ID: 1115131532

View in Genome Browser
Species Human (GRCh38)
Location 14:30057762-30057784
Sequence CTGAGAAAACAGAAGAAAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1856
Summary {0: 1, 1: 0, 2: 5, 3: 155, 4: 1695}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115131528_1115131532 -9 Left 1115131528 14:30057748-30057770 CCTATTATGGAAGACTGAGAAAA 0: 1
1: 0
2: 4
3: 34
4: 301
Right 1115131532 14:30057762-30057784 CTGAGAAAACAGAAGAAAGGGGG 0: 1
1: 0
2: 5
3: 155
4: 1695

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115131532 Original CRISPR CTGAGAAAACAGAAGAAAGG GGG Intronic
900904329 1:5541522-5541544 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
901101284 1:6721025-6721047 CTGGGAAAACAGAACTAAGGTGG - Intergenic
901395921 1:8981449-8981471 CTGAGAAAGCAGGAGGAAGGAGG - Intergenic
901575608 1:10198424-10198446 CTCAGAAAAAAGAAAAAAGGAGG - Intergenic
901598208 1:10401629-10401651 CAGAGAAAACTGAAAAATGGTGG + Intronic
901600033 1:10416484-10416506 CACAGCAACCAGAAGAAAGGTGG - Intronic
902980037 1:20116013-20116035 ATGAGATAACAGAAAAAAAGAGG + Intronic
903331541 1:22599555-22599577 CTGTGACAACAAAAGAAAGAAGG + Intronic
903656009 1:24949236-24949258 CTGAAGAAACAGCAAAAAGGAGG + Intronic
903912996 1:26742226-26742248 CTGGGAAAACAGAAGTAAAATGG - Intronic
904007280 1:27370005-27370027 CTCAGAAAAAAAAAAAAAGGCGG - Intronic
904726158 1:32549914-32549936 CAGCCAAAACAGAAGAAAGATGG + Intronic
904998625 1:34650765-34650787 CTGAGGAAGCAGCAGGAAGGAGG + Intergenic
905053142 1:35070028-35070050 CTGAGCAAAAAGAACAAAGCTGG - Intronic
905054819 1:35084226-35084248 TTGAGAAAACAGAGGAAAGATGG - Intronic
905331740 1:37207634-37207656 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
905739527 1:40357867-40357889 CTGAGCAAAAAGAACAAAGCTGG - Intronic
905955189 1:41987467-41987489 TTGAGCAAACAGAACAAAGCTGG + Intronic
905962407 1:42054716-42054738 CTAAGAAAAAAGAACAAAGCTGG - Intergenic
906105682 1:43290737-43290759 CTGAGTGAACAGCAGGAAGGGGG + Intergenic
906222721 1:44094784-44094806 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
906227309 1:44132554-44132576 GTGAGAAAATGGAAGAAAGGCGG - Intronic
906393084 1:45436067-45436089 CTGAGCAAAAAGAACAAAGCTGG - Intronic
906435457 1:45792346-45792368 CTGAGCAAAAAGAACAAAGTGGG - Intronic
906736496 1:48134301-48134323 CTAAGCAAAAAGAAGAAAGCTGG - Intergenic
906754844 1:48301578-48301600 CTGAGCAAACAGAACGAAGTTGG + Intronic
906891151 1:49716393-49716415 CTAAGGAAAAAGAAGAAAGCTGG - Intronic
906997900 1:50817123-50817145 CTGAGCAAAAAGAACAAAGTTGG - Intronic
907236297 1:53051931-53051953 ATGAGTAAACAACAGAAAGGTGG - Intergenic
907241460 1:53083563-53083585 CAGAGAAAACGGAAGACTGGAGG - Intronic
907249262 1:53127273-53127295 GTGAGAAATCAGATGAAAGGGGG + Intronic
907583865 1:55597292-55597314 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
907590204 1:55659458-55659480 CAGAGAAAACAAAAAAAAGTAGG - Intergenic
907665540 1:56431184-56431206 AAGAGAAGAAAGAAGAAAGGAGG + Intergenic
908723612 1:67151903-67151925 CTAAGCAAAAAGAAGAAAGCTGG - Intronic
908812210 1:67994297-67994319 TTGAGAAAAAAGAACAAAGTGGG + Intergenic
908859760 1:68470881-68470903 CTGAGCAATCAGAAGACAGATGG + Intergenic
908861098 1:68490733-68490755 CTAAGAAAAAAGAACAAAGCTGG + Intronic
908933644 1:69346880-69346902 TTTTGAAAAGAGAAGAAAGGAGG + Intergenic
909047088 1:70723559-70723581 CTAAGCAAAAAGAAGAAAGTTGG - Intergenic
909228350 1:73054838-73054860 ATGAGAAAACAGAATTAAGCAGG - Intergenic
909244753 1:73266766-73266788 CTGAGCAAACAGAACAAAGCTGG + Intergenic
909302597 1:74032257-74032279 TTGGGAAAACAGAACAAAGTTGG + Intronic
909319386 1:74264064-74264086 ATGAGAAAATAGAAGAAGGAGGG + Intronic
909382574 1:75016582-75016604 CTAAGAAAAAAGAACAAAGCTGG + Intergenic
909418428 1:75434123-75434145 GTGAGAACACAGAGGAAAGGAGG - Intronic
909428562 1:75557400-75557422 GTGAATACACAGAAGAAAGGTGG + Intronic
909549605 1:76883004-76883026 CTGGGAAAACTTTAGAAAGGAGG - Intronic
909625918 1:77715904-77715926 CAAAAACAACAGAAGAAAGGAGG + Intronic
909632050 1:77777989-77778011 CTGCCAAACCAGAAGAAGGGAGG + Intergenic
909659064 1:78062372-78062394 CAGAGAACACAGAAGAAGGAAGG - Intronic
909903647 1:81170010-81170032 CTGAGAAAAAAGAACAAAATTGG - Intergenic
910108870 1:83660531-83660553 CTGAGGAAAGAAAGGAAAGGGGG + Intergenic
910185462 1:84534958-84534980 CTGAGAATGCAAGAGAAAGGAGG - Intergenic
910363372 1:86437512-86437534 GTAAGGAAAGAGAAGAAAGGAGG + Intronic
910475845 1:87605902-87605924 CTGAGCAAAAAGAACAAAGCAGG - Intergenic
910618467 1:89226641-89226663 CTAAGCAAAAAGAACAAAGGTGG - Intergenic
910695734 1:90013402-90013424 CTTAGAAAACATAAGAAAAAAGG + Intronic
910741428 1:90522871-90522893 CTGAGCAAAAAGAACAAAAGTGG + Intergenic
910827388 1:91423816-91423838 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
910851722 1:91655542-91655564 CTGAGCAACGAGAAGAGAGGAGG - Intergenic
910855519 1:91691210-91691232 GAGAGAAAACAGAAAAAAGGGGG + Intronic
910994897 1:93094187-93094209 ATGTGAAAACAGAAAAAAAGTGG - Intronic
911037850 1:93569259-93569281 ATGAGAAAACAGAAGAGATTAGG + Intronic
911320335 1:96406296-96406318 CTGAGCAAAAAGAACAAAGGTGG - Intergenic
911338829 1:96612996-96613018 CTGACAAAAAAGAAGAAATGGGG - Intergenic
911413906 1:97546611-97546633 CTGAGGAAAAACAAGAATGGTGG + Intronic
911429164 1:97761352-97761374 ATAAGAAAAGAAAAGAAAGGAGG + Intronic
911486260 1:98510087-98510109 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
911492128 1:98583185-98583207 CTAAGCAAAAAGAACAAAGGTGG - Intergenic
911506364 1:98757399-98757421 CTGAGGACACAGCAGGAAGGTGG - Intronic
911551709 1:99290492-99290514 CTAAGAAAAAAGAACAAAGCTGG + Intronic
911637536 1:100251532-100251554 CTAAAAAAAGAGAAGAAATGGGG - Intergenic
911684531 1:100759723-100759745 ATGAAAAAAAAGAAAAAAGGGGG + Intergenic
911837681 1:102642165-102642187 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
911842898 1:102707014-102707036 CTAAGCAAACAGAACAAAGCTGG - Intergenic
911892185 1:103385473-103385495 CTAAGAAAAAAGAGGAAAGCTGG - Intergenic
911912477 1:103653562-103653584 CTGAAAAGGCAGAAAAAAGGGGG - Intergenic
911915977 1:103698386-103698408 CTGAAAAGGCAGAAAAAAGGGGG + Intronic
911919889 1:103747700-103747722 CTGAAAAGGCAGAAAAAAGGGGG - Intronic
912423433 1:109564405-109564427 GTGAGAAAACAGAATGAATGGGG - Intronic
912440016 1:109690611-109690633 CTGGGAAAACATCTGAAAGGAGG - Intronic
912590182 1:110810274-110810296 CTGAGAAAAAAGAATAAAGTTGG + Intergenic
912636608 1:111300281-111300303 CTAAGGAAAAAGAAGAAAGCTGG + Intronic
912743149 1:112221099-112221121 CTGAGCAAAAAGAAGAAAGCTGG + Intergenic
912999192 1:114562629-114562651 CTGACAAAAAAAAAGAAATGGGG + Intergenic
913341804 1:117765413-117765435 CTAAGAAAAAAGAACAAAGCTGG - Intergenic
913363202 1:118005057-118005079 CAGAGCAAACACAAGACAGGAGG - Intronic
913424730 1:118714835-118714857 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
913428647 1:118763904-118763926 TTGAGAAAGCAGAACAATGGTGG + Intergenic
914453451 1:147813573-147813595 TTGAGAAAAATGAAGAAGGGAGG + Intergenic
914741846 1:150472172-150472194 CTGATAGCACAGAAGAAAAGGGG + Exonic
914963726 1:152232480-152232502 TTGAGCAAAAAGAAGAAAGCTGG - Intergenic
914967403 1:152272598-152272620 CTAAGCAAAAAGAAGAAAGCTGG + Intergenic
914968965 1:152289513-152289535 CTAAGCAAAAAGAAGAAAGCTGG - Intergenic
915181805 1:154068133-154068155 CTAAGCAAAAAGAAGAAAGCTGG + Intronic
915688468 1:157661903-157661925 CTGAGAAAAAAGAACAAATCTGG - Intergenic
915700004 1:157783072-157783094 GAGAGAAGAAAGAAGAAAGGAGG - Intergenic
915749967 1:158197610-158197632 CTGAGCAGACAGAACAAAGTTGG - Intergenic
915794363 1:158712287-158712309 TAGAGAAAACAGAAGAAATTTGG - Intergenic
915865182 1:159491860-159491882 CAGATAAACCAGAAGACAGGTGG - Intergenic
915967334 1:160322160-160322182 CTGAGCAAAAAGAACAAAGATGG + Intronic
916278068 1:163016388-163016410 TTGAGCAAAAAGAAGAAAGCTGG - Intergenic
916986184 1:170193477-170193499 CTGAGCAAAAAGAAGAAAGCTGG - Intergenic
917008554 1:170444641-170444663 CTGAGAAAACTAAAGAAATATGG - Intergenic
917355999 1:174126905-174126927 CTAAGCAAAAAGAACAAAGGTGG - Intergenic
917389977 1:174525084-174525106 CTGAGCAAAAAGAACAAAGCTGG - Intronic
917456272 1:175188730-175188752 CTGAGGAAACAGAAGAGACGAGG + Intronic
917659087 1:177160248-177160270 TGGAGAAAACAGAAGAATGGGGG - Intronic
917707427 1:177648530-177648552 CTGAGAATGGAGAAGAGAGGAGG - Intergenic
917770661 1:178274156-178274178 CTAAGAAAGCAGAAGAAGGCAGG - Intronic
917803253 1:178589943-178589965 CTGAGTAAAAAGAACAAAGCTGG - Intergenic
917830043 1:178873014-178873036 ATGAGGAAAAAGAAGAATGGTGG + Intronic
917991439 1:180383720-180383742 CTGAGCAAAAAGAACAAAGCTGG + Intronic
918503446 1:185224428-185224450 CTGAGCAAAAAGAACAAAGCTGG - Intronic
918651591 1:186970848-186970870 CTGAGCAAAAAGAACAAAGCTGG - Intronic
918664624 1:187134876-187134898 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
918673232 1:187247461-187247483 TTGAAAAAAAAGAAGAAAGCTGG + Intergenic
918936907 1:190932456-190932478 CTAAGCAAAAAGAAGAAAGCTGG + Intergenic
919034410 1:192288032-192288054 CTGAGTAAAAAGAACAAAGCTGG + Intergenic
919061586 1:192640902-192640924 TTGAAAACACAGAAGAAAGAAGG - Intronic
919170172 1:193943943-193943965 CTGAGAAAAAAGAACCAAAGTGG + Intergenic
919199124 1:194330103-194330125 TTGAGAAAACATAAGATATGAGG - Intergenic
919207884 1:194440548-194440570 CTAAGCAAACAGAACAAAGCTGG + Intergenic
919293931 1:195669866-195669888 CTTAGCAAAAAGAAGAAAGTTGG - Intergenic
919333050 1:196195429-196195451 GAAAGAAAACAGAAGAAAGAAGG + Intergenic
919348041 1:196411353-196411375 CTAAGAACAAAGAAGAAAGCAGG - Intronic
919444675 1:197688370-197688392 TTGAGAAAGAAGAACAAAGGTGG + Intronic
919531415 1:198725866-198725888 GGTAGAAAACAAAAGAAAGGAGG - Intronic
919611911 1:199755922-199755944 CATATAAAACAGAAAAAAGGGGG + Intergenic
919965537 1:202520091-202520113 CTGAGCAAGCTGAAGAATGGAGG + Intronic
920049528 1:203154926-203154948 CAGAGAAAAAAGAAGGAAGAGGG - Intronic
920606082 1:207387774-207387796 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
920828024 1:209440249-209440271 CAGAGAAAAGAAAAGACAGGAGG + Intergenic
920934743 1:210421184-210421206 CTGAGCAAAAAGAACAAAGCTGG + Intronic
920947335 1:210542028-210542050 AAGAGAAAGCAGAAGGAAGGAGG - Intronic
920994448 1:210975476-210975498 CTGACAAAAAAGAAGAAATGGGG + Intronic
920995196 1:210983535-210983557 CTGACAAAAAAGAAGAAATGGGG - Intronic
921039237 1:211414496-211414518 CTGAGCAAAAAGAAAAAAGAAGG + Intergenic
921097023 1:211895469-211895491 CTGTGAAAACAGCAGAGAAGAGG - Intergenic
921120878 1:212136170-212136192 CTGAGCAAAAAGAACAAAGTGGG + Intergenic
921364865 1:214364284-214364306 CAGATAAAACAGGAGAAATGAGG - Intronic
921457122 1:215385411-215385433 CTAAGAAAAAAGAACAAAGCTGG + Intergenic
921594613 1:217040698-217040720 ATGAGAAAACTGAATTAAGGAGG + Intronic
921640417 1:217546310-217546332 CTGAGCAAAAAGAACAAAGCTGG + Intronic
922353177 1:224751936-224751958 CTGATGAACCAGAAGAAAGATGG + Intergenic
922549927 1:226487129-226487151 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
922716437 1:227876514-227876536 CTAAGCAAAAAGAACAAAGGTGG + Intergenic
922771720 1:228188498-228188520 CTGAGAAAAAAGAACAAAACTGG - Intergenic
923228564 1:231962498-231962520 CTGAGCAAAAAGAACAAAGCTGG + Intronic
923644359 1:235801683-235801705 CTTAGCAAACATAAAAAAGGAGG + Intronic
923766597 1:236897953-236897975 CTGTAAAAACAGAAAAAAGCAGG - Exonic
923811189 1:237318634-237318656 CTGACAAAAGAGAAGACAGAAGG - Intronic
923960393 1:239075750-239075772 CTAAGAAAACTGAAGATAGAAGG + Intergenic
924326146 1:242895606-242895628 CTGAAAAGAGAGAGGAAAGGAGG - Intergenic
924398465 1:243650844-243650866 CTGAGCAAAAAGAACAAAGCTGG - Intronic
924444992 1:244120722-244120744 CTGAGAAAACAGAAGACAATTGG + Intergenic
924472370 1:244353801-244353823 CTGAGAAAACAGAAGCAACAGGG + Intronic
924772584 1:247089926-247089948 CTGAGAAGCCAAAATAAAGGGGG - Intergenic
924889622 1:248260350-248260372 CTAAGAAAAAAGAAAAAAGCTGG + Intergenic
924903226 1:248424462-248424484 CTGACAAAACAGATTATAGGTGG - Intergenic
1063099608 10:2938039-2938061 ATGTGAAAACAGAAGAAACCTGG - Intergenic
1063103477 10:2972192-2972214 CTGAGAAAGAAAAAAAAAGGTGG + Intergenic
1063201860 10:3791600-3791622 AAGAGAAAAGAAAAGAAAGGGGG + Intergenic
1063390906 10:5649353-5649375 CTGTGAGAACAGAAGACATGGGG + Intronic
1063986159 10:11505105-11505127 TAGAGATAACAGAAGAAAGGAGG + Intronic
1064321214 10:14306684-14306706 GTTACAAAAAAGAAGAAAGGTGG + Intronic
1064525593 10:16253301-16253323 CTAAGCAAAAAGAAGAAAGCTGG + Intergenic
1064898249 10:20263057-20263079 CTGAGCAAAAAGAACAAAGCTGG + Intronic
1065405674 10:25360701-25360723 CTGAGCAAAAAGAACAAAGCTGG - Intronic
1065482281 10:26207715-26207737 TTGAGCAAAAAGAAGAAAGCAGG - Intronic
1065590150 10:27255216-27255238 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1065708733 10:28495208-28495230 CTGGGAAGACAGAGGGAAGGAGG + Intergenic
1065994693 10:31046852-31046874 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1066037195 10:31504396-31504418 CTGAGCAAAAAGAACAAAGCTGG - Intronic
1066087713 10:31987212-31987234 CTAAGCAAAAAGAACAAAGGTGG + Intergenic
1066137037 10:32458689-32458711 CTAAGCAAAAAGAAGAAAGCTGG - Intronic
1066271905 10:33832327-33832349 TTGAGAAAACATCAGAAGGGAGG - Intergenic
1066292871 10:34029795-34029817 CAGAGAAAACAGAAAATAGCAGG + Intergenic
1066599525 10:37089723-37089745 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1067737746 10:48871469-48871491 CTCAGAAAAAAAAAAAAAGGGGG - Intronic
1067846252 10:49723981-49724003 CTGAGAAGCCAGCAGAAAGGGGG - Intergenic
1068068873 10:52170186-52170208 CTGAGGACAAAGAAGAAAGAAGG + Intronic
1068085685 10:52370671-52370693 CTAAGAAAAAAGAACAAAGCTGG - Intergenic
1068154635 10:53182557-53182579 TTGAGAAAGAAGAATAAAGGTGG + Intergenic
1068450643 10:57182576-57182598 TTGAGAAAAAAGAACAAAGCTGG + Intergenic
1068536918 10:58250126-58250148 CTGAGCAAAAAGAATAAAGCTGG - Intronic
1068807212 10:61211184-61211206 CTTAGAATACAGGAGAAAAGAGG - Intergenic
1068952047 10:62787337-62787359 CTAAGCAAAAAGAACAAAGGTGG + Intergenic
1069076956 10:64047850-64047872 CTGAGCAAAAAGAACAAAGTTGG + Intergenic
1069105226 10:64375702-64375724 ATTAGAAACCAGAGGAAAGGAGG - Intergenic
1069158536 10:65059306-65059328 CTGAGCAAAAAGAACAAAGTTGG - Intergenic
1069273060 10:66554820-66554842 CTGAAAAAAATGAAGAAAGGAGG - Intronic
1070060245 10:72975546-72975568 CTGAGCAAAAAGAAGAAAGCTGG - Intergenic
1070210410 10:74313309-74313331 CAAAAAAAACAGAAGAAAGATGG - Intronic
1070226374 10:74511303-74511325 CTGAGTAAAAAGAACAAAGCTGG - Intronic
1070439250 10:76426867-76426889 CTGACAAAAAACAAGAAATGGGG - Intronic
1070464476 10:76706301-76706323 CTGAGCCAACAGAACAAAGCTGG + Intergenic
1070529758 10:77326212-77326234 CAGAGAAAACAGATGAGATGAGG - Intronic
1071035242 10:81237128-81237150 GTAAGAAAACAGAAAAAAGCAGG - Intergenic
1071066316 10:81640387-81640409 CTAAGCAAAAAGAAGAAAGCTGG - Intergenic
1071195036 10:83148890-83148912 CTTAGCAAAAAGAAGAAAGCTGG + Intergenic
1071406532 10:85339448-85339470 CTGAGAAAACCAAAGACAAGAGG + Intergenic
1071407168 10:85348338-85348360 CTGAGAAAACAGATGCAAGAAGG + Intergenic
1071514534 10:86288521-86288543 CTCAGAAACCAGAAACAAGGTGG + Intronic
1071723679 10:88173425-88173447 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1071774699 10:88772695-88772717 CTGAGAAAAAAGAACAAAGCTGG - Intronic
1071799748 10:89045457-89045479 CTGAGCAAAAAGAACAAAGCCGG - Intergenic
1072045557 10:91651167-91651189 CTGAGAAAACTGACAAGAGGTGG - Intergenic
1072114278 10:92354781-92354803 CTGAGCAAGGAGAATAAAGGAGG + Intergenic
1072532696 10:96334464-96334486 CTGGGAAAACAGGAGAAACAGGG - Intronic
1072771882 10:98147850-98147872 CTGAGCAAAAAGAAGAAAACTGG - Intronic
1072794536 10:98344370-98344392 ATGAGAAATCCGAAGAAAGACGG + Intergenic
1072894327 10:99353245-99353267 CTGAGGAAACAGAAGTAAATAGG + Intronic
1073356695 10:102860693-102860715 CTGAGACTACAGAAGAAGTGGGG + Intronic
1073618385 10:105021722-105021744 ATGAGAAAACAGATGAAAGCTGG - Intronic
