ID: 1115131096

View in Genome Browser
Species Human (GRCh38)
Location 14:30053050-30053072
Sequence AGGTTATTTCATATGTAGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 179}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115131096 Original CRISPR AGGTTATTTCATATGTAGTA AGG Intronic
903935944 1:26894940-26894962 AGGTTTTGTCATCTGTAGAATGG - Intronic
904506766 1:30962895-30962917 AGTTTATTTAGTATGTAGTATGG + Intronic
905994287 1:42367489-42367511 AGTTTATTCCATAGGTCGTAAGG - Intergenic
908305566 1:62812064-62812086 AGGTCATTTCATAACTACTAAGG - Intronic
908358175 1:63342567-63342589 TATTTATGTCATATGTAGTAGGG - Intergenic
909690984 1:78407848-78407870 AGGTTTTCTCATCTGTAGCAGGG - Intronic
912123273 1:106501093-106501115 TGGTTATTTCTAATGGAGTAAGG + Intergenic
916338469 1:163700258-163700280 AAGTTATTTCATATAAAGTGAGG - Intergenic
916359835 1:163956165-163956187 ATGGTATTTCATATTTTGTATGG + Intergenic
916877405 1:168984297-168984319 AGGTTACTTCATCTGTCCTATGG - Intergenic
917056478 1:170987427-170987449 ACATTATTTCCTATGTTGTAAGG - Intronic
917841336 1:178981815-178981837 AGGTTATGTCATCTGCAATAAGG - Intergenic
918797415 1:188919534-188919556 AGGTGATTTCTTGTGTAGTTAGG + Intergenic
919105694 1:193147748-193147770 ACCTTATGACATATGTAGTAGGG + Intronic
919613499 1:199776484-199776506 AGGTTGCTTTATATGTAGCAGGG - Intergenic
1063050343 10:2440333-2440355 AGGTTATTTCATGGTTAATAAGG - Intergenic
1063351838 10:5363579-5363601 AGTTTATTCCATATGTAATGGGG - Intergenic
1065070442 10:22018742-22018764 GGGTTATTTCATATACTGTAAGG - Intergenic
1065225405 10:23538566-23538588 AGGTTATTGAAGAGGTAGTAAGG - Intergenic
1066069897 10:31797444-31797466 AGGTTATTTCACAGATATTAAGG - Intergenic
1068004093 10:51372195-51372217 TGGTTATTTCTAATGAAGTAAGG + Intronic
1068344684 10:55759372-55759394 AGGTTCTTGCATATTTTGTATGG - Intergenic
1068471371 10:57468545-57468567 TGATTATTTTATATGTAGCATGG + Intergenic
1070264246 10:74886939-74886961 AGGTTATGGCATATCTTGTAAGG + Intronic
1071131245 10:82396046-82396068 TGGTTATGTAATCTGTAGTATGG + Intronic
1071264052 10:83948294-83948316 AGGTTATTAACTATGAAGTAAGG - Intergenic
1073165429 10:101444922-101444944 TGGTTTTCTCATATATAGTAGGG + Intronic
1074170437 10:110928944-110928966 AAGTTTTTTCATATGCATTAAGG - Intronic
1077575725 11:3381970-3381992 AGGTGATTTTACATGTAGCAGGG - Intergenic
1083787387 11:64959284-64959306 AGGTAATTTCAAAGGTAGGAGGG - Exonic
1086698294 11:89869455-89869477 AGGTTTTTTCATATAAACTATGG - Exonic
1086707870 11:89975033-89975055 AGGTTTTTTCATATAAACTATGG + Exonic
1090585299 11:128205555-128205577 AAGTTATTTGATATGGATTATGG - Intergenic
1092829561 12:12430507-12430529 AGGTTTTTACTTATGGAGTAGGG + Intronic
1093118284 12:15237480-15237502 AGATTTTTTTAAATGTAGTATGG + Intronic
1093193034 12:16097044-16097066 ATGTTTCTTCACATGTAGTAAGG + Intergenic
