623808-111623830 CCTTATATGAAGAAATTCAATGG + Intergenic
1059239756 9:112794058-112794080 ACTTTGGAGAATAAACTCAAAGG - Intronic
1059475495 9:114543484-114543506 ACTTAAAAAAAGAAGATAAAGGG - Intergenic
1060288503 9:122277154-122277176 AATTAAAAGAAGAAACTGGCTGG - Intronic
1060330552 9:122665223-122665245 TCTTAAAAGCAGAAACCCAGAGG + Intergenic
1062310806 9:135935674-135935696 ATGTAAAAGAAGAAATGCAATGG + Intronic
1203602466 Un_KI270748v1:28117-28139 ACTGAAAATAAGAAACAGAATGG + Intergenic
1187284236 X:17887637-17887659 AATCAAAATAATAAACTCAATGG + Intergenic
1187581071 X:20608093-20608115 AATCAAAAGAAGCATCTCAAGGG - Intergenic
1187582209 X:20620209-20620231 ATGTAAAAGAAGGAATTCAAAGG + Intergenic
1187632088 X:21184381-21184403 TCTTAAAAGAAGACACACAATGG - Intergenic
1188311448 X:28621563-28621585 ACTTAAAAGTACAAATTCTATGG + Intronic
1188627771 X:32307619-32307641 ACTTAAAAGACTTAACTGAAAGG - Intronic
1188943201 X:36264846-36264868 AGCAAAAAGAAGAAAGTCAAAGG - Intronic
1189634068 X:42986249-42986271 ACTTATAAGTAGAAGCTAAAGGG + Intergenic
1190104031 X:47545754-47545776 TATAAAAAGAAGAAACACAATGG + Intergenic
1190577286 X:51853130-51853152 ACTCAAAATTAAAAACTCAAGGG - Intronic
1190585669 X:51938378-51938400 TCTCAAAAGAAGACATTCAATGG + Intergenic
1191152637 X:57236633-57236655 TCTTAAAAGAAGACATACAAAGG - Intergenic
1191652772 X:63559406-63559428 ACTTTAAAAAAGAAAGTAAATGG + Intergenic
1192162206 X:68796847-68796869 AATTAAAAGTAGAGACTCAAGGG - Intergenic
1193835242 X:86335278-86335300 AATTCTATGAAGAAACTCAATGG + Intronic
1193982068 X:88193889-88193911 TCTTAAAAGAAGACATACAAAGG + Intergenic
1194369824 X:93058922-93058944 ACTTAAAGGAAGAAATTCTCTGG - Intergenic
1194464359 X:94213903-94213925 AATTAAAAGAAGAAAAGGAAAGG + Intergenic
1194952364 X:100141660-100141682 ACTGAAATAAAGAAACTCACTGG + Intergenic
1195122169 X:101765817-101765839 ACTAAAAAGTAGAAAATAAATGG + Intergenic
1197059831 X:122164331-122164353 ACATACAAAAATAAACTCAAAGG + Intergenic
1197786940 X:130207814-130207836 ACTTACAAGAAGAGGCACAAGGG - Intronic
1198573002 X:137978107-137978129 TCTGAAATGAAGAAAATCAATGG + Intergenic
1200012637 X:153130898-153130920 GTTTAAAATAAGAAACTAAATGG - Intergenic
1200026963 X:153269019-153269041 GTTTAAAATAAGAAACTAAATGG + Intergenic
1200130862 X:153844691-153844713 AATTAAAGGAGGAAACTCACAGG + Intergenic
1200578547 Y:4920013-4920035 AATTAAAAAAAAAAACCCAAAGG + Intergenic
1200678012 Y:6175132-6175154 ACTTAAAGGAAGAAATTCTCTGG - Intergenic
1200751533 Y:6949252-6949274 ACTTCAAATAAGAAATTAAATGG + Intronic
1200819115 Y:7564006-7564028 ACTTCAAGGAGGAAACTGAATGG + Intergenic
1201398721 Y:13578829-13578851 AATAAAAAGAAAAGACTCAATGG + Intergenic
1202017763 Y:20429800-20429822 ATTTAAAAAAAGAAATTCAAAGG + Intergenic
1202346982 Y:23941492-23941514 ACTTAATAGTAGAAATTTAAGGG + Intergenic
1202523789 Y:25728598-25728620 ACTTAATAGTAGAAATTTAAGGG - Intergenic