1074300213 10:112226551-112226573 ATGAGAAAAGACAAGAAAGTGGG + Intergenic
1074624982 10:115173061-115173083 CTGAGAAAACAGAAGTAATCAGG + Intronic
1074984731 10:118647756-118647778 CTAAGCAAAAAGAACAAAGGTGG - Intergenic
1075000844 10:118796096-118796118 CTAAGGAAAAAGAACAAAGGTGG + Intergenic
1075260463 10:120959016-120959038 CTGGGTGAACAGAAGACAGGTGG - Intergenic
1075297643 10:121292203-121292225 CAAAGAAAACAAAAAAAAGGGGG - Intergenic
1075449233 10:122537309-122537331 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1075936262 10:126344286-126344308 CTGACAAAAAACAAGAAATGGGG - Intronic
1076436542 10:130449219-130449241 TAGAGAAAACAGAAAAAAGTTGG - Intergenic
1076699264 10:132261993-132262015 CTAAGAAAAAAGAACAAAGCTGG + Intronic
1077890295 11:6413436-6413458 CTGAGAACACAGAGGGAAGGGGG - Intronic
1077984415 11:7336604-7336626 CTGAGAAAAAACAAGCAATGGGG - Intronic
1078151088 11:8760194-8760216 CTGAGAAGATAGAAGGAAAGGGG - Intronic
1078297110 11:10083433-10083455 CTGAGCAAAAAGAACAAAGTTGG + Intronic
1078575746 11:12500788-12500810 CTCAGAAAAAAGAAAAAAAGGGG + Intronic
1078932329 11:15921957-15921979 ATGAGGAAAGAAAAGAAAGGAGG - Intergenic
1079073169 11:17365946-17365968 CTCAGAAAACTGGAGAAAGAAGG - Intronic
1079529629 11:21434632-21434654 CTGAGCAAAAAGAACAAAGTTGG - Intronic
1079609927 11:22419683-22419705 TTGAGAAAAAAGGACAAAGGTGG + Intergenic
1079651070 11:22930799-22930821 CTGAGCAAAAAGAATAAAGCTGG - Intergenic
1079707039 11:23633920-23633942 CTAAGAAAAAAGAACAAAGCAGG + Intergenic
1079764286 11:24371304-24371326 CTAAGCAAAAAGAACAAAGGTGG - Intergenic
1079861383 11:25676480-25676502 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1079927622 11:26514470-26514492 ATGAGAAAACTGAAGATAAGAGG + Intronic
1080513262 11:32996458-32996480 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1081101679 11:39009688-39009710 TTGAGAAAATAGAAGAATGCAGG - Intergenic
1081214952 11:40384729-40384751 ATGAAAAAAGAAAAGAAAGGTGG - Intronic
1081232585 11:40604264-40604286 CTTAGAGAAGAGAAGATAGGAGG - Intronic
1081300169 11:41441500-41441522 CTGAGAAAACATATGAGATGTGG - Intronic
1081367842 11:42258311-42258333 CTGTGAAAATTGAATAAAGGAGG + Intergenic
1081467849 11:43340482-43340504 CTGAGCAAAAAGAACAAAGCTGG + Intronic
1081570245 11:44286273-44286295 CTGAGCAAACAGAAGGCAAGAGG - Intronic
1081920839 11:46774716-46774738 CTGACAAAAAACAAGAAATGGGG + Intronic
1081998548 11:47379268-47379290 ATGGGAAAACAGATGAATGGTGG - Intergenic
1082111815 11:48285159-48285181 CTAAGAAAAAAGAACAAAGCTGG - Intergenic
1082292131 11:50388726-50388748 CTGACAAAAAACAAGAAATGGGG + Intergenic
1082721243 11:56679617-56679639 TTGAGAAAAAAGAAAAAAAGAGG + Intergenic
1082741076 11:56911835-56911857 CTTAAACAACAGAAAAAAGGAGG + Intergenic
1082743801 11:56940502-56940524 CTGAGCCAAAAGAAGAAAGCTGG - Intergenic
1082746009 11:56963894-56963916 CTAAGCAAACAGAACAAAGCTGG - Intergenic
1082853588 11:57786767-57786789 GTGAGAAAACAGAAAAAAAATGG - Intronic
1083083396 11:60116522-60116544 CTGAGAAACCAGTAGAAAACTGG + Intergenic
1083102744 11:60326926-60326948 CTGAGAAACAAGAACAAAGTTGG + Intergenic
1083125075 11:60556828-60556850 CTGAGCAAAAAGAACAAAGTTGG + Intergenic
1083148793 11:60777103-60777125 ATGAAGAAACAGAAGGAAGGAGG - Intergenic
1083193529 11:61069296-61069318 CTGAGGGGCCAGAAGAAAGGGGG - Intergenic
1083407520 11:62468594-62468616 CTGAGAAATCAGGAGAAAGAGGG + Intronic
1083484253 11:62973501-62973523 ATGAGACAACAGAAGCAAGAGGG - Intronic
1083930878 11:65844184-65844206 CTGAAAAAAAAGAATAAAGGTGG + Intronic
1085402789 11:76244555-76244577 CTGACTAACCAGGAGAAAGGAGG + Intergenic
1085402884 11:76245004-76245026 GTGAGAACACAGCAAAAAGGTGG + Intergenic
1085670526 11:78460081-78460103 CTGAAGACACAGAAGAAGGGTGG + Intronic
1085741449 11:79081179-79081201 CTGAGAAGACAGAGGAAAAGAGG - Intronic
1085827379 11:79862218-79862240 AACAGAAAACAGAAGAAAGCAGG + Intergenic
1085915319 11:80880412-80880434 CTAAGCAAAAAGAAGAAAGCTGG + Intergenic
1085965947 11:81526560-81526582 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1086000757 11:81983383-81983405 CAGAGAAGACAGAAAAAAGGAGG - Intergenic
1086277575 11:85149190-85149212 CTGAGCAAAAAGAACAAAGCTGG - Intronic
1086776958 11:90848586-90848608 AAGAGAAAAGAAAAGAAAGGAGG + Intergenic
1086779304 11:90882302-90882324 CTGACAAAAAACAAGAAATGGGG + Intergenic
1086868650 11:92010956-92010978 CTAAGCAAAAAGAAGAAAGCTGG - Intergenic
1086984715 11:93235283-93235305 CTGAGACACCAGAAAAAAAGAGG - Intergenic
1087166387 11:95008250-95008272 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1087253209 11:95926795-95926817 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1087327517 11:96741856-96741878 ATGAGGATACAGGAGAAAGGAGG + Intergenic
1087344423 11:96952625-96952647 CAGAGAAAATATAAGAAATGCGG - Intergenic
1087380669 11:97400721-97400743 ATGAGACAAAAAAAGAAAGGAGG + Intergenic
1087471765 11:98584522-98584544 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1087569410 11:99905581-99905603 CTAAGAAAAAAGAACAAAGCTGG - Intronic
1087597710 11:100273921-100273943 CTAAGCAAAAAGAAGAAAGCTGG + Intronic
1087622215 11:100555152-100555174 TTGAGAAAACAGCAGAAGGAAGG + Intergenic
1087874098 11:103335213-103335235 TTGAAAAAAAAGAAGAAATGAGG + Intronic
1087940718 11:104093679-104093701 CTGAGAAAACAGAATCTATGAGG + Intronic
1087954478 11:104267977-104267999 CTAAGCAAACAGAACAAAGCTGG - Intergenic
1088000449 11:104874013-104874035 CTAGGAAAAGAGAAGAAAGTTGG + Intergenic
1088162103 11:106884569-106884591 CTAAGAAAACACAGGAAAAGGGG + Intronic
1088368767 11:109066338-109066360 CTGAGAAATCTGAAGCAAAGAGG + Intergenic
1088483642 11:110320343-110320365 CTTAGAAAGAAGAAGAAAGCTGG - Intergenic
1088545397 11:110953725-110953747 CTAAGAACAAAGAACAAAGGAGG - Intergenic
1088705459 11:112459720-112459742 CTGAGATAAAAGAAGAAATAAGG - Intergenic
1089252225 11:117173003-117173025 CTTAGAAATCAGAAGACAGGCGG - Intronic
1089322470 11:117635728-117635750 ATGAGAAAGGAGAAGAAATGAGG + Intronic
1089740745 11:120580565-120580587 CTAAAAAAAAAAAAGAAAGGAGG - Intronic
1089766228 11:120767988-120768010 CTGAGAAAGAAAAAGAAAGTTGG - Intronic
1090134392 11:124181981-124182003 TAGAGAAAACAAAAGAAAAGAGG - Intergenic
1090136359 11:124203564-124203586 CTGGGGAGTCAGAAGAAAGGAGG + Intergenic
1090350163 11:126102902-126102924 CTGGGCAAAGAGAAGAAAGGAGG + Intergenic
1090424999 11:126601625-126601647 CTGAGAGAACCAGAGAAAGGAGG + Intronic
1090525819 11:127534674-127534696 TTGAGAAAAAAGAATAAAGCTGG - Intergenic
1090703242 11:129314820-129314842 CAAAGAAAGCAAAAGAAAGGAGG - Intergenic
1090719894 11:129461928-129461950 CTGAGCAAAAAGAACAAAGATGG - Intergenic
1090853509 11:130591637-130591659 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1090942864 11:131403760-131403782 TTGAGAAAACAGAAGCAATCAGG + Intronic
1091010024 11:131992550-131992572 ATGAGAAAACAGCAGAATTGAGG - Intronic
1091076423 11:132622306-132622328 CAAAGACAACTGAAGAAAGGGGG + Intronic
1202828238 11_KI270721v1_random:100275-100297 CGGAGAGAACAGGAGAAAGTGGG + Intergenic
1091454730 12:598526-598548 GTGAGAAATGAGGAGAAAGGGGG + Intronic
1091834059 12:3572081-3572103 TTGAGAAAGAAGAAGAAAGGAGG - Intronic
1091883171 12:3996407-3996429 CTGAGAGAGAAGAAGGAAGGAGG - Intergenic
1091964695 12:4728797-4728819 TTGAGAAAGAAGAAGAAAGTTGG - Intronic
1092251989 12:6904740-6904762 CTGAGAAGCGAGAAGAGAGGGGG - Intronic
1092258701 12:6941055-6941077 ATGAGAAAAGGGCAGAAAGGAGG + Intronic
1092393789 12:8106329-8106351 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1092439299 12:8483672-8483694 CTAGGAAAAAAGAAGAAAGCAGG - Intergenic
1092509326 12:9137466-9137488 TTGAGAAAGAAGAAGAAAGCTGG - Intergenic
1092514045 12:9189198-9189220 CTAAGCAAAAAGAAGAAAGGAGG + Intronic
1092685767 12:11043991-11044013 CTAAGAAAAAAGAACAAAAGTGG + Intronic
1092774025 12:11926259-11926281 CTAAGAAAAAAGAACAAAGCTGG + Intergenic
1092803475 12:12196131-12196153 CTGAGCAAAAAGAACAAAGCTGG - Intronic
1092941667 12:13414667-13414689 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1092951712 12:13509758-13509780 CTGAGAAACCAAAGGAAAGCTGG + Intergenic
1092978205 12:13766787-13766809 CTGAGAGAAGAGAAGAGATGAGG - Intronic
1093038806 12:14356506-14356528 GAGAGAAAAAAAAAGAAAGGAGG - Intergenic
1093077336 12:14771444-14771466 TTGAAAAAACAGAAGGAGGGAGG - Intergenic
1093269620 12:17044125-17044147 CTCAGGAAAAAGAAGAAAAGGGG + Intergenic
1093428151 12:19052606-19052628 CTTAAAACATAGAAGAAAGGAGG + Intergenic
1093535960 12:20223523-20223545 CTGAGCAAAAAGAATAAAGCTGG + Intergenic
1093598817 12:20996526-20996548 CTAAGCAAACAGAAGAAATCTGG - Intergenic
1093681246 12:22006096-22006118 CTGAGCAAAAAGAATAAAGCTGG - Intergenic
1093952546 12:25180488-25180510 CTAAGCAAAAAGAAGAAAGCTGG + Intronic
1094121381 12:26978295-26978317 ATGAGAAAACAGAAATAAAGAGG - Intronic
1094210576 12:27885756-27885778 CTGGGAACAAAGAAGAAGGGTGG - Intergenic
1094436016 12:30421613-30421635 CTAAGAAAAAGGAAAAAAGGTGG - Intergenic
1095224359 12:39662087-39662109 CTGAGCAAAAAGAACAAAGGTGG - Intronic
1095281681 12:40358662-40358684 CTGAGCAAAAAGAACAAAGCTGG - Intronic
1095433932 12:42166951-42166973 ATAAGAAAACAGAAAAATGGTGG - Intronic
1095552956 12:43466076-43466098 CAGAGAAACCTGAAGGAAGGTGG + Intronic
1095696649 12:45151492-45151514 ATGAGAGAACAGAACTAAGGGGG - Intergenic
1095911821 12:47435225-47435247 CTGAGCAAAAAGAATAAAGCTGG + Intergenic
1095912052 12:47437738-47437760 CAAAGCAAACAGAAGGAAGGAGG + Intergenic
1096395481 12:51262927-51262949 AAGAGAAGGCAGAAGAAAGGGGG - Intronic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096749411 12:53749116-53749138 GGGAGAGAACAGAAGAAAGATGG + Intergenic
1097410612 12:59248036-59248058 CTGAAAAAAAAAAAAAAAGGGGG + Intergenic
1097525824 12:60734254-60734276 CTGAGCAAATAGAACAAAGCTGG - Intergenic
1097866150 12:64560663-64560685 CTGAGAAAACAAGAGTAAGATGG - Intergenic
1097977416 12:65702132-65702154 CTGAACAAACAGAAAAAAAGTGG - Intergenic
1098066539 12:66623683-66623705 CTGAGCCTACAGAAGAAATGAGG - Intronic
1098145561 12:67494337-67494359 CTAAGCAAACAGAACAAAGCTGG + Intergenic
1098198355 12:68026628-68026650 CTGAGGAAACAGAATCACGGTGG - Intergenic
1098215493 12:68212323-68212345 CTGAGCAAAAAGAACAAAGCTGG - Intronic
1098245779 12:68516037-68516059 CTGGGAAGGGAGAAGAAAGGGGG + Intergenic
1098347433 12:69520857-69520879 CTAAGAAAAAAGAACAAAGCAGG - Intronic
1098458913 12:70710101-70710123 CTGAGCAAAAAGAACAAAGCTGG + Intronic
1098579901 12:72087386-72087408 CTGAAGACACAGAAGAAAGATGG + Intronic
1098738873 12:74144892-74144914 CAGTTAAAACAGAAGAAAGGAGG - Intergenic
1098794627 12:74873682-74873704 TTGAGCAAACAGATGAAAAGTGG + Intergenic
1098860239 12:75701404-75701426 CTGAGAAAACAGTACACAGATGG - Intergenic
1098895704 12:76057814-76057836 AAGAAAAAACAGAAGAGAGGTGG + Intronic
1099027224 12:77480002-77480024 CAAAGAAAGCAGAAGAAAGCAGG - Intergenic
1099100534 12:78434389-78434411 CTGAGAAAAAAGAACAAAACTGG - Intergenic
1099192860 12:79578421-79578443 CTGAGCAAAAAGAACAAAGCTGG + Intronic
1099241584 12:80145321-80145343 CTGAGAAAAAACAAGCAACGGGG - Intergenic
1099497787 12:83374081-83374103 CTAAGCAAAAAGAAGAAAGCTGG - Intergenic
1099583096 12:84478453-84478475 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1099917286 12:88910508-88910530 CTGAGAAAAGAGAACAAACCTGG - Intergenic
1099992654 12:89741993-89742015 CTGAGCAAACAGAACAAAACTGG + Intergenic
1100024998 12:90117283-90117305 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1100040150 12:90306803-90306825 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1100193334 12:92216663-92216685 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1100250284 12:92814088-92814110 TTGAGAAAACAGTAAAAATGGGG + Intronic
1100482921 12:94996517-94996539 AAGGGAGAACAGAAGAAAGGAGG + Intronic
1100508596 12:95245253-95245275 CTGAGAAACAAGATAAAAGGTGG - Intronic
1100776635 12:97982124-97982146 CTGAGTAAAAAGAATAAAGTTGG + Intergenic
1100804811 12:98271710-98271732 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1100877224 12:98975102-98975124 AAGAGGAAACAGAAGAAAGTAGG - Intronic
1100932327 12:99623955-99623977 CTAAGAAAAAAGAACAAAGTTGG + Intronic
1100971397 12:100074752-100074774 CTAAGAAAAAAGAACAAAGCTGG + Intronic
1101145728 12:101838867-101838889 CAGAGCAAACAGAATAAGGGGGG - Intergenic
1101160658 12:101971450-101971472 CTGAGCAAAAAGAAGAAAATTGG + Intronic
1101173992 12:102129942-102129964 CTAAGCAAAAAGAAGAAAGCAGG + Intronic
1101353421 12:103954744-103954766 GTGAGCAGACAGGAGAAAGGAGG + Intronic
1101450562 12:104774247-104774269 CTTAGAAAAGGGAACAAAGGAGG - Intergenic
1101536351 12:105620769-105620791 CTGAGTAAAGAGAACAAAGCTGG - Intergenic
1101608023 12:106264460-106264482 CTGAGCAAAAAGAACAAAAGTGG + Intronic
1101612995 12:106309205-106309227 GAGAGAAGACAGAAGAAAAGGGG - Intronic
1101672886 12:106893105-106893127 CTGGGACAAAGGAAGAAAGGGGG + Intergenic
1102095570 12:110237926-110237948 CTGAGAAAGAAGAACAAAGTTGG - Intergenic
1102101889 12:110285554-110285576 CTGAGAAAAATAAAGCAAGGGGG + Intronic
1102216511 12:111165272-111165294 CTGAGAAAAGAGAAGTAGGAAGG + Intronic
1103012276 12:117466454-117466476 AGGAGAAAACAGCAGAAATGGGG + Exonic
1103055080 12:117812865-117812887 CTGAGCAAAAAGAACAAAGCTGG + Intronic
1103316960 12:120063924-120063946 GTGAGAAAACAGAGGCAAAGAGG - Intronic
1103336108 12:120190995-120191017 ATGAGAAAACTGAAGATTGGGGG - Intronic
1103457910 12:121080618-121080640 CTTAGAAAAAAAAAAAAAGGCGG - Intergenic
1103460523 12:121101059-121101081 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1103677246 12:122665551-122665573 AAGAGAAAAGAGAAGAAAAGAGG - Intergenic
1103729248 12:123015636-123015658 ATGATAAAACAGAAGAAAACTGG + Intronic
1104332136 12:127856818-127856840 CTGGGAAAACACAAGGAGGGAGG + Intergenic
1104352901 12:128060097-128060119 CAGAGAAAACAAAACAGAGGAGG - Intergenic
1104467455 12:129002534-129002556 CTGAAAGAACAGGAGAAAGAGGG - Intergenic
1104761045 12:131297715-131297737 CTGAGAAAAGAGAAGACACAGGG + Intergenic
1104818733 12:131663077-131663099 CTGAGAAAAGAGAAGACACAGGG - Intergenic
1105244507 13:18636632-18636654 CTAAGCAAACAGAACAAAGCTGG + Intergenic
1105318102 13:19287486-19287508 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1105819691 13:24069063-24069085 CTAAGCAAAAAGAAGAAAAGTGG - Intronic
1105835299 13:24205633-24205655 CTAAGCAAAAAGAAGAAAGCTGG + Intronic
1105938577 13:25126307-25126329 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1106073632 13:26438214-26438236 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1106258286 13:28041300-28041322 CTGAAAAAGGAGAAGAGAGGAGG + Intronic
1106334574 13:28771881-28771903 CTAAGCAAAAAGAAGAAAGCTGG - Intergenic
1106610613 13:31276081-31276103 CTGATCACACAGATGAAAGGGGG - Intronic
1106742274 13:32657385-32657407 AACAGAAAACAGAAGAAAGCAGG - Intronic
1106823005 13:33487469-33487491 CTGTGAAAAGAAAAGAAAGGGGG + Intergenic
1106860341 13:33900228-33900250 CCGAGAAAAAAGAACAAAGCGGG + Intronic
1106925083 13:34605437-34605459 TTGAGAAAACAGAAGCAGGAAGG + Intergenic
1107048769 13:36024787-36024809 CCGAGAAAGAAGAATAAAGGTGG + Intronic
1107130525 13:36889467-36889489 ATGAGAAAACAGAAGCAAAATGG + Intronic
1107322842 13:39207759-39207781 CTAAGCAAAAAGAAGAAAGCTGG - Intergenic
1107336168 13:39358096-39358118 CTAAGAAAAAAGAATAAAGCTGG + Intronic
1107379298 13:39838793-39838815 CTGAGCAAAAAGAACAAAGTTGG + Intergenic
1107510391 13:41078191-41078213 CTAAGCAAAAAGAACAAAGGTGG + Intronic
1107527990 13:41252448-41252470 AGGAGAAGACAGTAGAAAGGAGG - Intronic
1107741843 13:43458907-43458929 CTGAAAGAAAAGAAAAAAGGGGG - Intronic
1107793978 13:44031215-44031237 CTCAAAAAAAAGAAGAAAGATGG - Intergenic
1108194430 13:47978215-47978237 CTAAGCAAACAGAACAAAGCTGG + Intronic
1108209533 13:48124405-48124427 CAGAGGAATCAGAAGAAAGGTGG - Intergenic
1108237264 13:48421083-48421105 CTAAGCAAAAAGAAGAAAGCTGG + Intronic
1108240014 13:48454509-48454531 CTGGGAATACAGAAGTAAGATGG + Intronic