1093881097 12:24405523-24405545 AGCTTATTTTATATGTAGGAAGG - Intergenic
1095480989 12:42635467-42635489 AGTTTATTTCATCTGTCTTATGG - Intergenic
1097394759 12:59060279-59060301 TGGTTATTTCTCCTGTAGTATGG + Intergenic
1097574045 12:61369083-61369105 AAGTTATTGCATATGTAGACAGG + Intergenic
1098644312 12:72879887-72879909 ATTTTATTTCATATGTGGAAAGG - Intergenic
1099679896 12:85813889-85813911 GAGTTATTTCATATGTTCTATGG - Intronic
1100240487 12:92706460-92706482 AGGTTATTGCATCTGTAGTGAGG - Exonic
1100326100 12:93541244-93541266 AGGTTTTTTCATGTGTAAAATGG + Intergenic
1100758494 12:97778665-97778687 AAGTAATTTCCTATGAAGTAGGG + Intergenic
1105263037 13:18793842-18793864 AGGTTTTTCCATATGTACTCTGG + Intergenic
1106179525 13:27358792-27358814 AGGTTATGTCATTGGAAGTAAGG - Intergenic
1106968787 13:35109168-35109190 TGTTTATTTCATATTTATTAGGG + Intronic
1107359065 13:39600551-39600573 AGGTTGTTTGAGGTGTAGTAGGG - Intronic
1108081701 13:46743988-46744010 ATGTTTTTTCATTAGTAGTATGG + Intronic
1108864295 13:54904216-54904238 AGGTTTTCTCATGTGTAGTTGGG - Intergenic
1109284193 13:60392977-60392999 AGGTGATTTCAAATATAATAGGG + Intergenic
1111291156 13:86171589-86171611 AGGTTATTTCATAAATAGACTGG + Intergenic
1112913353 13:104517182-104517204 AGGTTTTTTCATATGTATGTTGG + Intergenic
1113296364 13:108963569-108963591 AGATTATTTCAGAAGTAGTGTGG - Intronic
1115131096 14:30053050-30053072 AGGTTATTTCATATGTAGTAAGG + Intronic
1115246269 14:31299163-31299185 GGGTTATTTCAAAAGTAGTCTGG - Intronic
1115679813 14:35724871-35724893 AGATTATTTCTTATTTATTAAGG - Intronic
1115962511 14:38851555-38851577 AAGTTAATTAATATGTATTAAGG + Intergenic
1116615934 14:47138657-47138679 AGTTTATTTTATAAGTAATATGG - Intronic
1117741450 14:58823340-58823362 TGGCTTTTTCATGTGTAGTAGGG - Intergenic
1119227323 14:72954337-72954359 AGATTATGTCACATGTAGTCTGG - Intronic
1120132121 14:80819942-80819964 ATATAATTTCATATGTAGTTTGG - Intronic
1120922515 14:89767693-89767715 AGGTTATTTAATATGTAAAAAGG - Intergenic
1127743740 15:61941549-61941571 ATCATATTACATATGTAGTAAGG + Intronic
1127947524 15:63770244-63770266 AGGTTATTTGAAAAGTAGGAGGG - Intronic
1128360363 15:66957446-66957468 AGGCTATTTCACCTGGAGTAGGG + Intergenic
1135390222 16:22086616-22086638 TGGTTTTTTCATCTGTAGAATGG + Intronic
1137726469 16:50659965-50659987 AGGTCATATCACATGTAGCAAGG - Intergenic
1144153078 17:12469892-12469914 AGGTTATTTAACATGTAGTCTGG - Intergenic
1145407674 17:22620135-22620157 AGGTTCTTGCATATTTTGTATGG - Intergenic
1145808315 17:27750291-27750313 AGGTTTCTTCATCTGTAGAATGG + Intergenic
1146253207 17:31368916-31368938 AGTTTATTTCATATACAATATGG - Intronic
1154428008 18:14286943-14286965 AGGTTTTTCCATATGTACTCTGG - Intergenic
1156618656 18:38821354-38821376 AGATAATTTTATATGTTGTAAGG - Intergenic
1156807294 18:41200699-41200721 TGGTTATTCCATTTGCAGTAAGG + Intergenic
1158550986 18:58436178-58436200 AAGTTATTTCATAAGCAGGAAGG + Intergenic
1159518268 18:69486069-69486091 AGGATATTTCATAGGTAAAAAGG + Intronic
1160630592 18:80244634-80244656 CGGTTATTTCATCTGTAAAATGG - Intronic
1164221504 19:23198339-23198361 AGGATATTTTCTATGTAGTTGGG - Intergenic
1164238593 19:23362201-23362223 AGATTATTTTATGTGTAGTAAGG + Exonic
1164287463 19:23832095-23832117 AAATTATTTTATGTGTAGTAAGG - Intergenic
1164319299 19:24126756-24126778 GAATTATTTCATGTGTAGTAAGG - Exonic
1167880377 19:52452879-52452901 AGGTTAATTCATCTGAAGTTTGG + Intergenic
935596782 2:104884872-104884894 AGGTTATTTCATAAGGAATGTGG + Intergenic
936553105 2:113467760-113467782 AGGTTTTTACAGATGGAGTAGGG + Intronic
939022431 2:136974958-136974980 AGGTTTTTTCATATGTTTTTTGG + Intronic
939641702 2:144647591-144647613 AGGTCATTGCATATGTAATCAGG + Intergenic
942138968 2:172957749-172957771 AGGGTATTTCATCTGTTGAAAGG - Intronic
942492973 2:176508347-176508369 ATGTGATTTCATAGGCAGTAGGG - Intergenic
947473985 2:230425222-230425244 TGGGTATTTAATGTGTAGTATGG - Intronic
947851286 2:233290617-233290639 AGGTAATTTAAACTGTAGTAGGG + Intronic
948833126 2:240609943-240609965 AGGATATTTCATATGAAAAAAGG - Intronic
948996488 2:241582734-241582756 AGGATATTTCTTAGGCAGTAAGG + Intergenic
1176846756 21:13882484-13882506 AGGTTTTTCCATATGTACTCTGG + Intergenic
1177352878 21:19967670-19967692 AGGTCATTGCAGATGTAGTTAGG + Intergenic
1177918969 21:27126272-27126294 AGGTTATGCCATCTGTAGTAGGG + Intergenic
1178070257 21:28957533-28957555 AGGGTATTTAATATGTATTGGGG - Intronic
1179119307 21:38528221-38528243 GGGTTATTGCAGATGTAGTAGGG - Intronic
1181710992 22:24688534-24688556 AGGGCATTTCCTCTGTAGTATGG + Intergenic
949415696 3:3811543-3811565 AAGTTATTTCATCTGTATTTTGG + Intronic
949644973 3:6083099-6083121 AGGATAATTCAAATGTAGTCAGG + Intergenic
950542827 3:13622323-13622345 TGGTTTTCTCATCTGTAGTAAGG + Intronic
950593356 3:13955498-13955520 AGCTTATTTCATCTTTTGTATGG + Intronic
951266643 3:20575708-20575730 AGGATAGCTCATATGTAGTCAGG - Intergenic
952977197 3:38706636-38706658 AGGTGATATCATGTGTGGTATGG + Intronic
956089795 3:65653730-65653752 AGGTTATTTTAAATCTAGCAGGG + Intronic
956453975 3:69402424-69402446 ATATTATTTCATATGTCATAAGG - Intronic
957318286 3:78595738-78595760 TGATTATTTCATATATAGTCTGG - Intergenic
957800817 3:85077834-85077856 ATGATATTTCATATGTAATTTGG - Intronic
957962880 3:87281239-87281261 GGGTTATTTTATCTGTAATATGG + Intergenic
960648041 3:119911752-119911774 AGGTTATTTCATGAGGATTAAGG - Intronic
960809049 3:121611088-121611110 AGGTTAAATCATATGTTGAAGGG + Intronic
963821058 3:149894079-149894101 AGGCTATTTCATAGGTGCTATGG + Intronic
965397829 3:168181821-168181843 AGGATATTTCATGTGAAGAAGGG + Intergenic
965492810 3:169360719-169360741 TTGTTATTTCATATGGAATAAGG + Intronic
966324507 3:178739018-178739040 TGGTCAATTGATATGTAGTAAGG + Intronic