1108261663 13:48663282-48663304 CTGAGCAAAAAGAACAAAGCTGG - Intronic
1108304086 13:49113342-49113364 AAGAGAATACAAAAGAAAGGGGG - Intronic
1108408976 13:50129259-50129281 CAGAGAAAAAAAAAAAAAGGTGG - Intronic
1108434729 13:50390441-50390463 TTGAGAAAACACAGAAAAGGAGG - Intronic
1108759787 13:53548909-53548931 CTAAGAAAAAAGAACAAAGCTGG - Intergenic
1108890261 13:55249594-55249616 CTGAGCAAAAAGAATAAAGGTGG + Intergenic
1108902422 13:55428334-55428356 CTAAGCAAAAAGAAGAAAGCTGG + Intergenic
1109086863 13:57985232-57985254 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1109290038 13:60462817-60462839 CTGAGTAAAAAGAACAAAGCTGG + Intronic
1109298896 13:60569624-60569646 CTGAGCATAAAGAAGAAAGCTGG + Intronic
1109336238 13:60998471-60998493 CTGAGCAAAAAGAACAAAAGTGG - Intergenic
1109426423 13:62169946-62169968 CTGAGCAAAAAGAATAAAGCTGG + Intergenic
1109454286 13:62563909-62563931 CTTAGAAAACAGAGCAAAGAAGG + Intergenic
1109457042 13:62606937-62606959 CTAAGCAAAAAGAAGAAAGCTGG - Intergenic
1109553585 13:63938684-63938706 CTAAGAAAAAAGAACAAAGCTGG + Intergenic
1109597576 13:64576744-64576766 CTAAGAAAAAAGAACAAAGCTGG + Intergenic
1109607285 13:64713138-64713160 CTGAGCAAAAAGAATAAAGCTGG + Intergenic
1109636921 13:65132250-65132272 CTGAGAGAAAAGTAGAAAGAGGG - Intergenic
1109687385 13:65839322-65839344 TTTAGAAAACTGAAGCAAGGAGG - Intergenic
1109793931 13:67285469-67285491 CTGAGAAGAAATAAGAAGGGAGG + Intergenic
1109945158 13:69423232-69423254 CTGAGAAAATGGTAGATAGGAGG + Intergenic
1110069429 13:71154889-71154911 CTAAGCAAACAGAACAAAGCTGG - Intergenic
1110128947 13:71982404-71982426 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1110150397 13:72245161-72245183 ATGAAAAAAAAGAAGAGAGGGGG + Intergenic
1110297365 13:73884233-73884255 CTGAGAAAAGAGAAGAATATAGG - Intronic
1110380127 13:74840856-74840878 TTGAGAAGAGAGAAGAAAGTAGG - Intergenic
1110388871 13:74948280-74948302 CTGAGAAAAGAGAACAAAACTGG + Intergenic
1110398372 13:75059866-75059888 CTGAGCAAAAAGAACAAAGTTGG + Intergenic
1110491623 13:76116703-76116725 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1110629239 13:77687498-77687520 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1110725487 13:78817847-78817869 GGGAGAAAAAGGAAGAAAGGTGG + Intergenic
1110747799 13:79076364-79076386 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1110943057 13:81376034-81376056 CTAGGGAAACAGAAAAAAGGAGG - Intergenic
1111030813 13:82595800-82595822 CTGAGCAAAAATAAGAAAGCTGG + Intergenic
1111105376 13:83638726-83638748 CTGAGAAATGAGAATTAAGGTGG - Intergenic
1111224272 13:85249036-85249058 CAGAGAGATCAGAGGAAAGGAGG + Intergenic
1111256152 13:85671368-85671390 TTGAGAAAATAGAAGAAAGTGGG + Intergenic
1111286895 13:86105818-86105840 CACAGAAAACAGAAAAAAGCAGG - Intergenic
1111394594 13:87648668-87648690 CTAAGAAAACAGATGTAAGCTGG + Intergenic
1111467908 13:88642074-88642096 CTGAGAAAAAAGAACAAAACTGG - Intergenic
1111491966 13:88990676-88990698 CTAAGAAAAAAGAATAAAGCAGG + Intergenic
1111492424 13:88998485-88998507 CTGACAAAACAGAATCAAAGGGG + Intergenic
1111519737 13:89385046-89385068 TTGAGCAAAAAGAAGAAAGCTGG - Intergenic
1111561523 13:89955300-89955322 TTGAGAAAAAAGAACAAAGATGG - Intergenic
1111875009 13:93882057-93882079 AAGAGAAAAGAAAAGAAAGGAGG - Intronic
1112076539 13:95919904-95919926 CTAAGAAAAAAGAACAAAGCTGG + Intronic
1112646376 13:101337607-101337629 CTTAGAAAAAAGAATAAATGTGG - Intronic
1112791170 13:103003612-103003634 CTGAGAAGACAGAACAAAAATGG + Intergenic
1112892493 13:104255403-104255425 CTGAGAAAACAGATGTAAGTAGG - Intergenic
1113261193 13:108565092-108565114 CTGAGGAAAAAGAATAAAGCTGG - Intergenic
1113410688 13:110085909-110085931 CTAAGAAAAAAGAACAAAGCTGG + Intergenic
1114162841 14:20188269-20188291 CTAAGCAAACAGAACAAAGCTGG + Intergenic
1114205336 14:20566001-20566023 CTGAGCAAAAAGAATAAAGCTGG + Intergenic
1114241289 14:20870805-20870827 AAGAGAGAAAAGAAGAAAGGAGG + Intergenic
1114262156 14:21044721-21044743 CTGAGATAAAGGAAGAAAGAAGG - Intronic
1114326763 14:21596911-21596933 CTGAGGAAACAGAGCAAAGGTGG + Intergenic
1114691650 14:24587844-24587866 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1114707221 14:24739272-24739294 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1114783374 14:25565510-25565532 CTGAGCAAACAGAACAAAACTGG - Intergenic
1114836004 14:26203686-26203708 CTGAGGGTACAGAAGAAAAGGGG - Intergenic
1114937754 14:27565031-27565053 CTGAGAAAAAAGAACAAAGCTGG + Intergenic
1114953059 14:27781371-27781393 CTGGGAAAAAGGAAGTAAGGTGG - Intergenic
1115087832 14:29538657-29538679 CTCAGAAAAAAAAAAAAAGGAGG + Intergenic
1115108005 14:29784333-29784355 CTGAGCAAAAAGAACAAAGCTGG - Intronic
1115131532 14:30057762-30057784 CTGAGAAAACAGAAGAAAGGGGG + Intronic
1115135431 14:30102168-30102190 CTAAGCAAAAAGAACAAAGGTGG + Intronic
1115402372 14:32976819-32976841 CTGAGAAATCAGAAGAATCAAGG + Intronic
1115790968 14:36877732-36877754 CACAGAAAAAAGAAGAAAAGAGG + Intronic
1115832634 14:37359275-37359297 CTAAGCAAAAAGAAGAAAGCTGG - Intronic
1115964204 14:38868693-38868715 CTGAGAAAGCTCAAGAAAGGGGG + Intergenic
1116027100 14:39527920-39527942 CTGAGCAAAAAGAAGAAACCTGG - Intergenic
1116058307 14:39891247-39891269 CTGAGGAAGGAGAACAAAGGTGG + Intergenic
1116059323 14:39900750-39900772 CTGAGGAAAGAGAACAAAAGTGG - Intergenic
1116061461 14:39929519-39929541 CTAAGCAAAAAGAAGAAAGCTGG - Intergenic
1116209567 14:41917439-41917461 CAGAGAAGACAGAGAAAAGGGGG - Intergenic
1116354465 14:43910922-43910944 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1116579366 14:46619399-46619421 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1116705571 14:48294371-48294393 TTGAGAAAAAAGAATAAAGCTGG - Intergenic
1116710080 14:48357289-48357311 GTGAGAACACAGCAAAAAGGTGG - Intergenic
1116722386 14:48515231-48515253 TTGAGAAAAAAGAACAAAGCTGG - Intergenic
1116722816 14:48522761-48522783 CTCAAGAAACAGAAGTAAGGTGG + Intergenic
1116869907 14:50060993-50061015 CTGAGAGAAATGAGGAAAGGAGG - Intergenic
1117106767 14:52405427-52405449 CTAAGAACAAAGAAGAAGGGTGG + Intergenic
1117205797 14:53442482-53442504 TTGAGGAAACAGAGTAAAGGAGG - Intergenic
1117481375 14:56148666-56148688 CAGAGAACACAGAAGAAAGGAGG - Intronic
1117504037 14:56383282-56383304 CTGAGCAAACAGAACAAAACTGG - Intergenic
1117655873 14:57955990-57956012 CTAAGAAAAAAGAATAAAGCTGG + Intronic
1117751451 14:58928374-58928396 CTAAGCAAAGAGAAGAAAGTTGG + Intergenic
1117856102 14:60035782-60035804 CTGAGCAAAAAGAACAAAGCTGG - Intronic
1118043733 14:61944433-61944455 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1118321716 14:64757362-64757384 AAGAGGAAACAGAAGAAAGGTGG - Intronic
1118479405 14:66148814-66148836 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1118491120 14:66261380-66261402 TTGAGAAAGAAGAATAAAGGTGG - Intergenic
1118523584 14:66616146-66616168 CTGAGCAAAAAGAACAAAGCTGG - Intronic
1118529522 14:66687289-66687311 CTGAGCAAAAAGAACAAAGCTGG - Intronic
1118581540 14:67305169-67305191 CTGAGGAAACATAACAGAGGAGG + Intronic
1118895335 14:69941095-69941117 GTGAGAAAGAAGGAGAAAGGAGG - Intronic
1118898847 14:69969926-69969948 TGGAGAAAAGAGAAGAAAGTGGG + Intronic
1118931190 14:70242568-70242590 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1119121323 14:72080959-72080981 TTGAGCAAAAAGAACAAAGGTGG - Intronic
1119385150 14:74253392-74253414 CTGAGAAGACATATCAAAGGTGG + Intronic
1119586759 14:75842960-75842982 CATAGCAAAAAGAAGAAAGGTGG + Intronic
1119877138 14:78070570-78070592 CTGAGAAAAGAAAAGAAACGTGG - Intergenic
1120486524 14:85121040-85121062 ATGTGAAGAGAGAAGAAAGGTGG + Intergenic
1120587925 14:86338488-86338510 CTGAGAAAAAAGAACAAAGCTGG - Intergenic
1120673409 14:87390358-87390380 CTCAGAAAACAAAAGATAAGTGG + Intergenic
1120824848 14:88945745-88945767 CTGAGAAAAAAGAGGAAATGTGG + Intergenic
1121060873 14:90908470-90908492 CTGTGAAAACAGAAGATATGTGG + Intronic
1121068320 14:90991394-90991416 GTGAGAAAATAGAAGTAAAGAGG + Intronic
1121192742 14:92044536-92044558 ATGAGTAAACAGAAGATAGTAGG + Exonic
1121216527 14:92252815-92252837 GAGAGAAAACAGAAGAAGGAGGG + Intergenic
1121838597 14:97114445-97114467 ATGAGAAAACAGAGGCACGGGGG - Intergenic
1122148868 14:99712845-99712867 CTGAGCAAAAAGAACAAAGCTGG + Intronic
1123681098 15:22764668-22764690 CTGAGACAAAAGTAGAATGGTGG - Intergenic
1124078324 15:26467446-26467468 CTAAGTAAAAAGAAGAAAGCTGG + Intergenic
1124225983 15:27895385-27895407 CTCAGAATACAGAAGAATGTGGG + Intronic
1124333315 15:28839129-28839151 CTGAGACAAAAGTAGAATGGTGG - Intergenic
1124394078 15:29285354-29285376 CTGAGAGAGCACAAGAAAGCTGG - Intronic
1124682821 15:31750556-31750578 CTGAGCAAAAAGAACAAAGCTGG + Intronic
1125235569 15:37509231-37509253 CTAAGCAAAAAGAAGAAAGCTGG - Intergenic
1125245836 15:37638045-37638067 CAGAGCAAACAGAAGGGAGGAGG + Intergenic
1125296602 15:38209877-38209899 TTATGAAAACAGAAGAAAGAGGG - Intergenic
1125357633 15:38832999-38833021 CTAAGCAAAAAGAAGAAAGCTGG - Intergenic
1125786263 15:42320994-42321016 CTGAGTAAAGAGAAGAAAAAAGG - Intronic
1126016068 15:44352120-44352142 CTGAGAAAAAAGAACAAAATAGG + Intronic
1126036502 15:44551061-44551083 CAGGGAAAACAGAATAAAGTGGG - Intronic
1126139787 15:45427985-45428007 CTGAGAAAACTTACCAAAGGTGG - Intergenic
1126317980 15:47391204-47391226 CTCAGAGAGCAGAGGAAAGGAGG - Intronic
1126474232 15:49049412-49049434 CTGAGAAAACAGAAGCCATTAGG - Intergenic
1126522373 15:49610612-49610634 TATAGAAAACAGAAAAAAGGTGG - Intronic
1126539048 15:49802277-49802299 GGGAAAAAAAAGAAGAAAGGAGG + Intergenic
1126738617 15:51755863-51755885 ATAAGCAAGCAGAAGAAAGGAGG + Intronic
1127027523 15:54823896-54823918 TTGAGCAAAGAGAAGAAAGATGG - Intergenic
1127047347 15:55041136-55041158 CTGAGCAAAAATAAGAAAGCTGG - Intergenic
1127058417 15:55156232-55156254 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1127382493 15:58442118-58442140 CTGAGAGATCAGAGGTAAGGAGG - Intronic
1127674901 15:61229266-61229288 CTCTGAAAACAGAAGATAGAGGG - Intronic
1127680346 15:61289595-61289617 CTGAGCAAAAAGAACAAAGTTGG + Intergenic
1127730195 15:61793730-61793752 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1127927353 15:63559913-63559935 ATGGGAAAACAGCAGGAAGGCGG + Exonic
1127970371 15:63954591-63954613 CTGAGAAAAAAGAACAAAAGTGG - Intronic
1128221378 15:65971046-65971068 CTGAGAAGACATAAGGAAGGAGG + Intronic
1128353936 15:66911332-66911354 CTGAGAAAGCACCAGAAAAGGGG - Intergenic
1128732365 15:70029871-70029893 CTGAAAAAACAAAAGACAAGAGG + Intergenic
1128749139 15:70136174-70136196 CTTATAAAAAAGGAGAAAGGTGG + Intergenic
1129292468 15:74578891-74578913 CTCAAAAAACAAAAGAAAGAAGG + Intronic
1129372711 15:75107986-75108008 GTAAGAAAACAGAAGAATGATGG + Intronic
1129495125 15:75972634-75972656 CTGACAAAAAATAAGTAAGGGGG - Intronic
1129548862 15:76426768-76426790 CTGAGCAAAAAGAACAAAGCTGG + Intronic
1129978782 15:79847176-79847198 TTCAGAAACCAAAAGAAAGGTGG + Intronic
1130166245 15:81461939-81461961 CTGAGAAAAAAGAACAAAGCTGG - Intergenic
1130634982 15:85609824-85609846 CAGAGAAAATGGAAGAGAGGAGG - Intronic
1130764621 15:86857435-86857457 ATGTGAAAACAGATGAAAGAAGG - Intronic
1130767871 15:86890830-86890852 CTAAGCAAAAAGAACAAAGGTGG - Intronic
1130989423 15:88867141-88867163 CTGAGAAACCAGAAGACCTGGGG - Intronic
1131353202 15:91720363-91720385 AGGAGAAGACAGAAGAAAGTGGG + Intergenic
1131444209 15:92482789-92482811 CTGAGCAAAAAGAACAAAGCTGG + Intronic
1131660475 15:94509953-94509975 CTGAGCAAAGAGAAAAAAGCTGG + Intergenic
1131967352 15:97858539-97858561 CTGACAAAACAGAAGGCAGGAGG + Intergenic
1132003590 15:98205252-98205274 TTGAGCAAAGAGAAGAAAGCTGG + Intergenic
1132037319 15:98495986-98496008 CTGAGCAAAAAGAACAAAGCTGG - Intronic
1132129725 15:99264757-99264779 CTTAGAAAAGAGAAGAGAGGGGG - Intronic
1132155247 15:99491553-99491575 ATGTGAAGACAGAGGAAAGGTGG - Intergenic
1132334258 15:101034695-101034717 CTGAGCAAAAAGAACAAAGCTGG - Intronic
1133630331 16:7614350-7614372 CTGATAAGACAGAAGAGGGGAGG - Intronic
1133782746 16:8952538-8952560 CTGAGAAGACAGGTGCAAGGGGG - Intronic
1133826363 16:9281788-9281810 CAGATAGAACAGAAGAGAGGAGG - Intergenic
1133873242 16:9709265-9709287 CTGAGAACCCAGAAGGCAGGAGG - Intergenic
1134140125 16:11711212-11711234 CAGAGAAAACAGAGTAAGGGTGG + Intronic
1134179129 16:12033401-12033423 TTATGAAAACAGAAAAAAGGAGG - Intronic
1134316627 16:13124667-13124689 CTGAGCAAAAAGAACAAAGCTGG + Intronic
1134781314 16:16898602-16898624 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1134869804 16:17641700-17641722 ATGACAAAACAGTAGAAAGATGG + Intergenic
1135305865 16:21367174-21367196 TTATGAAAACAGAAAAAAGGAGG - Intergenic
1135398911 16:22152208-22152230 CTCAGAAAAGAAAAGAAATGGGG + Intronic
1136125761 16:28179208-28179230 CTGAGGAGACATAAGAAAAGGGG + Intronic
1136302607 16:29346325-29346347 TTATGAAAACAGAAAAAAGGAGG - Intergenic
1137043871 16:35638835-35638857 CTGAGAAGACATAAGAAAAATGG + Intergenic
1137308559 16:47230440-47230462 CTGAGAAAAGAAAAGAGAGATGG + Intronic
1137316279 16:47327024-47327046 CTAAGCCAAAAGAAGAAAGGTGG + Intronic
1137318378 16:47351761-47351783 CTAAGCCAAAAGAAGAAAGGTGG + Intronic
1137385368 16:48037094-48037116 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1137483596 16:48873153-48873175 CAGAGAAAACATCAGAAAGGAGG + Intergenic
1137516996 16:49154219-49154241 TTGAGAAAGAAGAACAAAGGTGG + Intergenic
1138139302 16:54553738-54553760 CTGAGAAGACAGAAGACAAGAGG - Intergenic
1138219769 16:55240682-55240704 CTGAGAAAACAGAAGGGACCTGG - Intergenic
1138300536 16:55924620-55924642 CTGAGCAAAAAGAACAAAGCTGG + Intronic
1138637671 16:58354753-58354775 CTGAGTAAAAAGAACAAAGCTGG - Intronic
1138752739 16:59443605-59443627 CTGACAAAAAACAAGAAATGGGG + Intergenic
1138997011 16:62467799-62467821 CTAAGCAAAAAGAACAAAGGTGG - Intergenic
1139046895 16:63072010-63072032 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1139089839 16:63632015-63632037 CAGAGCAAAGACAAGAAAGGAGG + Intergenic
1139122184 16:64033852-64033874 CTGACAAAACAGAACTCAGGTGG + Intergenic
1139304483 16:65972311-65972333 TTGAGGAAAAAGAACAAAGGTGG - Intergenic
1139495315 16:67312680-67312702 CTGAGCAACCAGATGAATGGTGG - Intronic
1139545884 16:67649361-67649383 CTGAGGGAACAAGAGAAAGGAGG - Intronic
1139762737 16:69199845-69199867 GTGAAAAATCAGGAGAAAGGGGG + Intronic
1139825366 16:69752932-69752954 CTCAAAAAAAAGAAGAAAGTTGG + Intronic
1140319455 16:73934691-73934713 CTAAGAAAAAAGAACAAAGATGG + Intergenic
1140538812 16:75736098-75736120 CTGACAAAAAACAAGAAATGGGG - Intronic
1140956986 16:79875058-79875080 CTGAGAAAACAGAGGCAAATTGG + Intergenic
1141433006 16:83980610-83980632 CCGAGAAAACAGAACAAGGGTGG + Intronic
1141697256 16:85625962-85625984 CTGAGAAAACACAAGCAGGTGGG - Intronic
1141711109 16:85699396-85699418 CTGAGAAGCCAGAAGGAAGGGGG + Intronic
1141747759 16:85937459-85937481 CTGTGAACAAGGAAGAAAGGAGG + Intergenic
1141773196 16:86103854-86103876 CTGACATAATAGAAGCAAGGTGG - Intergenic
1141874298 16:86811574-86811596 GTGAGAACAAGGAAGAAAGGGGG + Intergenic
1143328008 17:6112996-6113018 CTGAGCAAAAAGAACAAAGCTGG + Intronic
1143589256 17:7871257-7871279 ATGAGAAAACAGACAAAGGGAGG - Intronic
1143679198 17:8463728-8463750 TTGAGAAAACAGAAGCAACTGGG - Intronic
1143696777 17:8626625-8626647 TTAAAAAAAAAGAAGAAAGGAGG + Intronic
1143833996 17:9675425-9675447 ATGAGAAAAAAAAAGAAAAGTGG + Intronic
1144029925 17:11310531-11310553 ATGAGGAGACAGAAGAAATGAGG + Intronic
1144078770 17:11743410-11743432 CTGAGGAATTAGAAGAGAGGTGG - Intronic
1144214684 17:13044825-13044847 CTGAGAAAAAAGGAGAAGAGAGG + Intergenic
1144381306 17:14701254-14701276 CTGATAAATCAGAAGTAAAGAGG - Intergenic
1144436987 17:15251098-15251120 CTGAGTTAGCTGAAGAAAGGAGG - Intronic
1146228368 17:31087557-31087579 CTGAGAAAAGTAAAGAAAGAGGG - Intergenic
1146508466 17:33425657-33425679 TTGAGAAAACAGAAGGGATGGGG + Intronic
1146888709 17:36490525-36490547 CTGAGCAAACAGAACAAAGCTGG - Intronic
1147364530 17:39951547-39951569 CTCAAAAAAAAGAAGAAATGGGG - Intergenic
1148554299 17:48569062-48569084 CCGAGAAAAAAAAAGAGAGGGGG - Intronic
1148568493 17:48647593-48647615 CACAGGGAACAGAAGAAAGGAGG - Intergenic
1148700483 17:49583819-49583841 CTTAGAAAAAAAAAGACAGGAGG - Intronic
1149004007 17:51785746-51785768 CTGAGCAAAAAGAAGAAAACTGG - Intronic
1149075273 17:52589472-52589494 CTGAGCAAAAAGAATAAAGCTGG - Intergenic
1149196542 17:54128339-54128361 CTAAGCAAAAAGAAGAAAGCTGG - Intergenic
1149370468 17:55989208-55989230 CTGGGAAGAGAGGAGAAAGGAGG - Intergenic
1150198860 17:63332272-63332294 AAGAAAAAACAGAAGAGAGGTGG - Intronic
1151444056 17:74151912-74151934 CCGAGAAACCACAAGAAAAGTGG + Intergenic
1151450302 17:74194668-74194690 AGAAGAAAACAGAAGAAAGAAGG + Intergenic
1151802443 17:76385962-76385984 CTGAGAAAACAAAACCAAAGAGG - Intronic
1151990766 17:77572579-77572601 CTGAGGAAACAGCAGGGAGGAGG - Intergenic
1151997579 17:77619664-77619686 TTGAGAAAAAAGAAAAAAAGGGG - Intergenic
1152350569 17:79781943-79781965 CTGAGAGACAGGAAGAAAGGGGG - Intronic
1152913031 17:83016450-83016472 CAGAGAGAAGAGAATAAAGGAGG + Intronic
1153129252 18:1835518-1835540 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1153133046 18:1879661-1879683 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1153274634 18:3355898-3355920 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1153327787 18:3839505-3839527 CTGGGCAAAGAGAAGAGAGGAGG + Intronic
1153401186 18:4685388-4685410 CTGACAAAAAACAAGAAATGGGG + Intergenic
1153466528 18:5394573-5394595 GTGAGAGAACAGAGGAAAGGAGG + Intronic
1153644473 18:7182719-7182741 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1153679024 18:7483017-7483039 CTGAGAAAAAAAAAGGAAGAGGG + Intergenic
1153701938 18:7703119-7703141 CTGAGCAAAAAGAACAAAGCTGG - Intronic
1153722386 18:7919236-7919258 CTGAGCAAAAAGAAAAAAGCTGG - Intronic
1153803237 18:8689967-8689989 CTGAGAAGACTGATGAAAGGGGG - Intergenic
1153862652 18:9229234-9229256 CTGAGCAAATAGAACAAAGCTGG - Intronic
1153977508 18:10282439-10282461 CTGAGAGGACAGAAGGAAAGAGG + Intergenic
1154097993 18:11438293-11438315 CTGAGAATAAAGAATAAAGCTGG + Intergenic
1154350299 18:13577535-13577557 CAGAGAAAACTTAAGAAATGGGG + Intronic
1154444427 18:14423266-14423288 CTAAGCAAACAGAACAAAGCTGG - Intergenic
1155049772 18:22136513-22136535 ATGAGAAAACAGCTGGAAGGAGG + Intergenic
1155124649 18:22860475-22860497 CTGAGCAAACAGAACAAATCTGG + Intronic
1155448427 18:25937507-25937529 CTAAGCAAAAAGAAGAAAGCTGG - Intergenic
1155486557 18:26349754-26349776 CTGAGCAAAAAGAACAAAGCTGG + Intronic
1155666034 18:28309550-28309572 CTAAGAAAAAAGAATAAAGCTGG + Intergenic
1155744996 18:29344835-29344857 TTGAGCAAAAAGAAGAAAGCTGG + Intergenic
1155808397 18:30201220-30201242 TTGAGTAAACAGAACAAAGCTGG + Intergenic
1156125169 18:33896333-33896355 CTAAGAAAAAAGAACAAAGCTGG + Intronic
1156135059 18:34027584-34027606 TTTAGAAAATAGAATAAAGGTGG - Intronic
1156135924 18:34037463-34037485 CTGAGTAAAAAGAACAAAGCTGG + Intronic
1156632207 18:38983831-38983853 ATGAGAACACAGAAAGAAGGTGG + Intergenic
1156720928 18:40069168-40069190 GTGAGGAAAAAGAGGAAAGGAGG - Intergenic
1157077920 18:44487209-44487231 CTGAGATAAAAGAAGAAACCTGG + Intergenic
1157185008 18:45532142-45532164 CTAAGAAAAAAGAACAAAGCTGG - Intronic
1157497797 18:48168949-48168971 CTGAGCAAACAGAAGGGAAGTGG + Intronic
1157647777 18:49294257-49294279 CTGAGCAAAAAGAACAAAGCTGG - Intronic
1158036777 18:53041456-53041478 CTAAGAAAAAAGAACAAAGCTGG - Intronic
1158447545 18:57534180-57534202 CCCAGAAAACAAAAGAATGGAGG + Intergenic
1158584825 18:58723025-58723047 CTTTGAAAAAAAAAGAAAGGGGG - Intronic
1158747852 18:60222158-60222180 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1158776195 18:60582882-60582904 CTAAGAAAAAAGAACAAAGCTGG - Intergenic
1158907619 18:62029275-62029297 ATGAGAAAAAAGAAGAGAGAGGG - Intergenic
1159048642 18:63395818-63395840 CAGACAAAACAGAACACAGGAGG + Intronic
1159153238 18:64547662-64547684 TTGAGCAAAAAGAAGAAAGCTGG - Intergenic
1159199692 18:65167912-65167934 CTGGGAAAACGGAAGCAAGTTGG + Intergenic
1159319458 18:66828525-66828547 CTGAGCAAAAAGAAGATAGTTGG - Intergenic
1159331992 18:67006929-67006951 CTGAGCAAATAGAACAAAGCTGG - Intergenic
1159376125 18:67595904-67595926 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1159416615 18:68157680-68157702 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1159545272 18:69833113-69833135 CTGAGCAAAAAGAACAAAGCTGG + Intronic
1159878848 18:73839051-73839073 CTGAGAAAAAGAAAGAAAGTTGG + Intergenic
1159879895 18:73848783-73848805 CTAAGACAACAGAAGAAATCAGG + Intergenic
1160115649 18:76076736-76076758 CTGAGAAAGCAGAAGTGAGGAGG + Intergenic
1160184517 18:76664828-76664850 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1160381875 18:78464347-78464369 CTGAGCAGACAGAACAAAGCTGG - Intergenic
1160917709 19:1505365-1505387 CTCAGAAAAAAAAAAAAAGGAGG + Exonic
1162082247 19:8225171-8225193 TAGAGAAAACAGCAGAGAGGAGG + Intronic
1162090114 19:8274045-8274067 CTGAGAAAACAGAAATCAGCAGG + Intronic
1162092348 19:8288908-8288930 CTGAGAAAACAGAAATCAGCAGG + Intronic
1163141693 19:15353689-15353711 CTGGGAAATCATTAGAAAGGAGG - Exonic
1163560424 19:18016178-18016200 AAGAGAAAAGAAAAGAAAGGGGG + Intergenic
1163590195 19:18189122-18189144 CTGAGCAAACAGAACAAAACTGG + Intergenic
1163804509 19:19387318-19387340 CTCAAAAAAAAAAAGAAAGGGGG - Intronic
1163989658 19:20986787-20986809 CTGAGAAAAAAGTGGAAATGGGG + Intergenic
1164116790 19:22229228-22229250 CTGACAAAAAACAAGAAATGGGG + Intergenic
1164133889 19:22393561-22393583 CTGACAAAACACAAGAAATGGGG + Intronic
1164164919 19:22663199-22663221 CTGACAAAACACAAGAAATGGGG - Intronic
1164345803 19:27255662-27255684 CTAAGACAAAAGAACAAAGGTGG + Intergenic
1164756470 19:30693542-30693564 GGGAGAGAAGAGAAGAAAGGAGG + Intronic
1164923901 19:32110752-32110774 CAGAGAAATCACAAGACAGGTGG + Intergenic
1165037350 19:33043241-33043263 CTGAAAAAAAAGAAAAAAGGTGG + Intronic
1165250473 19:34529263-34529285 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1165260314 19:34609763-34609785 CTGAGAAAAATGAAAAAAGTTGG - Intronic
1165566878 19:36737527-36737549 CTGAGCAAAAAGAACAAAGCTGG + Intronic
1165637573 19:37355102-37355124 CTGAGAAAGGGGAAGGAAGGAGG - Intronic
1165752214 19:38267294-38267316 CGGAGAAAACAGAAGCAATCAGG - Intronic
1165895064 19:39136463-39136485 CTGACTGAACAGAAGGAAGGAGG - Intronic
1167763888 19:51467431-51467453 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1167773111 19:51534284-51534306 CGGAGAAAAAAGAACAAAGCTGG - Intergenic
1167860498 19:52279315-52279337 CTGAGCAAAAAGAACAAAGCTGG - Intronic
1168192720 19:54751495-54751517 CTGAGAAAGCAGGAGAAAGCTGG + Intronic
1168194808 19:54766323-54766345 CTGAGAAAGCAGGAGAAAGCTGG + Intronic
1168200641 19:54812971-54812993 CGGAGAAAGCAGGAGAAAGCTGG + Intronic
1168207880 19:54865653-54865675 CTGAGAAAGCAGGAGAAAGCTGG + Intronic
1168479239 19:56704613-56704635 CTGAGCAAAGAGAACAAAGCTGG + Intergenic
925088032 2:1127395-1127417 CTGAGAAACAAGAATAAAGTTGG - Intronic
925271395 2:2611449-2611471 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
925322854 2:2990252-2990274 CTTAGAAGACAGAAAAAAAGCGG - Intergenic
925477804 2:4238100-4238122 CTAAGCAAAAAGAAGAAAGCTGG + Intergenic
925663883 2:6232306-6232328 CAGAGAGCACAGAGGAAAGGAGG - Intergenic
925869715 2:8259224-8259246 TTGAGAAAAGGAAAGAAAGGGGG - Intergenic
925913110 2:8586211-8586233 CTGAGGAAACAGAAGCATGACGG + Intergenic
926348417 2:11971093-11971115 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
926498460 2:13621132-13621154 CTAAGCAAACAGAACAAAGATGG - Intergenic
926595405 2:14784582-14784604 CTGAGAAAAAACAAGCAATGGGG - Intergenic
926649754 2:15329856-15329878 CAGAGATAACATAAGCAAGGTGG - Intronic
926651948 2:15356394-15356416 GTGAGAACCCAGAAGAAAGGCGG - Exonic
926702837 2:15815308-15815330 CTGAGGAAACAGAAGGAAGGAGG - Intergenic
927003577 2:18824777-18824799 CTGAGTAAATAGAAAAAGGGAGG + Intergenic
927331364 2:21867556-21867578 CTGATAAAAAAGAACAAAGCTGG + Intergenic
927426680 2:22988903-22988925 CTGAGAAAAAACAAGCAATGGGG + Intergenic
927522496 2:23707874-23707896 CTGAGAAAAGGGAAGCCAGGAGG + Exonic
928064649 2:28151270-28151292 CTAGGAAAAAAGAACAAAGGAGG + Intronic
928254152 2:29707430-29707452 CAGGGAAAACAGAACAAGGGAGG + Intronic
928316656 2:30251688-30251710 CTAATAAAAAATAAGAAAGGTGG + Intronic
928320413 2:30278814-30278836 TTGAAGATACAGAAGAAAGGAGG - Intronic
928470547 2:31571071-31571093 CTAAGAAAAAAGAACAAAGCTGG + Intronic
928679398 2:33684159-33684181 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
928679904 2:33691076-33691098 CTAAGCAAAAAGAAGAAAGCTGG - Intergenic
928737511 2:34309292-34309314 CTGAGAAAAAAAAAGCAATGGGG - Intergenic
928763913 2:34618597-34618619 CTGAAAAAAAAAAAAAAAGGTGG + Intergenic
928850435 2:35738952-35738974 CTAAGCAAAAAGAAGAAAGCTGG + Intergenic
928940257 2:36720191-36720213 CTGAGCAAAAAGAACAAAGGTGG + Intronic
929048313 2:37812576-37812598 ATGAGAAAACAGACGCAAGAGGG + Intergenic
929385127 2:41397367-41397389 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
929411319 2:41700022-41700044 ATGAGAAAGCAGAAGACAGGAGG - Intergenic
929734834 2:44536713-44536735 CTGAGCAAAAAGAACAAAGCTGG + Intronic
929750570 2:44708410-44708432 CTGCTCAAACAGGAGAAAGGAGG + Intronic
930291274 2:49496146-49496168 CTGAGCAAAAAGAATAAAGCTGG + Intergenic
930292997 2:49519153-49519175 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
930908256 2:56599819-56599841 CTAAGCAAAAAGAACAAAGGTGG - Intergenic
931210199 2:60186476-60186498 GTGAGGACACAGAAGAAAGGTGG - Intergenic
931211619 2:60202371-60202393 CTAAGCAAACAGAACAAAGCTGG - Intergenic
931217043 2:60255480-60255502 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
931409472 2:62015208-62015230 CAGAGAAAAAAGTAGAAAAGAGG - Intronic
931644680 2:64411279-64411301 TTGAGAAAAGAGAAGAAGGCAGG - Intergenic
931663305 2:64590189-64590211 ATAAGAAAACAGAAGGAATGAGG - Intronic
931795529 2:65705678-65705700 TTGAGAAAGAAGAAGAAAGTGGG + Intergenic
932045827 2:68348674-68348696 CTAAGCAAAAAGAACAAAGGTGG + Intergenic
932101490 2:68904549-68904571 CTGAGCAAAAAGAACAAAGTTGG + Intergenic
932375998 2:71236284-71236306 CTAAGAAAAGAGAAGAATGGCGG + Intergenic
932462434 2:71891686-71891708 CTTAGATAAGAGAAGAAAGGTGG - Intergenic
932518637 2:72382473-72382495 CTAAGCAAAAAGAAGAAAGCTGG - Intronic
932542038 2:72665016-72665038 CTGAGAACACTGAAGAGGGGTGG + Intronic
932920678 2:75910990-75911012 CTGAGCAAAAAGAACAAAAGTGG - Intergenic
933323546 2:80807566-80807588 CTGAGTAAAAAGAACAAAGCTGG + Intergenic
933390758 2:81663673-81663695 CTGTGAAAGCAGAAACAAGGGGG + Intergenic
933551153 2:83777395-83777417 TTGAGAAAAAAGAACAAAGCTGG - Intergenic
933640992 2:84759814-84759836 CTAAGAAAAAAGAAAAAAGCTGG + Intronic
934484262 2:94688062-94688084 CTGGGAAAAAGGAAGTAAGGTGG + Intergenic
934572219 2:95379998-95380020 GGGAGAAAACAGAGGAAAGTGGG - Intronic
934755629 2:96822771-96822793 TTTAGAAAACAGAAGAGAGAAGG + Intronic
934947420 2:98551830-98551852 CTGAGGAAGCTGAAGAAAGCAGG - Intronic
935112515 2:100105481-100105503 GTGAGAAATAAAAAGAAAGGAGG - Intronic
935288226 2:101585218-101585240 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
935411636 2:102770585-102770607 CTGTGAGAAGAGAAGAAAGGAGG - Intronic
935457697 2:103289149-103289171 CTGAGAAAAGAGAAGACCTGAGG + Intergenic
935473132 2:103483614-103483636 TTGAGAAAACAGCTGAAAGAAGG - Intergenic
935490298 2:103711136-103711158 CTAAGTAAAAAGAATAAAGGTGG - Intergenic
935531928 2:104244088-104244110 CTGAGCAAAAAGAACAAAGTGGG + Intergenic
935553956 2:104486530-104486552 CTGGGAAAACTGAAGACATGGGG - Intergenic
935691357 2:105735168-105735190 CTAAGAAAACTAAACAAAGGTGG - Intergenic
935711031 2:105898547-105898569 CTAAGCAAAAAGAAGAAAGCTGG - Intergenic
935841956 2:107123180-107123202 TTGAGAAAACAGCAAGAAGGTGG + Intergenic
936099566 2:109563364-109563386 CAGAGTAAACAAAAGAAAGGGGG - Intronic
936892219 2:117384958-117384980 CTGAGAAAAAAGAACAAAGCTGG - Intergenic
936927200 2:117749357-117749379 CTGAGAAAACAGAAGCAGCTGGG - Intergenic
937014360 2:118590029-118590051 CTGAGAAAACAAACAAGAGGAGG - Intergenic
937284229 2:120739709-120739731 CTTAGTGAAAAGAAGAAAGGGGG - Intronic
937763171 2:125629693-125629715 CTGGGAAAACAAAAGAAACAAGG + Intergenic
938045278 2:128113581-128113603 AAGAGAAAACAGAAGAAAAAAGG - Intronic
938563328 2:132494397-132494419 ATGAGAAAACAGAAGGAACAAGG - Intronic
938613711 2:132975839-132975861 TTTAGAAAACAGGATAAAGGGGG - Intronic
938977598 2:136494706-136494728 CTGAGAAAACAAAAGAAGCTTGG + Intergenic
939058330 2:137389990-137390012 CTGAGCAAAAAGAACAAAGCTGG - Intronic
939463098 2:142522921-142522943 CTGTGAAAACAGATTCAAGGTGG - Intergenic
939758875 2:146149851-146149873 CTGAGAAAAGAAAATAAATGTGG + Intergenic
939970585 2:148654727-148654749 GCCAGAAAACAGAAGGAAGGAGG - Intronic
940101303 2:150042331-150042353 CAGAGAAACCAGAAGAGAAGTGG + Intergenic
940129737 2:150367782-150367804 CTGACTTAACAGAAGACAGGTGG + Intergenic
940166441 2:150778919-150778941 AGGAGAACACAGAATAAAGGAGG + Intergenic
940195328 2:151088128-151088150 CTCAGAAAAGAGAAGATGGGGGG - Intergenic
940492799 2:154386287-154386309 GTGGGAAAACAGAATAAGGGAGG + Intronic
940506555 2:154561693-154561715 CTGAGAAAAATGAACAAAGCTGG - Intergenic
940612918 2:156012694-156012716 AGGAGAAAACAGTAAAAAGGTGG - Intergenic
940674509 2:156712352-156712374 CTAAGCAAAAAGAACAAAGGTGG - Intergenic
940716302 2:157228647-157228669 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
940730909 2:157390158-157390180 CTAAGCAAAAAGAAGAAAGATGG - Intergenic
940827349 2:158427867-158427889 CTGAAAAAAAAGAAGGAAGTGGG + Intronic
941067161 2:160916269-160916291 CTAAGCAAAAAGAAGAAAGCTGG + Intergenic
941213344 2:162670747-162670769 TTTAAAAAACACAAGAAAGGTGG + Intronic
941238896 2:163012553-163012575 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
941750022 2:169125577-169125599 CTGAGCAAAAAGAACAAAGTTGG + Intergenic
942077217 2:172367070-172367092 CCGAGGAAGCAGAAGAAAGTGGG + Intergenic
942391393 2:175497399-175497421 CTGAGAAAAAAGAAAATTGGAGG - Intergenic
942393362 2:175519911-175519933 CTAAGCAAAAAGAAGAAAGCTGG - Intergenic
942400605 2:175598145-175598167 CTAAGCAAAAAGAAGAAAGCTGG - Intergenic
942494663 2:176527121-176527143 CAGAGAAAAGAGGAAAAAGGAGG - Intergenic
942505713 2:176639132-176639154 CTTAGAAATGAGAAGAAAGTGGG - Intergenic
942638611 2:178036572-178036594 CTAAGAAAAAAGAACAAAGCTGG + Intronic
942652694 2:178185006-178185028 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
942739065 2:179152888-179152910 CAAAGAAAATAGAAGAAAGGAGG + Intronic
942769482 2:179499611-179499633 CTAAGAAAACAGAGGATAGAAGG + Intronic
942927671 2:181453544-181453566 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
943038037 2:182770256-182770278 CTAAGCAAAAAGAACAAAGGTGG - Intronic
943077504 2:183213490-183213512 GTGAGAAAACAGAGGCAATGTGG - Intergenic
943204905 2:184882109-184882131 AAGAGAAAACAGAAAAAAGCAGG + Intronic
943236632 2:185329548-185329570 CTGAGCAAAAAGAAGAAAACTGG - Intergenic
943368564 2:186987402-186987424 CTAAGAAAAAAGAACAAAGCTGG - Intergenic
943495578 2:188616809-188616831 CTAAGAAAAAAGAAAAAAGAGGG - Intergenic
943667333 2:190623367-190623389 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
943697939 2:190956543-190956565 CTAAGCAAAAAGAAGAAAGCTGG - Intronic
943714689 2:191137567-191137589 CTGAGCAAAAAGAACAAAGCTGG + Intronic
943976915 2:194493655-194493677 CAGAGAAAAGAGAAGGAAGCTGG + Intergenic
944078931 2:195763201-195763223 CAGTGAAAACAGTAGTAAGGTGG + Intronic
944147154 2:196518142-196518164 CTTGAAAAACAGAAGAAAGGAGG - Intronic
944156026 2:196608829-196608851 CTTATAAGACAGAAGAAAGAGGG - Intergenic
944178482 2:196860887-196860909 CTGAGCAAAAAGAACAAAGCTGG + Intronic
944225784 2:197347446-197347468 CTCACAAGAGAGAAGAAAGGGGG - Intergenic
944810968 2:203327818-203327840 CTGAGAAAAATGAAGTCAGGTGG + Intergenic
945018241 2:205542880-205542902 CTGTGTAAACAAAAGAAATGTGG + Intronic
945110990 2:206359481-206359503 CTGAGTAAAAAGAACAAAGATGG + Intergenic