967350348 3:188507711-188507733 ATGTTCTTTCATATTTAGTGGGG + Intronic
967591325 3:191277420-191277442 AGATTACTTCAGATGTTGTATGG + Intronic
968218108 3:196911587-196911609 AGGTTTTTTCATATGTTTTTTGG - Intronic
970691657 4:18627786-18627808 AAATTATTTCATGTGTAGAATGG + Intergenic
972565752 4:40267624-40267646 AGGTCATTTGATAAGGAGTAGGG - Intergenic
972719906 4:41685643-41685665 AGGTGACTTCCTAGGTAGTAAGG + Intronic
974362209 4:60896307-60896329 AGGTTACTTCAAATGTTGTAAGG - Intergenic
976035764 4:80818431-80818453 AGATTATTTTATATGTACTTGGG + Intronic
976571906 4:86621950-86621972 AGGTCATTTAAAATGTATTAAGG - Intronic
979037065 4:115734436-115734458 ATGTGTTTTCATATATAGTAAGG + Intergenic
979594027 4:122513149-122513171 AGGTTCTTTCATATGATGAAAGG + Intergenic
981260829 4:142716725-142716747 AAGTTTTTTCATATGTAGGATGG + Intronic
981974334 4:150705828-150705850 AGGCTATGTCATACTTAGTAGGG + Intronic
982448651 4:155525294-155525316 AGTTGTTTTCATATGTAATAGGG - Intergenic
983490317 4:168381814-168381836 AGATTTTTTCTTTTGTAGTAAGG - Intronic
984069024 4:175088094-175088116 AGATTATGTAATATGAAGTAGGG + Intergenic
985012194 4:185594441-185594463 ATGTTAATTCAAATGTAGCATGG - Intronic
987741398 5:21913645-21913667 ACATTATTTCATATGTTGTGGGG + Intronic
987798286 5:22658665-22658687 TGGTTATTTCTTATGTAGGAGGG - Intronic
988383006 5:30523660-30523682 ATGTTATTTAATATGTTTTACGG - Intergenic
989024924 5:37056263-37056285 AGGTTATTCCATCTGTGCTATGG + Intronic
990790075 5:59467718-59467740 ATGTTATTTCATATGTACACAGG + Intronic
991469537 5:66953430-66953452 AGCTTATTTTGTATGTAGTTTGG + Intronic
993439578 5:87939230-87939252 TGGTTATCTCATATGTAAAATGG - Intergenic
995585469 5:113643741-113643763 AAATTATATCATATGAAGTAGGG - Intergenic
1000545448 5:162594779-162594801 AAATTATTTCATATGGAGGATGG + Intergenic
1003413040 6:5882605-5882627 AGGTGCTTTCATAGGTACTAGGG + Intergenic
1005603471 6:27451037-27451059 AGATTATTTCAAAGGTAGTTTGG - Exonic
1008065286 6:47041091-47041113 TGGTTATTTCATTTGTAAAATGG - Intronic
1010558537 6:77317173-77317195 AATATATTTTATATGTAGTAGGG - Intergenic
1013464632 6:110407058-110407080 AGGTTCTTTCTTAGGTATTAGGG - Intronic
1014429339 6:121348703-121348725 AGGTTATTTGCTATTAAGTAAGG + Intergenic
1016334080 6:142984926-142984948 AGTTTACTTCAAATGTAGTTGGG + Intergenic
1017332033 6:153210574-153210596 ATGTTTTTTCATCTGTAGAAAGG - Intergenic
1019847547 7:3521309-3521331 AGGTACTTTCAAATGTAGTAGGG - Intronic
1019854243 7:3588025-3588047 ATCTTATTTCAAATGTAGTAGGG + Intronic
1021139015 7:17000192-17000214 AGGTTTATTCATCTCTAGTAAGG - Intergenic
1022487977 7:30794950-30794972 AGGAAACTTCAGATGTAGTACGG + Intronic
1024109449 7:46130614-46130636 AGCTTATTTACTAAGTAGTATGG + Intergenic
1026271026 7:68836988-68837010 AGGTTGTTTCATCTGTAAAATGG - Intergenic