945160040 2:206880553-206880575 CTGAGAAAGGAGAACAAAGTTGG - Intergenic
945211145 2:207383604-207383626 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
945212100 2:207394437-207394459 CTGAGGTTACAGAAGGAAGGAGG + Intergenic
945479967 2:210334025-210334047 CTAAGCAAAAAGAAGAAAGCTGG + Intergenic
945845499 2:214939404-214939426 CTGAGCAAAAAGAACAAAGCTGG - Intronic
945891943 2:215439048-215439070 CTCAGAAAAATGAAGAAATGAGG - Intergenic
946099143 2:217303818-217303840 CTGAGAAGACAGAGGAAAACTGG + Intronic
946613020 2:221479411-221479433 CTGTGAAAACAGAGCAAAGATGG + Intronic
946617565 2:221526500-221526522 CTGAGCACACAGGAGAAAGGTGG - Intronic
946661167 2:222001426-222001448 ATGAGAAAGAAGAAAAAAGGAGG + Intergenic
946718797 2:222582230-222582252 CAGAGAAGTCAAAAGAAAGGAGG + Intronic
947040629 2:225915206-225915228 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
947102930 2:226640593-226640615 CTGAAAAAACTGAAGAATTGTGG + Intergenic
947346699 2:229199037-229199059 GTGAGGAAACAGAACAGAGGAGG - Intronic
947365096 2:229386020-229386042 CTAAGCAAACAGAACAAAGCTGG + Intronic
947440185 2:230113505-230113527 CTAAGCAAACAGAACAAAGCTGG - Intergenic
947871001 2:233437971-233437993 AAGAGAAGACAGCAGAAAGGTGG + Intronic
948245134 2:236476016-236476038 CTGAGCAAAAAGAACAAAGCTGG - Intronic
948324710 2:237104890-237104912 CTGAGCAAAGAGAACAAAGCTGG + Intergenic
948331829 2:237174144-237174166 TTGAAAAAGCAGAAGAAAGCTGG - Intergenic
948739670 2:240035531-240035553 CTGAACAAAAAGAACAAAGGTGG - Intergenic
948775073 2:240282734-240282756 CTGAGCAAAAAGAATAAAAGTGG + Intergenic
1169007002 20:2215974-2215996 CTGAAGAGAAAGAAGAAAGGGGG + Intergenic
1169165158 20:3416280-3416302 ATAAGAAAACAGAAGCCAGGCGG - Intergenic
1169225746 20:3855608-3855630 CTGAGAAATCTGAGGACAGGAGG - Intronic
1169234283 20:3917107-3917129 CTGAGAAAACAGACGTGATGGGG - Intronic
1169413510 20:5395120-5395142 CTAAGCAAAAAGAAGAAAGCTGG + Intergenic
1169648657 20:7842659-7842681 CTTAGAAGACAGAAGAAAGAGGG - Intergenic
1169695256 20:8380388-8380410 CTGAGCAAAAAGAACAAAGCTGG - Intronic
1169987770 20:11464986-11465008 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1170178295 20:13497685-13497707 CTAAGCAAAAAGAAGAAAGCTGG + Intronic
1170271919 20:14537064-14537086 AACAGAAAACAGAAGGAAGGGGG - Intronic
1170370664 20:15644467-15644489 GTAAGAAAACAGAAGGAAAGAGG - Intronic
1170384568 20:15801642-15801664 CTGAGCAAAAAGAACAAAGCTGG - Intronic
1170505841 20:17024959-17024981 CAGAGAAAGCAGAAGAAGGTGGG + Intergenic
1170831686 20:19848065-19848087 ATGAGAAAATAAAAGCAAGGGGG + Intergenic
1170996891 20:21370296-21370318 CTGAGCAAAAAGAACAAAGCTGG - Intronic
1171239953 20:23558494-23558516 AACAGAAATCAGAAGAAAGGAGG - Intergenic
1171293465 20:23995751-23995773 CAAAGAAAACAGAAGCATGGAGG - Intergenic
1171441587 20:25167738-25167760 CTTACAAACCAGAAGAAAGTGGG + Intergenic
1172351499 20:34246245-34246267 AAGAAAAAACAGAAGAGAGGTGG - Intronic
1172452586 20:35038028-35038050 CAGAGAAAAAAGCAGAATGGTGG + Intronic
1172489191 20:35320719-35320741 ATGGGAAAACAGAAGAAAGTTGG + Intronic
1172706075 20:36883000-36883022 ACGAGAACACAGAAGAAATGAGG - Intronic
1172782913 20:37447783-37447805 CAGAGGAAACAGGAGAAGGGTGG - Intergenic
1172879117 20:38187006-38187028 ATGAAAAATCAGCAGAAAGGGGG + Intergenic
1172955490 20:38755053-38755075 CTGAGGAGAAACAAGAAAGGCGG + Exonic
1173131233 20:40395616-40395638 GAGAGAAAACAGAAGATTGGAGG + Intergenic
1174027317 20:47588636-47588658 CTAAGAAAACTGAAGAAAAATGG - Intronic
1174286456 20:49477461-49477483 CTCAGAAAAAAAAAGAAAGTGGG + Intronic
1174695793 20:52556375-52556397 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1174772100 20:53309866-53309888 CCGAGGAAACAAAAGCAAGGAGG + Intronic
1175055572 20:56194415-56194437 CTGAGAAAAAAGAAAAAAGAGGG - Intergenic
1175430367 20:58897809-58897831 GTGAGGAAAAAGAAAAAAGGAGG - Intronic
1175669111 20:60886204-60886226 ATGAGAAAAAAGAATAAAAGAGG + Intergenic
1176333480 21:5573496-5573518 CTAAGCAAAAAGAACAAAGGTGG - Intergenic
1176394277 21:6247456-6247478 CTAAGCAAAAAGAACAAAGGTGG + Intergenic
1176467142 21:7068718-7068740 CTAAGCAAAAAGAACAAAGGTGG - Intronic
1176490703 21:7450496-7450518 CTAAGCAAAAAGAACAAAGGTGG - Intergenic
1176509939 21:7687887-7687909 CTAAGCAAAAAGAACAAAGGTGG + Intergenic
1176760170 21:10774321-10774343 CTGAGACAAAAGAACAAAGCTGG + Intergenic
1176884131 21:14233825-14233847 CTGACTATACAGAATAAAGGAGG + Intergenic
1176970013 21:15254103-15254125 CAGGGAAAACAGAGGAAAGGAGG + Intergenic
1177104575 21:16938649-16938671 CTGAGCAAAGAGAACAAAGCTGG - Intergenic
1177118325 21:17111470-17111492 CTAAGAAAAAAGAACAAAGCTGG + Intergenic
1177144960 21:17397664-17397686 TTAAAAAAAAAGAAGAAAGGAGG + Intergenic
1177279235 21:18957989-18958011 CTGAGCAAAAAGAGGAAAGCTGG + Intergenic
1177421883 21:20870094-20870116 CTGTTCAAACAGAAGCAAGGAGG - Intergenic
1177423342 21:20890707-20890729 CTGAGAAAAGAGTATAGAGGAGG - Intergenic
1177768323 21:25485031-25485053 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1177960755 21:27663154-27663176 CTGACAAAAAATAAGAAATGGGG + Intergenic
1177970475 21:27783422-27783444 CTGAGCAAACAGAACAAAACTGG + Intergenic
1178313170 21:31546599-31546621 CTGAGAAAAATGGAGAAGGGTGG + Intronic
1178333156 21:31718991-31719013 TTAAGAAAACAGAATATAGGTGG + Intronic
1178387629 21:32166489-32166511 CTCAAAAAACAGAAGGATGGAGG + Intergenic
1178579775 21:33828622-33828644 CAGAAAAAAAAGAAGAAAGAGGG - Intronic
1179083443 21:38195000-38195022 CTGAGCAAAAAGAATAAAGCTGG - Intronic
1179196375 21:39167043-39167065 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1179291746 21:40024133-40024155 CTGAGAAAAAACAAGCAATGGGG - Intronic
1179311088 21:40196708-40196730 AGGAGAAAACAGAAAAAAGCAGG - Intronic
1179473668 21:41629541-41629563 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1180078639 21:45475953-45475975 CTGAGAAAACACAGGAGGGGCGG + Intronic
1180123874 21:45773679-45773701 CTGAGCAAAAAGAACAAAGCTGG - Intronic
1180716877 22:17877837-17877859 CTCAAAAAAAAGAAGAAGGGAGG - Intronic
1180824521 22:18853467-18853489 CAAAGAAAACAGAAGCATGGAGG - Intronic
1181124943 22:20696622-20696644 CAAAGAAAACAGAAGCATGGAGG - Intergenic
1181188214 22:21121081-21121103 CAAAGAAAACAGAAGCATGGAGG + Intergenic
1181210982 22:21289412-21289434 CAAAGAAAACAGAAGCATGGAGG - Intergenic
1181316369 22:21973274-21973296 CTCAGAAAAAAAAAGAAATGGGG - Intronic
1181394784 22:22613378-22613400 ATTAGAAGACAGAAGACAGGAGG + Intergenic
1181398518 22:22637476-22637498 CAAAGAAAACAGAAGCATGGAGG + Intergenic
1181650897 22:24258584-24258606 CAAAGAAAACAGAAGCATGGAGG - Intergenic
1181706484 22:24652155-24652177 CAAAGAAAACAGAAGCATGGAGG + Intergenic
1181912475 22:26250603-26250625 CTGAGCAAAAAGAACAAAGCTGG - Intronic
1182402681 22:30092929-30092951 CTGAGCAAAAAGAACAAAGTTGG - Intronic
1182627071 22:31655312-31655334 CTGGGAAAAAAAAAAAAAGGGGG - Intronic
1183008543 22:34925289-34925311 CTTATAACCCAGAAGAAAGGAGG + Intergenic
1183148764 22:36020124-36020146 CTGACAAAAAACAAGAAATGGGG + Intronic
1183599110 22:38829817-38829839 CTTAGGAAACTGAGGAAAGGTGG - Intronic
1184268938 22:43366547-43366569 CTCAGAAAAAAAAAAAAAGGGGG - Intergenic
1185122352 22:48979509-48979531 ATGGGAAAGCAGCAGAAAGGGGG - Intergenic
1185417256 22:50717010-50717032 ATGAGAAAACTGAAGCAAGGAGG + Intergenic
1203215964 22_KI270731v1_random:6018-6040 CAAAGAAAACAGAAGCATGGAGG + Intergenic
1203274659 22_KI270734v1_random:79372-79394 CAAAGAAAACAGAAGCATGGAGG - Intergenic
949210427 3:1492502-1492524 CTCAGAAAACAGAGGATGGGAGG - Intergenic
949244847 3:1914938-1914960 CTAAGCAAAAAGAACAAAGGTGG - Intergenic
949250690 3:1980062-1980084 CTAAGAAAAAAGAACAAAGCTGG + Intergenic
949274721 3:2265507-2265529 CTGAGCAAAAAGAATAAAGCTGG - Intronic
949303819 3:2616690-2616712 CTAAGAAAAAAGAACAAAGCTGG + Intronic
949314323 3:2734726-2734748 CTGAGAAAAAAGAATAAAGTTGG - Intronic
949477033 3:4457448-4457470 TTGAGCAAAAAGAACAAAGGTGG + Intronic
949642337 3:6051468-6051490 TTGAGCAAAAAGAACAAAGGTGG + Intergenic
949709148 3:6854557-6854579 CTGTGAAAAGAAAAGAGAGGAGG - Intronic
950323076 3:12076261-12076283 CTGAGAAAATTCAAGAAATGTGG - Intronic
950366909 3:12492930-12492952 CTGAGGAAAGAGAGGAATGGGGG - Intronic
950383593 3:12638037-12638059 CTGAGTAAAGAGAAGAATGATGG - Intronic
950951230 3:17001797-17001819 CTGAGTAAAAAGAACAAAGCTGG - Intronic
950951491 3:17004591-17004613 ATGAGAAAAAAGAAGAAAAGGGG - Intronic
950956881 3:17063304-17063326 CTAAAAAAAAAGAAGGAAGGAGG - Intronic
951124885 3:18971732-18971754 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
951282362 3:20767774-20767796 CTGAGTAAAAAGAACAAAGCTGG - Intergenic
951324051 3:21281185-21281207 CTAAGAAAAAAGAACAAAGCTGG - Intergenic
951518022 3:23583370-23583392 CTAAGCAAAAAGAACAAAGGTGG - Intronic
951820923 3:26810866-26810888 CTAAGCAAAAAGAAGAAAGCTGG - Intergenic
951957328 3:28271638-28271660 CTAAGCAAAAAGAACAAAGGTGG - Intronic
951977420 3:28528261-28528283 CTAAGCAAAAAGAACAAAGGTGG - Intronic
951977656 3:28530897-28530919 CTGAGTAAAAAGAACAAAGCTGG + Intronic
952077613 3:29716451-29716473 ATTAGAAAAAAGAAGAAAGGAGG + Intronic
952250933 3:31653359-31653381 CTGACCAAAAAGAACAAAGGTGG + Intergenic
952275690 3:31873689-31873711 CTGAGAATAAAGAAGAAACACGG + Intronic
952295882 3:32061594-32061616 TTGAGAAAAAAGAAGAGAAGAGG + Intronic
952329655 3:32352518-32352540 TTGAGAAATCAGAGGAAAGAAGG + Intronic
952445142 3:33373815-33373837 CAGAGAAAACAAAAGACAGCTGG - Intronic
952490881 3:33871475-33871497 CTGAAAAAAAAAAAAAAAGGAGG + Intergenic
952514114 3:34086779-34086801 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
952685453 3:36142644-36142666 CTGAGCAAAAAGAATAAAGCTGG - Intergenic
952986075 3:38785181-38785203 CTAAGCAAAAAGAAGAAAGTTGG + Intronic
953052389 3:39357208-39357230 CTGAGCAAACAGAACAAAGCTGG + Intergenic
953220277 3:40964163-40964185 CTGAGCAAAAAGAAAAAAGCTGG - Intergenic
953447729 3:42981691-42981713 CTGAGAGAACGGGAGAAAGCTGG + Intronic
953525157 3:43683629-43683651 CTGAGACAAAAGAACAAAGCTGG + Intronic
954363137 3:50133001-50133023 CAGAGAAGAAAGAAGAAACGAGG - Intergenic
954499419 3:50996681-50996703 ATGAAAAAAGAGAAGAAAAGAGG + Intronic
954574371 3:51667464-51667486 CTGAGAAATCAAAAGGAAGTGGG - Exonic
954949334 3:54455991-54456013 CTGAGCAAAAAGAACAAAGCTGG - Intronic
955305299 3:57824690-57824712 CTGAGAAAGAAGAACAAAGTTGG - Intronic
955375451 3:58392176-58392198 CTGAGAAAACAGAACTAATGAGG + Intronic
955672650 3:61418151-61418173 ATGAGAAAACAGAGGCAGGGAGG + Intergenic
955756469 3:62229641-62229663 CTGAGAAATCCAAAGAAAGATGG - Intronic
956176450 3:66477677-66477699 GTGAGATAAAGGAAGAAAGGTGG - Intronic
956396143 3:68828140-68828162 CTGACAAAAAACAAGAAATGGGG - Intronic
956396254 3:68829276-68829298 CTGACAAAAAACAAGAAATGGGG + Intronic
956687527 3:71844058-71844080 GTGAGAGAACAGAGGAAAGGAGG - Intergenic
957395187 3:79627200-79627222 CTAAGCAAAAAGAACAAAGGTGG + Intronic
957438181 3:80207078-80207100 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
957535558 3:81498240-81498262 GTGGGAAAACAGTAGAAAGATGG + Intronic
957561501 3:81827735-81827757 CTGAGGAAAAAGAACAAAGCTGG - Intergenic
957748977 3:84387293-84387315 CTCAGAAAAAAAAATAAAGGTGG + Intergenic
957786709 3:84891638-84891660 CTGTGGAAACAAAAGACAGGAGG - Intergenic
957960053 3:87237387-87237409 CTGAGAACACAGCAAGAAGGTGG + Intronic
958073996 3:88652802-88652824 CAGAGTAATCAGTAGAAAGGGGG + Intergenic
958122512 3:89309838-89309860 TTGTGAAAAGAGAAGAAAGAAGG - Intronic
958467250 3:94473139-94473161 CTGAAAAAAAAAAAGAGAGGTGG + Intergenic
958536862 3:95414986-95415008 GAAAGAAAACAGAAGGAAGGAGG + Intergenic
958589005 3:96129634-96129656 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
958591175 3:96159955-96159977 CTAAGCAAAAAGAACAAAGGGGG + Intergenic
958613640 3:96460788-96460810 CTGAGCAAATAGAACAAAGCTGG + Intergenic
958618946 3:96531885-96531907 CTGAAAAAAAACAAGAAATGGGG + Intergenic
958687837 3:97423707-97423729 CTAAGAAAAAAGAACAAAGCTGG + Intronic
958719983 3:97832268-97832290 CTAAGGAAAAAGAAGAAAGCTGG + Intronic
958811947 3:98870382-98870404 CTGAGCAAACAAAAGAAATCTGG - Intronic
958812544 3:98878477-98878499 CTGAGAAAACATGATATAGGGGG + Intronic
958871300 3:99562228-99562250 AGGAGAGAACAGAAGAAAGGAGG - Intergenic
959307069 3:104680937-104680959 CTGAGAAAAAAGAACAAAACTGG + Intergenic
959404490 3:105943456-105943478 AGGAAAAAAAAGAAGAAAGGAGG + Intergenic
959523431 3:107346716-107346738 CTCAGAATACAGAAGTGAGGTGG + Intergenic
959601597 3:108192471-108192493 CTGAGAAAAAAGAAAAGAGTAGG - Intronic
959601741 3:108194539-108194561 CTGAGCAAAAAGAACAAAGCTGG + Intronic
960208239 3:114929264-114929286 CTGAAAAAACAGAAGCAGAGAGG + Intronic
960228472 3:115195670-115195692 CTGATGAAACAGAAGAGAGAAGG + Intergenic
961438797 3:126938350-126938372 CTGAGAAGACAGATGAAGAGCGG - Intronic
961501086 3:127336634-127336656 CTGAGAAAGACAAAGAAAGGGGG - Intergenic
962242026 3:133757720-133757742 ATGGCAACACAGAAGAAAGGAGG - Intronic
962463882 3:135639160-135639182 ATGAGAAAATAGAAAAAAGAGGG + Intergenic
962496066 3:135940051-135940073 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
962665821 3:137652519-137652541 CTGAAAAAAAACAAGAAATGGGG + Intergenic
962823481 3:139076002-139076024 CTGAGCAAAAAGAACAAAGTTGG + Intronic
962909757 3:139837141-139837163 CTGCGAAAACAGAAATCAGGTGG - Intergenic
962981585 3:140495905-140495927 CTAAGAAAAAAGAATAAAGCTGG - Intronic
963027882 3:140938051-140938073 CTAAGAAAAAAGAACAAAGCTGG + Intergenic
963033816 3:141006797-141006819 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
963258076 3:143166199-143166221 CGGAGAAAAAGAAAGAAAGGAGG - Intergenic
963493434 3:146030046-146030068 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
963701790 3:148635889-148635911 CTGAGCAAAAAGAACAAAAGTGG + Intergenic
964002794 3:151796122-151796144 CTAAGAAAAGAAAAGAAAAGGGG + Intergenic
964114808 3:153124693-153124715 CTGAGTAAAAAGAACAAAGCTGG - Intergenic
964139820 3:153384835-153384857 CAGAAAAAACAGAAGCAAGCAGG + Intergenic
964148174 3:153491542-153491564 CTGAGCAAAAAGAACAAAGCTGG + Intronic
964296134 3:155235499-155235521 CTAAGCAAAAAGAAGAAAGCGGG - Intergenic
964334994 3:155645640-155645662 CTGAAAAAAAAGAAAAAAGCTGG - Intronic
964456249 3:156870146-156870168 CTGAGCAAAAAGAACAAAGCTGG - Intronic
964537569 3:157740361-157740383 CTGAGAAAAAAGAACAAAACTGG - Intergenic
964844773 3:161033390-161033412 CTAAGCAAACAGAACAAAGCTGG + Intronic
964883705 3:161454710-161454732 CTGAGTAAACAGAACAAATAGGG + Intergenic
965117368 3:164508486-164508508 GAGAGAAAACAGAAGAAAGAAGG - Intergenic
965174033 3:165307583-165307605 CTGAGCAAAAAGAAGACAGCTGG + Intergenic
965274225 3:166660050-166660072 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
965332276 3:167390424-167390446 CTAAGCAAAAAGAAGAAAGCTGG - Intergenic
965452205 3:168852045-168852067 CTGAGCAAAAGGAACAAAGGAGG - Intergenic
965854421 3:173071011-173071033 CTGAGAAAAAACAATAAAGCTGG + Intronic
965867600 3:173224686-173224708 CTGAGTAAACACAAGAGAGCAGG - Intergenic
965956149 3:174372555-174372577 CTGAGCAAAAAGAAAAAAGCTGG + Intergenic
965970448 3:174548745-174548767 CTCAGGTAACTGAAGAAAGGAGG - Intronic
966026881 3:175294979-175295001 ATGAGAAAACAGAAGCATAGAGG - Intronic
966133307 3:176669105-176669127 CTGAGAAAAAAGAACAAAGCTGG - Intergenic
966138189 3:176725041-176725063 CTGAGTAAAAAGAACAAAGCTGG - Intergenic
966141538 3:176762619-176762641 AAGAGAAAACAGAAAAAAAGGGG + Intergenic
966296118 3:178425723-178425745 CTGAGCAAAAAGAATAAACGTGG - Intronic
966346340 3:178984808-178984830 CTAAGCAAACAGAACAAAGCTGG - Intergenic
966395024 3:179493621-179493643 ATGAGAAGAGAGAGGAAAGGAGG + Intergenic
966441732 3:179952801-179952823 CTAAGCAAAAAGAAGAAAGCTGG + Intronic
966664593 3:182457056-182457078 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
967189500 3:186973330-186973352 CTCAGAAAACAGAAGAGGGCCGG - Intronic
967222860 3:187262830-187262852 CTGAGAAACCCAAAGAAAGGAGG + Intronic