1029638203 7:101800036-101800058 ATGTTATTTCTTATGTTTTAAGG - Intergenic
1031412266 7:121454178-121454200 AGGTTATTTCATATTGATAAAGG - Intergenic
1031475336 7:122214256-122214278 TTGTTATTTCATATGAAGTATGG + Intergenic
1032272896 7:130427728-130427750 ATATTATTTCTTATGTGGTAAGG + Intronic
1032506729 7:132441022-132441044 TGGTTTTTTCATATGTAAAATGG - Intronic
1033289813 7:140074003-140074025 AGGTTATTTGAAATGTGGTAAGG + Intergenic
1034032550 7:147784186-147784208 AGGTCATTGCAAATGTAGTTAGG - Intronic
1038816184 8:30906813-30906835 TGGTTTTTTCATATGTAAAATGG - Intergenic
1041031469 8:53740097-53740119 AGTTTATATCATATGGAGTATGG - Intronic
1041886989 8:62821501-62821523 AGGTAATTTCATGTGTAATGAGG + Intronic
1042788601 8:72578323-72578345 AGTTCATTCCATCTGTAGTATGG - Intronic
1043357071 8:79426058-79426080 AGGTGGTTTCAAAGGTAGTATGG + Intergenic
1044063225 8:87665150-87665172 AGGTCATTACAAATGTAATAAGG + Intergenic
1044396200 8:91715954-91715976 AGGTTATGTCACATTTAGAAAGG + Intergenic
1046371277 8:113310222-113310244 ATAATATTTCATATGTATTAAGG + Intronic
1050452634 9:5799459-5799481 AAGTTATTTCAAATGGAGCACGG - Intronic
1053742944 9:41159719-41159741 AGGTTTTTACAGATGGAGTAGGG - Intronic
1054348221 9:63989543-63989565 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054445947 9:65315902-65315924 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054484323 9:65705608-65705630 AGGTTTTTACAGATGGAGTAGGG + Intronic
1054685399 9:68271581-68271603 AGGTTTTTACAGATGGAGTAGGG + Intronic
1054760023 9:68996155-68996177 AGGATATTTCATATGTTATCTGG - Intronic
1055891088 9:81124123-81124145 GGCTTATTTCATATGTTGTATGG - Intergenic
1055983634 9:82032614-82032636 AGGTTAATTGACATGAAGTATGG + Intergenic
1056017439 9:82405234-82405256 AGTTTATTAGATATGTAGGATGG + Intergenic
1057415075 9:94854773-94854795 AGGTGATTTCATGTTTATTATGG - Intronic
1058934631 9:109757409-109757431 TGGTTACTTCATAAGTGGTAAGG - Intronic
1059558468 9:115306929-115306951 AGGTTATTACATGTGTGATACGG - Intronic
1186923462 X:14306861-14306883 AGGTGATTTAATTTGTTGTAGGG + Intergenic
1187605008 X:20873565-20873587 ATGTTTTTTCATATTTAATAAGG - Intergenic
1189366422 X:40392495-40392517 AGCTTCTTTCATCTGTAGTGGGG - Intergenic
1189726807 X:43975606-43975628 CTGTTATTTCGTATGTATTAAGG + Intergenic
1195692705 X:107641088-107641110 AGTTTATTTCAGATGTACTTGGG - Intronic
1195799656 X:108693509-108693531 AGTTTATTTGATATGTAACAAGG + Intronic
1196112277 X:111959747-111959769 AGGGTATTTAATATGTAGCCAGG - Intronic
1196534165 X:116821775-116821797 AGGTATTTTGATATGCAGTATGG + Intergenic
1198745044 X:139881353-139881375 AGAATATTTCATAAGGAGTATGG + Intronic
1198933463 X:141883284-141883306 AGGTTATTTTAAATGTAATGTGG + Intronic
1198935467 X:141898956-141898978 AGGTTATTTCAATTGTAATGTGG + Intergenic
1199675714 X:150187572-150187594 AACTCTTTTCATATGTAGTAGGG - Intergenic