967393895 3:188984969-188984991 AGGAGAAAAAAGAAGAAAGTGGG - Intronic
967524757 3:190478324-190478346 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
967560606 3:190914082-190914104 CTGAGCAAAAAGAATAAAGCTGG - Intergenic
967619118 3:191610557-191610579 CTAAGCAAAAAGAAGAAAGCTGG - Intergenic
967900196 3:194442038-194442060 ATGAGAAAACTGAAGCAGGGTGG + Intronic
967944328 3:194790958-194790980 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
968336175 3:197915617-197915639 ATGTAAAAAGAGAAGAAAGGCGG - Intronic
968387329 4:153354-153376 CTGAGCAAAAAGAATAAAGCTGG - Intronic
968902006 4:3436312-3436334 CTGAGAACACGGCAGGAAGGGGG - Intronic
969130704 4:4989291-4989313 CTGAGACAGCAAAAGAAAGAAGG - Intergenic
969680326 4:8639747-8639769 CAGAGAAAACAGAGGCCAGGAGG - Intergenic
969974645 4:11086007-11086029 CTGACCAAACAGATGAATGGAGG - Intergenic
970310127 4:14773818-14773840 CTAAGAAAAAAGAACAAAGCTGG + Intergenic
970379962 4:15497112-15497134 CTAAGCAAAAAGAAGAAAGCTGG + Intronic
970416115 4:15858624-15858646 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
970693651 4:18648671-18648693 CTGAGGAAAAAGAACAAAGCTGG + Intergenic
970717230 4:18940548-18940570 GTGAGGAAACAGCAAAAAGGTGG - Intergenic
970903179 4:21183908-21183930 CTGAGAAGGGAGAGGAAAGGAGG - Intronic
970931677 4:21519013-21519035 CTGAGCAAACCGAAGAAAATGGG + Intronic
971005579 4:22370619-22370641 CTGAGTAAACAGAACAAAGCTGG + Intronic
971018065 4:22508914-22508936 TTGAGAAAATAGAAGCAACGGGG + Intronic
971106717 4:23533846-23533868 GTGAGAACACAGCAGTAAGGTGG - Intergenic
971219852 4:24694980-24695002 TTGAGAAACAAGAAGAAAAGGGG - Intergenic
971497886 4:27287304-27287326 ATAAGAAAAAAGAAGAAAGAAGG + Intergenic
971593071 4:28493924-28493946 CTAAGCAAACAGAAGAAAGCTGG + Intergenic
971654009 4:29318081-29318103 CTGACAAAAAACAAGAAATGAGG - Intergenic
971950285 4:33335855-33335877 CTAAGCAAAAAGAAGAAAGCTGG - Intergenic
972096450 4:35352458-35352480 CTGAGAAATAAGAAAATAGGTGG - Intergenic
972128209 4:35797197-35797219 CTGAGCAAAGAGAACAAAGCTGG + Intergenic
972147741 4:36049053-36049075 CTGAGAAAGAAGAACAAAGCTGG - Intronic
972177958 4:36430648-36430670 CTGAGAAAAAAGAACAAAGCTGG + Intergenic
972372030 4:38433636-38433658 CTAAGCAAACAGAACAAAGCTGG - Intergenic
972640245 4:40918737-40918759 CAGAGAAAAAATAAGGAAGGAGG - Intronic
972837031 4:42883920-42883942 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
972901351 4:43687947-43687969 CAAACAAAACAGAAGACAGGTGG + Intergenic
972995760 4:44877861-44877883 CTGAGAAAGTAGCAGAAAAGGGG - Intergenic
973563344 4:52159094-52159116 AAGAGAAAAGAAAAGAAAGGAGG - Intergenic
973592291 4:52454721-52454743 CTAAGAAAAAAGAACAAAGCTGG - Intergenic
973636521 4:52866203-52866225 AAGAGAAAAAAGAAAAAAGGGGG - Exonic
973686143 4:53371768-53371790 CTGAGAATACAGCACAAAGGTGG - Intergenic
973769282 4:54191788-54191810 CTGAGCAACCAGAAGAATGCAGG + Intronic
974241746 4:59258417-59258439 CCTAGAAAAAAGAATAAAGGTGG + Intergenic
974243149 4:59278668-59278690 CTGAGTAAAAAGAAGACAGCTGG + Intergenic
974284508 4:59846676-59846698 CTGACAAAAAACAAGAAATGGGG + Intergenic
974314098 4:60255311-60255333 CTGAGAAAATAGAAGGTAGTTGG - Intergenic
974551632 4:63382309-63382331 CTGACAAAAAAAAAGAAATGGGG + Intergenic
974745773 4:66073817-66073839 AAGAGAAAAGAGAAGAAAGCAGG - Intergenic
974876226 4:67706428-67706450 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
974918500 4:68206871-68206893 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
975030871 4:69614521-69614543 CTGAGCAAAAAGAACAAAGTTGG + Intronic
975093371 4:70428504-70428526 CTGACAAAAAAAAAGAAATGGGG + Intergenic
975304027 4:72826892-72826914 CTAAGCAAAAAGAAGAAAGCTGG + Intergenic
975532028 4:75409871-75409893 CTGAGCAAAAAGAAAAAAGCTGG - Intergenic
975691571 4:76969700-76969722 CTGAGTAAACACAACCAAGGAGG + Intronic
975877545 4:78860739-78860761 CTAAGAAAAAAGAAGGAATGTGG + Intronic
976024293 4:80668743-80668765 CTGAGCAAAAAGAACAAAGCTGG - Intronic
976025749 4:80686318-80686340 CTTAGAGAGCAGAAGAAGGGAGG + Intronic
976363576 4:84208294-84208316 CTAAGCAAAAAGAAGAAAGCTGG + Intergenic
976398349 4:84582110-84582132 AAGAGAAAAAAGAAAAAAGGCGG - Intergenic
976527449 4:86110674-86110696 CTAAGCAAAAAGAAGAAAGCTGG - Intronic
976833488 4:89342749-89342771 CTGAGAAAAAAGAACAAAGCTGG - Intergenic
976944463 4:90747480-90747502 CAGAGAAAAAAAAAGAGAGGTGG + Intronic
977037739 4:91976393-91976415 CTGAGGAGAGAGGAGAAAGGAGG - Intergenic
977116710 4:93037879-93037901 CTAATAAAAAAGAAGAAAGCTGG - Intronic
977342512 4:95776580-95776602 CTGAGCAAAAAGAAAAAAGCAGG + Intergenic
977407941 4:96623825-96623847 CTGAGAAAGAAGAACAAAGCTGG - Intergenic
977508339 4:97930619-97930641 CTAAGCAAAAAGAACAAAGGTGG - Intronic
977520367 4:98075158-98075180 CTGGGAAGACAGAAAACAGGAGG - Intronic
977537891 4:98277553-98277575 CTAAGAAGACAGAAGAAAACAGG - Intronic
977545351 4:98370473-98370495 TGGAGAAAAAAGGAGAAAGGAGG - Intronic
977588982 4:98805772-98805794 CTGACAAAAAACAAGAAATGGGG + Intergenic
977629701 4:99228566-99228588 CTAAGCAAACAGAACAAAGCTGG - Intergenic
977915825 4:102591652-102591674 CTGAGAAAAAAGAAAAAAAAAGG + Intronic
978010606 4:103677879-103677901 ATAAGAAAAAAGAAAAAAGGTGG + Intronic
978020162 4:103799016-103799038 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
978130567 4:105191198-105191220 CTGAAAATACAAAAGAAAGAGGG + Intronic
978137836 4:105284209-105284231 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
978208613 4:106109324-106109346 CTAAGCAAAAAGAAGAAAGCTGG + Intronic
978215876 4:106202323-106202345 ATAAGAAAACAGAAGAATGATGG + Intronic
978249690 4:106615564-106615586 CTTTGTAAACAGAAGAAAAGAGG + Intergenic
978252163 4:106644514-106644536 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
978758000 4:112324957-112324979 CTGAGGAACCAAAAAAAAGGGGG + Intronic
978857091 4:113405505-113405527 CTGGGAAAAGAGAAGAAACCAGG - Intergenic
978929329 4:114291713-114291735 CTAAGCAAAAAGAACAAAGGTGG + Intergenic
978980017 4:114933021-114933043 TTGAGAAACAAGAAGAAAGCTGG + Intronic
979046178 4:115868361-115868383 CTAAGAAAAAAGAACAAAGTTGG - Intergenic
979141261 4:117177858-117177880 CTAAGCAAAAAGAAGAAAGCTGG - Intergenic
979148738 4:117280001-117280023 CTAAGCAAAAAGAAGAAAGCTGG - Intergenic
979338024 4:119486242-119486264 CTAAGCAAAAAGAAGAAAGCTGG + Intergenic
979431609 4:120639394-120639416 CTGAGAGAACACAGCAAAGGAGG - Intergenic
979458163 4:120949764-120949786 CTAAGCAAAAAGAACAAAGGTGG + Intergenic
979493223 4:121354150-121354172 CCGAGCAAAAAGAACAAAGGTGG - Intronic
980035048 4:127873499-127873521 TTGAGCAAAAAGAAGAAAGCTGG + Intergenic
980147837 4:129011548-129011570 CTAAGCAAAAAGAAGAAAGCTGG - Intronic
980253808 4:130350339-130350361 AGGAGAAAACAGAGGAAAGAGGG - Intergenic
980297246 4:130937405-130937427 CTGAGAAAAAAGAACAAAGCTGG - Intergenic
980305721 4:131059375-131059397 CATAGAAAACTGAGGAAAGGGGG - Intergenic
980432573 4:132723258-132723280 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
980694981 4:136342746-136342768 CTAAGAAAAAAGAACAAAGCTGG + Intergenic
980882766 4:138729935-138729957 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
980941517 4:139279643-139279665 CTGAGGAAGCAGAGGAACGGTGG - Intronic
981163220 4:141523891-141523913 CTGAGAAAAAAGAACAAAACTGG + Intergenic
981235678 4:142412669-142412691 CAGAGAATACAGAAGAAAGATGG - Intronic
981273491 4:142871059-142871081 CTAAGCAAAAAGAACAAAGGTGG + Intergenic
981428018 4:144626309-144626331 TTGAGAAGACAGCAGAAAGTAGG + Intergenic
981439101 4:144761951-144761973 CTAAGAAAAAAGAACAAAGCTGG + Intergenic
981752545 4:148106563-148106585 CTAAGAAAAAAGAAAAAAGTTGG + Intronic
981851220 4:149232488-149232510 CTGAGCAAAGAGAACAAAGCTGG + Intergenic
982016230 4:151156373-151156395 CTGAGCCAAAAGAACAAAGGTGG + Intronic
982323081 4:154100623-154100645 CTGAGGAAAAAGAACAAAGCTGG - Intergenic
982336777 4:154248636-154248658 CTAAGTAAAAAGAAGAAAGCCGG + Intronic
982572748 4:157070932-157070954 ATGAGAAGAGAGAAGAAATGTGG - Intergenic
982584554 4:157221069-157221091 CCCATAAAACAGGAGAAAGGAGG - Exonic
982674272 4:158357926-158357948 CTGAGCAAAAAGAACAAAGCTGG + Intronic
982872133 4:160593720-160593742 CTGAGAAAATAGAAGTAATCTGG - Intergenic
983017632 4:162633740-162633762 CTGAGCAAACAGAACAAAACTGG + Intergenic
983066606 4:163217417-163217439 AAGAGGAAACTGAAGAAAGGAGG - Intergenic
983521902 4:168717861-168717883 ATGAGAACACAGAAGAAATGAGG - Intronic
983625275 4:169796026-169796048 CTCAAAAAACAAAACAAAGGTGG - Intergenic
983669728 4:170222132-170222154 CTGAGCAAAGAGAACAAAGCTGG + Intergenic
983879482 4:172916947-172916969 CTGAGCAAAAAGAACAAAGCTGG + Intronic
983985226 4:174051622-174051644 CTAAGAAAAAAGAACAAAGCTGG + Intergenic
984018309 4:174452685-174452707 CTGATAAAAGAGAAGAAAACAGG + Intergenic
984019173 4:174464143-174464165 CAAATAAACCAGAAGAAAGGAGG + Intergenic
984079038 4:175219840-175219862 CTGAGAAAGAAAAAGAAAGCTGG - Intergenic
984100696 4:175481985-175482007 ATGTGAAAACAGAGGAAAGATGG - Intergenic
984319269 4:178170797-178170819 CTGACAAAAGACAAGAAATGGGG + Intergenic
984324805 4:178238882-178238904 TTGAGAAAAAAGAAAAAAGCTGG + Intergenic
984472125 4:180189679-180189701 GAGAGAAAACAGAAGAAAATAGG + Intergenic
984473201 4:180203482-180203504 CTGAGAAAAGAGTAGGAGGGAGG + Intergenic
984476312 4:180239176-180239198 CTGAGAAAAAACAAGCAATGGGG + Intergenic
984949970 4:185000843-185000865 TGGAGAAAGGAGAAGAAAGGTGG - Intergenic
985151503 4:186951862-186951884 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
985367847 4:189252097-189252119 CTAAGAAAAGAGAACAAAGCTGG + Intergenic
985442266 4:189991084-189991106 CTGACAAAAAACAAGAAATGGGG - Intergenic
985751339 5:1678761-1678783 CTGAGCAAAAAGAAGGAAGCTGG - Intergenic
985831211 5:2232854-2232876 CTGAGCAAAAAGAACAAAGTTGG + Intergenic
986113391 5:4743717-4743739 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
986392091 5:7296659-7296681 CTGAGACAAAAGTAGAATGGTGG - Intergenic
986403913 5:7406570-7406592 CACATAAAACAGAAGAAAAGGGG - Intronic
986515637 5:8560387-8560409 TTCAGAAAATAGAAGAAAGGGGG - Intergenic
986754806 5:10825347-10825369 CTGAGAAAAAAGAACAAAACTGG + Intergenic
986761963 5:10888371-10888393 CTGAGAAATCAGGAGAGAGATGG - Intergenic
986886692 5:12246521-12246543 ATGGGAAAACAGAAGACAGATGG + Intergenic
987183864 5:15395513-15395535 CTGAGAAAATGGAAGACATGGGG - Intergenic
987189426 5:15459214-15459236 CTGAGCAAACAGAACAAAGCAGG - Intergenic
987236467 5:15947113-15947135 CTGCTAAGACAGAAGAATGGTGG - Intergenic
987249954 5:16089871-16089893 GTGAGAAAACAGAAGTATGGAGG + Intronic
987261627 5:16210202-16210224 CTGAGAAAACAGACACAAGGAGG + Intergenic
987304317 5:16623447-16623469 CAGAGAAAGCTGAAGAAAGCAGG - Intergenic
987615390 5:20267374-20267396 CTGAGGAAAAAGAACAAAGCTGG - Intronic
987665150 5:20927688-20927710 CTGAGCAAAAAGAAGAAAGATGG - Intergenic
987793077 5:22593408-22593430 CAGGGAAAACAGGAGAAAGAAGG - Intronic
987910127 5:24132341-24132363 GAGAGAAGAAAGAAGAAAGGAGG + Intronic
987995592 5:25273685-25273707 TTGAGTAAAGAGAAGAAAGGTGG + Intergenic
988172680 5:27680084-27680106 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
988345651 5:30035037-30035059 CTCAGAAGACAGAAGAAATATGG + Intergenic
988455950 5:31387421-31387443 CGGAGAAAACAGGAGGATGGAGG + Intergenic
988717501 5:33842638-33842660 CTGGAAAAACAGAGGAAAGTGGG + Intronic
988757537 5:34274494-34274516 CTGAGCAAAAAGAAGAAAGATGG + Intergenic
988880084 5:35492774-35492796 CTGAGAAAAAAAATGCAAGGAGG - Intergenic
989008401 5:36841324-36841346 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
989018077 5:36964299-36964321 CTGAGGAAAAAGAAAAAAGCTGG + Intronic
989112745 5:37922969-37922991 CTGAGAACTCAGAAGGAAGAAGG - Intergenic
989234419 5:39129025-39129047 CTGAGCAAAAAGAATAAAGCTGG + Intronic
989239755 5:39190308-39190330 ATGAGAAAGAAGAAGAAAGTGGG + Intronic
989364349 5:40638962-40638984 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
989673816 5:43950770-43950792 CTGAAAGAATAGAAGGAAGGAGG + Intergenic
989692849 5:44166141-44166163 CTAAGCAAAAAGAAGAAAGCAGG - Intergenic
989762952 5:45041806-45041828 TTGAAAAAATATAAGAAAGGGGG + Intergenic
989784287 5:45308807-45308829 CTAAGAAAAAAGAACAAAGCTGG - Intronic
989805440 5:45598115-45598137 CTAAGAAAAAAGAACAAAGCTGG + Intronic
989991566 5:50773598-50773620 CTGAGCAAAAAGAACAAAGCTGG - Intronic
989994002 5:50805287-50805309 CATAGTTAACAGAAGAAAGGAGG + Intronic
990068715 5:51751703-51751725 TTGAGAAAAAAGAACAAAGCTGG + Intergenic
990237562 5:53784204-53784226 ATGAGAGAAAAGAAGAAAGAAGG - Intergenic
990289811 5:54338321-54338343 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
990505712 5:56442662-56442684 GTGAGGAAACAGCAAAAAGGTGG - Intergenic
990788260 5:59447886-59447908 CTGAGAAGGCAGAAGAAATTGGG - Intronic
990859963 5:60315928-60315950 CTAAGCCAACAGAAGAAAGCTGG - Intronic
990870392 5:60425233-60425255 CTAAGCCAACAGAAGAAAGCTGG + Intronic
990940317 5:61196309-61196331 CTAAGCAAAAAGAAGAAAGCTGG - Intergenic
990951833 5:61305961-61305983 ATGAGAAAACAGAGGGATGGGGG - Intergenic
990975212 5:61554558-61554580 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
991121380 5:63018761-63018783 CTAAGAAAAAAGAACAAAGCTGG - Intergenic
991177030 5:63701017-63701039 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
991394811 5:66193098-66193120 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
991459712 5:66845023-66845045 CTGAGGCACAAGAAGAAAGGAGG + Intronic
991577947 5:68124373-68124395 ATGAAAAAACAGAAAAAAGCAGG + Intergenic
991596822 5:68315054-68315076 ATTAGGAAACAGGAGAAAGGTGG + Intergenic
991627177 5:68615466-68615488 CTGAGCAAAAAGAACAAAGTTGG + Intergenic
992026803 5:72678090-72678112 CTGAGGAAAAAGAACAAAGCTGG - Intergenic
992121095 5:73593344-73593366 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
992459452 5:76946390-76946412 TTGAGAAGATTGAAGAAAGGGGG - Intergenic
992741104 5:79774412-79774434 CTGAGGAAACAGCAGAACGGTGG - Intronic
992741255 5:79775519-79775541 AAGAGAAAACAGGAGAGAGGGGG + Intronic
992834207 5:80624204-80624226 CTGGCCAAACAGAAGAAAGAAGG - Intergenic
993242729 5:85411798-85411820 CTAAGAAAAAAGAACAAAGCTGG - Intergenic
993313780 5:86373435-86373457 CTAAGAAAAAAGAACAAAGTTGG + Intergenic
993341752 5:86732521-86732543 CTGAGCCAAAAGAACAAAGGTGG - Intergenic
993367620 5:87052484-87052506 CTGAGCAAACAGAACAAAGAAGG + Intergenic
993494394 5:88591290-88591312 CTAAGAAAAAAGAACAAAGCTGG + Intergenic
993791315 5:92215057-92215079 CTAAGTAAAAAGAAGAAAGCTGG - Intergenic
993923622 5:93838438-93838460 ATAAGCAAACAGAACAAAGGTGG - Intronic
994016738 5:94975429-94975451 CTGAGCACACAGCAGGAAGGTGG + Intronic
994053261 5:95386483-95386505 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
994155832 5:96503472-96503494 AAAAGAAAAGAGAAGAAAGGGGG + Intergenic
994368831 5:98946612-98946634 CTGGGAAAACAGAAAAAAGCTGG - Intergenic
994835735 5:104849931-104849953 CTAAGCAAAAAGAAGAAAGCTGG - Intergenic
994966494 5:106679363-106679385 CTAAGCAAACAGAACAAAGCTGG - Intergenic
995263451 5:110132362-110132384 CTAAGAAAAAAGAACAAAGCTGG - Intergenic
995448202 5:112270240-112270262 CTGAGAAAACTGAAGGATGTAGG + Intronic
995453700 5:112330591-112330613 ATGAGAAAACTGAGGAATGGGGG + Intronic
995535727 5:113134511-113134533 CTGAGCAAAAAGAACAAAGCTGG - Intronic
995664431 5:114525301-114525323 CTAAGAAAAAAGAACAAAGCTGG + Intergenic
995701116 5:114937075-114937097 CTGAGAAAAGGGAAGAAGGCAGG + Intergenic
995715191 5:115075693-115075715 CTAAGAAAAAAGAACAAAGCTGG + Intergenic
995812408 5:116122423-116122445 CTGAGCAAAAAGAACAAAGCTGG - Intronic
995865090 5:116681840-116681862 CTGAAAACACCGAAGAAACGAGG - Intergenic
996083106 5:119276630-119276652 GTGAGAATACAGCAGAAATGTGG - Intronic
996269761 5:121589088-121589110 TTGAGAAAAAAGAACAAAGCTGG + Intergenic
996317692 5:122179000-122179022 CTGAGAAAAAATAAGCAATGGGG - Intronic
996468377 5:123830253-123830275 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
996506381 5:124272177-124272199 AAGAGAAAATAGAAGAAAGGAGG + Intergenic
996521535 5:124432264-124432286 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
996630484 5:125625655-125625677 CTGACAAAAAACAAGAAATGGGG + Intergenic
996641987 5:125766231-125766253 CTAAGCAAAAAGAACAAAGGTGG - Intergenic
996786741 5:127245334-127245356 CTGACAAAACACAAGGAATGGGG + Intergenic
996872260 5:128204359-128204381 GGGAGTAAACAGAAGAAATGGGG - Intergenic
997053218 5:130407857-130407879 CTAAGAAAAAAGAACAAAGCCGG - Intergenic
997391388 5:133520092-133520114 CTGAGAAAGGAGAAGAAAAGAGG - Intronic
997529769 5:134574766-134574788 GTGAATAAACAGAAGATAGGGGG - Intronic
997769081 5:136536380-136536402 CAAAGAAAATAGTAGAAAGGAGG - Intergenic
997782184 5:136670259-136670281 CTGAGCAAAAAGAACAAAGTTGG + Intergenic
998209371 5:140182790-140182812 CTATGAAAACAGAAGAAAGGGGG + Intronic
998223878 5:140311136-140311158 CTGAAAAGACAGAAAAAAAGGGG + Intergenic
998248031 5:140527035-140527057 GTCAGAAAAGAGAAGAAGGGTGG + Exonic
998387267 5:141764675-141764697 ATGAGAAAACAGAAGCAGAGAGG - Intergenic
998676224 5:144411234-144411256 CTGAGTAAAAAGAACAAAGCTGG + Intronic
998755222 5:145370563-145370585 CTAAGAAAAAAGAACAAAGCTGG - Intergenic
998894346 5:146782807-146782829 GAGAGGAAACAGAAGAAAGAAGG + Intronic
998908963 5:146937298-146937320 CTCAGAAAAAAAAAAAAAGGGGG + Intronic
999416501 5:151401466-151401488 CTGAGCAAAAAGAAAAAAGGTGG - Intergenic
999493023 5:152070339-152070361 TTGAAAAAACAGAAGGAAGCAGG - Intergenic
999581448 5:153042837-153042859 CTAAGCAAACAGAACAAAGGTGG - Intergenic
999651106 5:153768243-153768265 GTGAGAAAGAAGAAGAAAGAAGG - Intronic
999688798 5:154127220-154127242 CTAAGCAAAAAGAAGAAAGCTGG + Intronic
999903300 5:156111099-156111121 ATGAGAAAAAAGAAGAGAGGAGG + Intronic
1000004649 5:157172083-157172105 CTGAAAAAACAGAAGAAAACAGG + Intronic
1000498336 5:162014623-162014645 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1000693231 5:164348441-164348463 CACAGAAACCAGAAGAAAAGTGG - Intergenic
1000745204 5:165024421-165024443 CTGATAAAACTGAATAATGGTGG - Intergenic
1001090024 5:168732520-168732542 CTGAGCAAAAAGAACAAAGCTGG + Intronic
1001571700 5:172734389-172734411 CTAAGAAAACAGATGAAGAGGGG + Intergenic
1001815311 5:174663824-174663846 CTGAAATAAAAGAAGGAAGGAGG - Intergenic
1003156301 6:3598490-3598512 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1003219780 6:4149054-4149076 CTGAGAAAAAAGAACAAAACTGG - Intergenic
1003237659 6:4311676-4311698 CTGAGCAAAAAGAGCAAAGGTGG + Intergenic
1003491835 6:6629004-6629026 TTGATAAAACAGAAGAGAGATGG + Intronic
1003656367 6:8014097-8014119 CTGAGATAACACAAGAGAGCTGG + Exonic
1003945306 6:11070127-11070149 ATGAGAGAGCAGAGGAAAGGGGG + Intergenic
1003954546 6:11149678-11149700 CCCAGGAAACAGAAGAAAGGTGG - Intergenic
1004240430 6:13916388-13916410 CTGAGGCAACAGAGGAAGGGAGG - Intergenic
1004429837 6:15533396-15533418 CTGAGGAAACAGAATAACTGGGG + Intronic
1004586614 6:17008144-17008166 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1004611498 6:17245438-17245460 CTAAGCAAAGAGAACAAAGGTGG + Intergenic
1004795403 6:19077788-19077810 CTGAGCAAAAAGAACAAAGCAGG + Intergenic
1004946885 6:20624979-20625001 CTCAGAAAACAGATGAAGAGAGG - Intronic
1005159391 6:22841511-22841533 CTGAGAAAAAAGAATACAGCTGG + Intergenic
1005436845 6:25821228-25821250 GAGAGAAAAAAGAAGAATGGAGG - Intronic
1005651550 6:27889784-27889806 CTGGGAAAACAGATTATAGGAGG - Intergenic
1006206003 6:32343506-32343528 CGGAAAAGACAGGAGAAAGGTGG - Intronic
1006213166 6:32414587-32414609 GAAAGAAAAGAGAAGAAAGGAGG + Intergenic
1006280368 6:33047772-33047794 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1006292246 6:33147293-33147315 TTGGTAAAACAGAAGAAAGCAGG + Intergenic
1006308801 6:33242595-33242617 AAGAGAAGAAAGAAGAAAGGAGG + Intergenic
1006553481 6:34845292-34845314 CTGAGCAAAGAGAAGAAAACTGG - Intronic
1006999222 6:38293368-38293390 CTAAGAAAAAAGAACAAAGCTGG + Intronic
1007013351 6:38438863-38438885 CTGAGAAAACGGAATAGAAGTGG + Intronic
1007025685 6:38570567-38570589 ATCAGAAAACAGAAGAAAAGAGG - Intronic
1007184399 6:39956010-39956032 TTGAGAAACAAGAAGAAAGTTGG + Intergenic
1007756842 6:44104998-44105020 CAGAAAAAGCAGAAGAAATGTGG + Intergenic
1008069040 6:47080540-47080562 GTGAGAACACAGTAAAAAGGTGG - Intergenic
1008262392 6:49382697-49382719 CTAAGCAAAAAGAAGAAAGTTGG - Intergenic
1008265886 6:49425790-49425812 CAGAGAAAAAAGTAGAATGGTGG - Intergenic
1008302983 6:49865557-49865579 TTGTGAAAACAAAAGGAAGGTGG + Intronic
1008347980 6:50453100-50453122 AGGAGAAAAGAAAAGAAAGGAGG + Intergenic
1008352093 6:50504096-50504118 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1009030581 6:58052911-58052933 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1009357405 6:62768240-62768262 CTGAGAAAATAGAACAAAGCTGG + Intergenic
1009845794 6:69133067-69133089 CTAAGAAAAAAGAACAAAGCTGG - Intronic
1009858939 6:69299823-69299845 CTGAACAAAAAGAAGAAAGCTGG - Intronic
1009950736 6:70392795-70392817 CAGAGATAAAATAAGAAAGGAGG + Intergenic
1009991461 6:70847573-70847595 ATGAGCAAACAGAAGAAATTAGG - Intronic
1010008217 6:71019745-71019767 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1010019964 6:71147988-71148010 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1010158877 6:72828170-72828192 CTGAGCAAAAAGAACAAAGATGG - Intronic
1010170584 6:72970725-72970747 CTGACAAAAAACAAGAAATGGGG + Intronic
1010484675 6:76395593-76395615 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1010539918 6:77080327-77080349 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1010653408 6:78481367-78481389 CTGAGAGAGAAGCAGAAAGGAGG - Intergenic
1010849517 6:80754821-80754843 CTGAGCAAAAAGAAGGAAGGTGG - Intergenic
1010961437 6:82150563-82150585 CTGAGCAAAGAGAACAAAGCTGG + Intergenic
1011103611 6:83753341-83753363 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1011116812 6:83902461-83902483 CTGAGCAAAAAGAACAAAGATGG - Intronic
1011147822 6:84238195-84238217 CTAAGCAAAAAGAACAAAGGTGG + Intergenic
1011236588 6:85225054-85225076 TTGAGAAAGAAGAACAAAGGTGG + Intergenic
1011294434 6:85810954-85810976 CTCAGAATCCAGGAGAAAGGAGG + Intergenic
1011324283 6:86131953-86131975 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1011539093 6:88411065-88411087 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1011815042 6:91179562-91179584 CTGTAAAAACAGTACAAAGGAGG - Intergenic
1011887283 6:92112256-92112278 CTGAGATAACAAAACAAATGAGG + Intergenic
1011969650 6:93207212-93207234 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1012135942 6:95555900-95555922 CTAAGCAAAAAGAAGAAAGCTGG - Intergenic
1012638043 6:101571930-101571952 CTTACAAAACAGAAAAAAGGTGG + Intronic
1012688727 6:102286993-102287015 CTAAGCAAAAAGAAGAAAGCTGG + Intergenic
1012770580 6:103428413-103428435 CTAAGAAAAATGAAGAAAGCTGG + Intergenic
1012787222 6:103646411-103646433 CTAAGAAAAAAGAACAAAGCTGG + Intergenic
1012799471 6:103806535-103806557 CTAAGCAAAAAGAACAAAGGTGG + Intergenic
1012922023 6:105229987-105230009 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1012931957 6:105326785-105326807 CAGAGAAAAGAGAAAAATGGAGG + Intronic
1013017241 6:106170999-106171021 CTCAGAAAACAAAAGGAAGGGGG + Intergenic
1013029091 6:106313119-106313141 CTGAGAAGGCAGAAGATAGAGGG + Intronic
1013055871 6:106582423-106582445 CTAAGAATACAGCTGAAAGGTGG + Intronic
1013213117 6:108004282-108004304 CTGGGAAAAAAAAAGAAAAGTGG - Intergenic
1013386818 6:109640089-109640111 CTAAGCAAAAAGAACAAAGGTGG - Intronic
1013454093 6:110314328-110314350 CTTAAAAAAAAGAAGACAGGAGG - Intronic
1013456462 6:110334094-110334116 GAGAGAAAACAGAGGAAAGGGGG + Intronic
1013505260 6:110793843-110793865 CTGAACAGACAGAGGAAAGGAGG + Intronic
1014220985 6:118798443-118798465 CTAAGCCAAAAGAAGAAAGGTGG + Intergenic
1014357091 6:120426021-120426043 CTAAGCAAAAAGAAGAAAGCTGG + Intergenic
1014385261 6:120792801-120792823 CTAAGCAAAAAGAAGAAAGCTGG - Intergenic
1014402041 6:121001924-121001946 CTGAGCAAACAGAACAAAGCTGG + Intergenic
1014560218 6:122880744-122880766 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1014590262 6:123257584-123257606 CTAAGCAAACAGAACAAAGCTGG - Intronic
1014643861 6:123949243-123949265 CTGAGCAAAAAGAACAAAGCTGG - Intronic
1014754081 6:125284045-125284067 CTGACAAAAAACAAGAAATGGGG + Intronic
1014833935 6:126136683-126136705 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1014838764 6:126191885-126191907 CTGAGGAAAAAGAACAAAGCTGG - Intergenic
1014967332 6:127771463-127771485 CTAAGCAAAAAGAAGAAAGCTGG + Intronic
1015046893 6:128787072-128787094 CTAAGTAAAAAGAAGAAAGCTGG - Intergenic
1015488872 6:133802155-133802177 CTGAGCAAAAAGAATAAAGCTGG - Intergenic
1015602952 6:134928230-134928252 CTGAGAAAACAGAAGAAATAAGG + Intronic
1015735561 6:136396006-136396028 CTGAGCAAAAAGAACAAAGCTGG - Intronic
1015763015 6:136685353-136685375 ATGTGAAAACAGAAAATAGGGGG - Intronic
1016155161 6:140797045-140797067 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1016271627 6:142296916-142296938 CTGACAAAACTAAAGAAAAGGGG + Intergenic
1016390864 6:143573572-143573594 CTTAGAAAAAAAAAAAAAGGAGG - Intronic
1016405799 6:143728535-143728557 CTGAGCAAAAAGAAGAAAGCTGG + Intronic
1016511473 6:144848088-144848110 CTTAGACAACAGAAGCAAGCAGG - Intronic
1016601903 6:145871746-145871768 CTTAGCAAAAAGAACAAAGGTGG + Intronic
1016650849 6:146457926-146457948 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1016660627 6:146575062-146575084 CTGAGCAAAAAGAATAAAGCTGG + Intergenic
1016660716 6:146575902-146575924 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1017143262 6:151211180-151211202 CTGAGAAAAAAGAACAAAGCTGG + Intergenic
1017411931 6:154176839-154176861 CTGAGCAAAAAGAACAAAGCTGG + Intronic
1017783890 6:157738648-157738670 CTAAGAAAAAAGAACAAAGCTGG + Intronic
1017995033 6:159524974-159524996 CTGAGAAACCACTGGAAAGGAGG - Intergenic
1018360160 6:163059256-163059278 ATGAGAAAAGAGAAAAAAGACGG - Intronic
1018448613 6:163883212-163883234 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1018463994 6:164025913-164025935 CTGAGAAAGCTGTATAAAGGTGG - Intergenic
1018895011 6:168008516-168008538 CTGAGAAAAAAGAACAAAGCTGG - Intronic
1019035981 6:169059000-169059022 CATAGAACAAAGAAGAAAGGTGG - Intergenic
1019289272 7:242438-242460 CTGAGAAAGCAGAAGGAGGAGGG + Intronic
1019336462 7:485190-485212 GGGAGAGAACAAAAGAAAGGAGG + Intergenic
1020342563 7:7127912-7127934 CTGGGAAAGAAGAAGAAAAGAGG - Intergenic
1020554343 7:9651842-9651864 CTAAGCAAAAAGAAGAAAGCTGG + Intergenic
1020609860 7:10381932-10381954 CTGAGCAAAAAGAAGAAAACTGG + Intergenic
1020652912 7:10896508-10896530 CTGAGCAAAAAGAAGAAAACTGG + Intergenic
1020771721 7:12403801-12403823 CTGAGAAAATCCAAGAAAGGAGG - Exonic
1020970332 7:14930164-14930186 CTGAGCAAAAAGAACAAAGCTGG - Intronic
1021015098 7:15522399-15522421 CTAAGCAAAAAGAAGAAAGCTGG + Intronic
1021048872 7:15957418-15957440 CTGACAAAAAACAAGAAATGAGG + Intergenic
1021321480 7:19218146-19218168 CAAAGAAAAAAGAAGAAAGCTGG + Intergenic
1021347256 7:19543715-19543737 CTAAGCAAACAGAACAAAGCTGG - Intergenic
1021605824 7:22408505-22408527 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1021739829 7:23675518-23675540 CTGAATAAAAAGAACAAAGGTGG - Intergenic
1021764629 7:23935012-23935034 CTGAGCAAAAAGAACAAAGTTGG - Intergenic
1022224001 7:28344588-28344610 TTGAGCAAAAAGAAGAAAGCTGG - Intronic
1022232116 7:28424066-28424088 CAGAGAAGACAGAAGAAGGAGGG - Intronic
1022278103 7:28876257-28876279 CTGAGAAAATGAACGAAAGGAGG + Intergenic
1022293577 7:29027994-29028016 CTGAGCAAAAAGAACAAAGCTGG + Intronic
1022346638 7:29522140-29522162 CTGAGTAAAAAGAACAAAGCTGG - Intergenic
1022365794 7:29714806-29714828 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1022381198 7:29861488-29861510 AAGAGAAAACAAAGGAAAGGAGG - Intronic
1022549302 7:31222695-31222717 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1022560344 7:31341937-31341959 AAGAGAAAACAGGAGGAAGGTGG - Intergenic
1022633973 7:32114171-32114193 CTAAGCAAACAGAACAAAGCAGG + Intronic
1022770756 7:33470281-33470303 CTGAGAAAAAAAAAGAATGCTGG - Intronic
1022898814 7:34781486-34781508 CTAGGAACAAAGAAGAAAGGTGG + Intronic
1023035113 7:36124652-36124674 CTAAGCAAAAAGAAGAAAGCTGG + Intergenic
1023297807 7:38734542-38734564 CAGAGAAATAAGGAGAAAGGGGG - Intronic
1023677668 7:42647464-42647486 CAGAGAATAAAGAAGCAAGGTGG + Intergenic
1023730043 7:43182595-43182617 TTGAGAAAAAAGAACAAAGTTGG - Intronic
1024050419 7:45617929-45617951 TTGAGCAAAAAGAAGAAAGCTGG + Intronic
1024150144 7:46563190-46563212 CTAAGTAAAAAGAAGAAAGCTGG + Intergenic
1024412180 7:49057114-49057136 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1024571630 7:50727889-50727911 CGCTGAAAACAGAAGAAATGTGG + Intronic
1024614048 7:51092727-51092749 TTGAGCAAAAAGAACAAAGGTGG - Intronic
1024951073 7:54860846-54860868 CAGAGAGAACAGAGGAAGGGAGG + Intergenic
1025001379 7:55317963-55317985 CTAAGCAAAAAGAACAAAGGTGG - Intergenic
1025048985 7:55718171-55718193 CTGAGAAAGAAGAACAAAGCTGG + Intergenic
1025286487 7:57666611-57666633 CTGTGAAAAAAGAAAAATGGTGG - Intergenic
1026131836 7:67627380-67627402 TTGAGAAAACAGAAGTATGGAGG + Intergenic
1026212658 7:68319517-68319539 CTTAGAAAACAGAGAGAAGGAGG + Intergenic
1026231537 7:68488428-68488450 CTGAGAAAGCAGTAAAGAGGAGG + Intergenic
1026600925 7:71776658-71776680 CTGAGAGCAGAGAAGAAAGATGG + Intergenic
1026715471 7:72785572-72785594 ATGAGAAAACAGAAGCACAGAGG + Intronic
1027112423 7:75451225-75451247 CTAAGCAAAAAGAACAAAGGTGG + Intronic
1027284668 7:76635831-76635853 CTAAGCAAAAAGAACAAAGGTGG + Intergenic
1027332857 7:77117653-77117675 ATAAGAAAACAGAAGAATGATGG + Intergenic
1027495540 7:78883570-78883592 CTAAGAAAAAAGAACAAAGCTGG + Intronic
1027608301 7:80327822-80327844 CTAAGAAAAAAGAACAAAGCTGG + Intergenic
1027727448 7:81825520-81825542 CTAAGCAAAAAGAAGAAAGATGG - Intergenic
1027919715 7:84377543-84377565 CTGAGCAAAAAGAACAAAGCTGG - Intronic
1028084027 7:86614890-86614912 CTGAGAAAGAAGAACAAAGCTGG + Intergenic
1028215374 7:88125802-88125824 CTGAAGAAGCAGTAGAAAGGGGG + Intronic
1028444279 7:90902293-90902315 CTGAGCAAAAAGAACAAAGCTGG + Intronic
1028459596 7:91076171-91076193 CTGAGCAAAAAGAACAAAGCTGG + Intronic
1028557758 7:92141457-92141479 CAGAGAGAAAAGAAGAAAGCTGG - Intronic
1028672334 7:93416900-93416922 TTGAGAAAAAAGAACAAAGCTGG - Intergenic
1028870200 7:95762988-95763010 CTAAGAAAAAAGAACAAAGCTGG + Intergenic
1029493181 7:100883379-100883401 GAGGGAAAACAGAAGAAATGAGG - Intronic
1029745111 7:102512294-102512316 GAGAGAAAGGAGAAGAAAGGAGG + Intronic
1029763103 7:102611455-102611477 GAGAGAAAGGAGAAGAAAGGAGG + Intronic
1029782927 7:102753644-102753666 ATAAGAAAACAGAAGAATGATGG - Intronic
1030194784 7:106842920-106842942 CTGTCAAATTAGAAGAAAGGTGG + Intergenic
1030288015 7:107846647-107846669 ATTAGAAAACAGAAAAAAGTAGG - Intergenic
1030294866 7:107913236-107913258 CTGAATAAAAAGAAGAAAGCTGG - Intronic
1030400412 7:109042182-109042204 CTAAGCAAAAAGAAGAAAGCTGG + Intergenic
1030473117 7:109992964-109992986 CTAAGCAAAAAGAAGAAAGCTGG - Intergenic
1030679286 7:112417681-112417703 CTAAGCAAAAAGAACAAAGGTGG + Intergenic
1030705205 7:112685514-112685536 CTAAGCAAAAAGAAGAAAGCTGG - Intergenic
1030756861 7:113296184-113296206 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1030759787 7:113336392-113336414 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1030886811 7:114948626-114948648 ATGAGAAAGAAGAAGAAAAGAGG - Intronic
1030980948 7:116185290-116185312 CTAAGCAAAAAGAACAAAGGTGG + Intergenic
1030988959 7:116276989-116277011 AACAGAAAACAGAAAAAAGGAGG - Intergenic
1031182353 7:118434353-118434375 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1031773544 7:125877365-125877387 GAAAGAAAACAGAAGAAAGCAGG + Intergenic
1032603269 7:133322659-133322681 CTAAGCAAACAGAACAAAGCTGG - Intronic
1032626375 7:133595886-133595908 CAGAGAAGACAGAGGCAAGGTGG - Intronic
1032901416 7:136313560-136313582 CTGAGGAAAAAGAACAAAGCTGG - Intergenic
1032940760 7:136787732-136787754 CTGAGCAAAGAGAACAAAGCTGG - Intergenic
1032982259 7:137297786-137297808 CTGATAGAGCAGAATAAAGGAGG + Intronic
1033231666 7:139603127-139603149 CTCCGAGAAAAGAAGAAAGGTGG - Intronic
1033412900 7:141136077-141136099 CTGAGCAAAAAGAACAAAGCTGG + Intronic
1033446491 7:141427262-141427284 CTGAGCAAATAGAAGCAAGCTGG + Intronic
1033491791 7:141851489-141851511 CTAAGCAAAAAGAAGAAAGCTGG + Intergenic
1033605386 7:142923992-142924014 TTGAGAAAACACAAACAAGGTGG - Intronic
1033614114 7:142995234-142995256 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1033645605 7:143300751-143300773 GTAAGAAGAAAGAAGAAAGGAGG - Intronic
1033819075 7:145111553-145111575 CTAAGCAAACAGAAAAAAGCTGG - Intergenic
1033976722 7:147111807-147111829 CTAAGAAAAAAGAACAAAGCTGG - Intronic
1034012865 7:147549046-147549068 CTAAGTAAAAAGAACAAAGGTGG - Intronic
1034366488 7:150553466-150553488 AATAGAAAACAGAAAAAAGGAGG + Intergenic
1034742330 7:153488274-153488296 CTAAGCAAAAAGAAGAAAGCTGG - Intergenic
1035230792 7:157464314-157464336 TTAAGAAACCAGAAGAAAAGGGG - Intergenic
1035287725 7:157816867-157816889 CTGAGTAAAGAGAAAAGAGGAGG - Intronic
1035473232 7:159124584-159124606 CTAAGCAAAAAGAAGAAAGCTGG - Intronic
1035599090 8:885073-885095 CTAAGCAAAAAGAAGAAAGCTGG - Intergenic
1035886456 8:3296380-3296402 CTGAGAGCAGAGAAGAATGGGGG + Intronic
1036062125 8:5335183-5335205 CACAGAAAACAGAAGATACGAGG - Intergenic
1036078977 8:5532228-5532250 GTGAACAAACAGAAGAAATGAGG - Intergenic
1036118605 8:5989028-5989050 CTGAAGAAACCCAAGAAAGGAGG - Intergenic
1036199980 8:6762555-6762577 TTGAGGAAAAAGAATAAAGGTGG - Intergenic
1036476390 8:9097089-9097111 ATGGGAAGAGAGAAGAAAGGGGG - Intronic
1037319528 8:17630160-17630182 TGGGGAAAACAGAAGAAAGACGG - Intronic
1037346902 8:17910445-17910467 TTGGAAAAACAAAAGAAAGGGGG - Intergenic
1037528970 8:19756310-19756332 CTTTGAAACCAGAAGAAAAGTGG + Intronic
1037552265 8:19986017-19986039 GTGAAGAAACAGAAGAAAGTTGG + Intergenic
1038097204 8:24327586-24327608 CTAAGAAAAAAGAACAAAGCTGG + Intronic
1038225109 8:25648775-25648797 CTGAGCAAAAAGAACAAAGTTGG - Intergenic
1038318856 8:26510779-26510801 TTGAGAAAAAAGAAAAAAGGAGG + Intronic
1038348526 8:26755190-26755212 CAGAGAAAAAAAAAAAAAGGAGG - Intronic
1038913039 8:31988632-31988654 ATGAGAAAGCAGAAGATATGAGG + Intronic
1039005582 8:33032964-33032986 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1039098419 8:33912939-33912961 CTGAGAAAAGAGAACAAATGAGG - Intergenic
1039235407 8:35497395-35497417 TTGAGAAAACAGCAGTAGGGAGG - Intronic
1039297653 8:36174267-36174289 CAGAGAAAACAGAGGCAATGTGG - Intergenic
1039434835 8:37552951-37552973 CTTAGAAAAGCAAAGAAAGGGGG + Intergenic
1039644172 8:39262486-39262508 CTGAGAAAAAAGAGTAAAGCTGG - Intronic
1039832772 8:41229653-41229675 CTAAGAAAAAAGAAAAAAGCTGG + Intergenic
1040106292 8:43544186-43544208 CTGAGAGAGGAGAGGAAAGGAGG - Intergenic
1040443398 8:47468403-47468425 CTGAGCAAAAAGAACAAAGCTGG + Intronic
1040473385 8:47755393-47755415 CTAAGCAAAAAGAAGAAAGCTGG - Intergenic
1040474857 8:47766731-47766753 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1040601453 8:48888405-48888427 GTGAAAAAACAGAAGAACAGAGG - Intergenic
1040734556 8:50490212-50490234 CTGAGCAAAAAGAACAAAGCTGG - Intronic
1040884079 8:52240464-52240486 CTGTTAAACCAGAAGAAAGAAGG - Intronic
1040956135 8:52981983-52982005 CTGAGCAAAGAGAAAAATGGAGG - Intergenic
1041098995 8:54378018-54378040 CTGCTAAAAGAAAAGAAAGGTGG - Intergenic
1041146909 8:54885967-54885989 TTGAGAAAGAAGAATAAAGGTGG - Intergenic
1041150804 8:54931713-54931735 GGGAGAAATCAGAAGAAAGGAGG - Intergenic
1041589142 8:59556576-59556598 CTGACATAATAGAAGAAAGCTGG + Intergenic
1041800821 8:61796222-61796244 ATGAGAAAATAGCAAAAAGGAGG - Intergenic
1042129473 8:65573109-65573131 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1042140717 8:65675692-65675714 GTGAGAAAACAGAAGCATAGAGG + Intronic
1042338383 8:67653004-67653026 CTGAGAAAAAACAAGCAATGGGG - Intronic
1042428748 8:68679622-68679644 CTGAGCAAAAAGAATAAAAGTGG + Intronic
1044052969 8:87532696-87532718 CTGATGAAACTGAAGAAATGGGG - Intronic
1044099760 8:88120187-88120209 AAAAGAAAACAGAAGGAAGGAGG + Intronic
1044143540 8:88684902-88684924 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1044185950 8:89252457-89252479 CTTATAAAACAGAAGAAATTGGG - Intergenic
1044377715 8:91495812-91495834 CTAAGCAAACAGAACAAAGCTGG - Intergenic
1044431816 8:92116433-92116455 CTGAGAAAAAAGAATAAAGGTGG - Intergenic
1044556172 8:93564290-93564312 CTGAGGAGAAACAAGAAAGGAGG + Intergenic
1045592791 8:103617068-103617090 CTGAGTAAAAAGAACAAAGCTGG + Intronic
1045732574 8:105259259-105259281 CTAAGCAAAAAGAAGAAAGCTGG - Intronic
1045812810 8:106243628-106243650 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1045840039 8:106569245-106569267 TTGAGAAGAAAGAAGAAGGGGGG - Intronic
1045945710 8:107793699-107793721 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1046057175 8:109092916-109092938 CAGTGAAAACATAAGAAAAGCGG - Intronic
1046162626 8:110387335-110387357 CTAAGCAAAAAGAACAAAGGTGG - Intergenic
1046248983 8:111605101-111605123 CTGAGGAAAGAGAAAAGAGGTGG - Intergenic
1046254189 8:111674719-111674741 CTAAGCAAAAAGAAGAAAGCTGG - Intergenic
1046441248 8:114257720-114257742 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1046586986 8:116159637-116159659 TTGAGAAAATGGAAGAAACGGGG - Intergenic
1046596790 8:116270835-116270857 CCAAGCAAACAGAAAAAAGGAGG - Intergenic
1046652496 8:116852647-116852669 CTTAGAAAAAGGAGGAAAGGAGG - Exonic
1047036562 8:120945698-120945720 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1048108185 8:131435706-131435728 CTGAGCAAAAAGAATAAAGCTGG + Intergenic
1048612089 8:136033970-136033992 ATAAAAAAAAAGAAGAAAGGAGG - Intergenic
1048916326 8:139187397-139187419 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1049136028 8:140900958-140900980 CTGAGCAAAAAGAACAAAGCTGG + Intronic
1049366684 8:142241556-142241578 CTAAGCAAACAGATGAAAGCTGG + Intronic
1049630023 8:143648807-143648829 ATGAGAAAACAGAAGAAATCAGG - Intronic
1050039948 9:1479277-1479299 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1050127519 9:2374453-2374475 CTGAGCAAAAAGAACAAAGCCGG + Intergenic
1050281765 9:4057820-4057842 CTGAGAAAACTTCAGAAAAGAGG + Intronic
1050316477 9:4406993-4407015 CTGAGAAAAAAGAACAAAACTGG + Intergenic
1050320290 9:4445681-4445703 CTGAGAAAACTGAGGACAAGAGG + Intergenic
1050363148 9:4850352-4850374 CTGTGATAACTGAAGAATGGTGG + Intronic
1050429559 9:5548803-5548825 CAAAGAAAACAGAGGAAAGGAGG + Intronic
1050505535 9:6344962-6344984 CTGAGCAAAAAGAATAAAGTTGG + Intergenic
1050676366 9:8059133-8059155 CTGAGCAAAAAGAATAAAGCTGG - Intergenic
1050677122 9:8068941-8068963 CTAAGCAAACAGAACAAAGCTGG - Intergenic
1050722945 9:8611751-8611773 AAGAGAAAAGAAAAGAAAGGAGG + Intronic
1050754501 9:8984588-8984610 CTGAGAAGTCAGAAGAAAAATGG - Intronic
1050788414 9:9434573-9434595 CTGAGCAAAAAGAACAAAGTTGG + Intronic
1050796779 9:9556286-9556308 CTGAGTAAGTTGAAGAAAGGAGG + Intronic
1050877392 9:10655654-10655676 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1050964130 9:11775922-11775944 GCTAGAAAACAGAAGAAATGGGG - Intergenic
1050980266 9:12002533-12002555 CTGAAAATACAGAAGAATAGTGG + Intergenic
1051089666 9:13391619-13391641 CTGAGCAAAAAGAAAAAAGCTGG + Intergenic
1051466830 9:17387945-17387967 CTGAAAAAAAAAAAAAAAGGTGG + Intronic
1051480534 9:17555379-17555401 CAGAGAAAAGATAACAAAGGAGG + Intergenic
1051549157 9:18309887-18309909 CTAAGCAAAAAGAATAAAGGTGG + Intergenic
1052001455 9:23287008-23287030 CTGAGAAAAAAGAACAAAGCTGG - Intergenic
1052267952 9:26595854-26595876 CTGGGAACAGAGAAGAGAGGTGG - Intergenic
1052330505 9:27262589-27262611 ATGAGAAAACAGAGGGTAGGAGG + Intergenic
1052337622 9:27336403-27336425 CTGAGACACCAGGAGAAAGGGGG + Intronic
1053028781 9:34756653-34756675 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1053460593 9:38267470-38267492 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1053834656 9:42121593-42121615 CCCAGAAAAAAGAAGAAATGAGG + Intronic
1054770442 9:69078435-69078457 CTGAGAGAAAAGGAGGAAGGTGG - Intronic
1054770678 9:69080319-69080341 CTGAGCAAAAAGAACAAAGCTGG + Intronic
1054877000 9:70107395-70107417 ATAAGAAGACAGAAGAGAGGAGG + Intronic
1054908789 9:70434552-70434574 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1055165694 9:73189772-73189794 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1055217649 9:73886002-73886024 CTAAGCAAAAAGAAGAAAGATGG - Intergenic
1055283732 9:74705167-74705189 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1055342912 9:75304251-75304273 CTGAGAAAAAACAAGCAATGGGG - Intergenic
1055433070 9:76264007-76264029 CTAAGCAAAAAGAAGAAAGCTGG + Intronic
1055717105 9:79129860-79129882 CTGAGAGACCAGAAAAAAGGCGG + Intergenic
1055868162 9:80840883-80840905 TTGAGATAACTGAAGAAAAGGGG - Intergenic
1055972219 9:81922954-81922976 CTGGCAAAACATAAAAAAGGAGG + Intergenic
1055973972 9:81938026-81938048 CTGGCAAAACATAAAAAAGGAGG + Intergenic
1056003110 9:82238600-82238622 CTAAGCAAACAGAACAAAGCTGG - Intergenic
1056040252 9:82658489-82658511 CTGAGAGAAAAGAAGGAAGGTGG + Intergenic
1056086954 9:83160222-83160244 CTCAGAAGACAGAAAAATGGGGG + Intergenic
1056120116 9:83479381-83479403 AGGAGAAAAAGGAAGAAAGGAGG + Intronic
1056174197 9:84018206-84018228 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1056624347 9:88241854-88241876 AGGAGATAAGAGAAGAAAGGAGG + Intergenic
1056818313 9:89817661-89817683 ATGTGGAAACAGAAGGAAGGAGG + Intergenic
1057006010 9:91560552-91560574 TTCAGAAAACAGAAGAATGCTGG - Intergenic
1057115717 9:92519364-92519386 TTGAGAAAAAAGAACAAAGTTGG + Intronic
1057436950 9:95049124-95049146 CTGTGAAATCAGCAGAAAAGTGG + Intronic
1057460736 9:95259240-95259262 CTAAGCAAAAAGAACAAAGGTGG + Intronic
1058034142 9:100232795-100232817 CTAAGCAAAAAGAAGAAAGCTGG - Intronic
1058198938 9:102014159-102014181 CTAAGCAAACAGAACAAAGCTGG + Intergenic
1058227241 9:102380539-102380561 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1058303185 9:103402023-103402045 CTGAGCAAAAGGAAGAAAGCTGG - Intergenic
1058552786 9:106133470-106133492 GGGAGAAAAGAGAGGAAAGGAGG - Intergenic
1058810323 9:108632826-108632848 CTCAGAAAACAGCAGAAAGATGG + Intergenic
1058847530 9:108975781-108975803 GTGAGAAAACAGTAGACAGTAGG + Intronic
1058934052 9:109751373-109751395 CTGAGAAAACTGAAGTGAGCAGG - Intronic
1059017501 9:110535458-110535480 CTAAGAAAAAAGAAAAAAGGTGG - Intronic
1059053874 9:110958278-110958300 CTGAGCAAAAAGAACAAAGCTGG + Intronic
1059060023 9:111025969-111025991 CTGAGCAAAAAGAACAAAGCTGG - Intronic
1059089501 9:111340788-111340810 CTAAGCAAAAAGAACAAAGGTGG + Intergenic
1059132457 9:111767627-111767649 CTGAGCAAAAAGAAGAAAGCTGG - Intronic
1059381894 9:113933502-113933524 CTGAGAAAATAGAAGCAATCAGG - Intronic
1059424017 9:114209653-114209675 CCTAGGAAAGAGAAGAAAGGGGG - Exonic
1059604393 9:115818147-115818169 ATGAGAAAAAACAAGAAAGACGG - Intergenic
1059610459 9:115886978-115887000 CTGAAATAAAAGAAGAAAGCGGG - Intergenic
1059669049 9:116476215-116476237 CTGAGAAGACAGAGCAAAGAAGG - Intronic
1059684763 9:116624491-116624513 ATGAGAATACAGAAGGAAGGGGG + Intronic
1059772986 9:117445159-117445181 ATGGGAAAACAGAATATAGGAGG + Intergenic
1060079686 9:120631417-120631439 CTGAGCAAAAAGAACAAAGCTGG - Intronic
1060216196 9:121739922-121739944 CTGTGAGAACAGAGGAAAGCTGG + Intronic
1060313990 9:122491398-122491420 CTGAGGAAAAAGAAGAAGGAGGG + Intergenic
1060510155 9:124225826-124225848 CTCAGAAAAAAAAAAAAAGGAGG + Intergenic
1060566534 9:124597714-124597736 CTGAGAATGCTGAAGAAATGTGG - Intronic
1061140159 9:128761289-128761311 CTGAAAAAAGAAAAAAAAGGTGG - Intronic
1061538600 9:131265253-131265275 CTCAAAAAAAAGGAGAAAGGTGG - Intronic
1061981345 9:134105680-134105702 CTGAGCAAAGAGAACAAAGCTGG + Intergenic
1061984402 9:134121550-134121572 ATGGGAAAGCAGAAGCAAGGTGG + Intergenic
1203428217 Un_GL000195v1:61726-61748 CTAAGCAAAAAGAACAAAGGTGG + Intergenic
1185694105 X:2182056-2182078 ATGAGAAAACAGGAGACATGAGG + Intergenic
1186051434 X:5600021-5600043 CTAAGAAAAAAGAACAAAGCTGG - Intergenic
1186124763 X:6401233-6401255 ATGAGAACAAAGAAGAAAAGAGG - Intergenic
1186250502 X:7660676-7660698 CTAAGAAGACATCAGAAAGGAGG + Intergenic
1186299807 X:8187920-8187942 CTGAACACACAGAAGAAATGGGG + Intergenic
1186381506 X:9065130-9065152 CTGAGCAAAAAGAACAAAGCTGG + Intronic
1186383460 X:9085587-9085609 CCCAGAAAACAAAAGAAGGGAGG - Intronic
1186432493 X:9517053-9517075 CTGGGAGAGCAGAAGAAACGTGG + Intronic
1186588878 X:10906987-10907009 TTGAGAAAGAAGAAGAAAGCAGG - Intergenic
1186703257 X:12114197-12114219 TTGAGAAAAAAGAAGAAAAATGG - Intergenic
1186866867 X:13729298-13729320 CTCAGCCAAAAGAAGAAAGGTGG + Intronic
1186924433 X:14317073-14317095 CTGAGCAAAAAGAATAAAGCTGG + Intergenic
1186934870 X:14437602-14437624 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1186947793 X:14588522-14588544 CTAAGCAAAAAGAAGAAAGCTGG - Intronic
1187181043 X:16944560-16944582 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1187198701 X:17114019-17114041 ATGACAAAACAGTAGAAAAGAGG + Intronic
1187305620 X:18092967-18092989 CTGAGCAAAAAGAAGAAAGCTGG - Intergenic
1187439165 X:19302416-19302438 CAGGGAAAACAGAAGACAGATGG - Intergenic
1187592647 X:20735267-20735289 GGGAGAAACTAGAAGAAAGGAGG + Intergenic
1187658084 X:21503887-21503909 CAGGTAAAAGAGAAGAAAGGCGG - Intronic
1187674819 X:21705608-21705630 CTGAGCAAACAGAACAAGAGAGG - Intergenic
1187705952 X:22009577-22009599 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1187804051 X:23098737-23098759 CTAAGCAAAAAGAACAAAGGTGG + Intergenic
1188084861 X:25891425-25891447 CTGATAATTCAGGAGAAAGGAGG - Intergenic
1188139917 X:26537198-26537220 TTAAGAAGACAAAAGAAAGGAGG - Intergenic
1188220047 X:27530360-27530382 TATAGAAAACAGAAGAATGGCGG - Intergenic
1188596471 X:31907440-31907462 CTGACAAAAAACAAGAAATGGGG + Intronic
1188724695 X:33568022-33568044 CTGAGCAAAAAGAACAAAGTTGG - Intergenic
1188758530 X:33995595-33995617 CTAAGCAAAAAGAAGAAAGCTGG - Intergenic
1188843102 X:35039608-35039630 AACAGAAAACAGAAAAAAGGAGG + Intergenic
1188995065 X:36874311-36874333 CTGAGCAAAAAGAACAAAGCAGG + Intergenic
1189286441 X:39855230-39855252 CTGAGAAAACCGAAGTGATGGGG + Intergenic
1189721445 X:43923341-43923363 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1189951096 X:46231764-46231786 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1190141423 X:47848884-47848906 CTGAGCAGACAGGAGAAAGATGG - Intronic
1190244303 X:48680951-48680973 CCGAGAAAGAAGTAGAAAGGTGG + Intronic
1190718748 X:53129010-53129032 CTGAGGTAAAAGAAGAAAGATGG - Intergenic
1190782452 X:53610989-53611011 TTCAGAAGGCAGAAGAAAGGGGG + Intronic
1190992950 X:55571218-55571240 CTGAGCAAAAAGAACAAAGATGG + Intergenic
1191030973 X:55971112-55971134 CTGAGCAAAAAGAAGAAAACTGG + Intergenic
1191040825 X:56077583-56077605 CTAAGCCAACAGAATAAAGGTGG - Intergenic
1191722567 X:64246582-64246604 CTAAGAAAACAGAAAGAAGTAGG - Intergenic
1191756368 X:64596948-64596970 CTAAGAAAAAAGAACAAAGCTGG + Intergenic
1191815784 X:65242678-65242700 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1191832596 X:65431021-65431043 TTGATAAAACAGAGGAATGGGGG - Intronic
1191891206 X:65943618-65943640 CTAAGAAAATAGAACAAAGCTGG - Intergenic
1191925650 X:66306953-66306975 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1192001087 X:67152186-67152208 CTGACAAAAAAGAAGAAATGGGG - Intergenic
1192006661 X:67221255-67221277 CTGAGTAAAAAGAACAAAGCTGG + Intergenic
1192062359 X:67840940-67840962 CTGAGCAAAAAGAAGAAAACTGG + Intergenic
1192245413 X:69367792-69367814 CTGAGAAAACAGACAGAAGGGGG - Intergenic
1192285562 X:69731727-69731749 GTTAGAAAAGAGAATAAAGGTGG - Intronic
1192285711 X:69733365-69733387 CTGACAAAAAACAAGAAATGGGG - Intronic
1192287256 X:69751288-69751310 CTGACAAAAAACAAGAAATGGGG - Intronic
1192696869 X:73425966-73425988 CTAAGGAAACAGAACAAAGCTGG + Intergenic
1192716323 X:73646340-73646362 TTGAGAAAAAAGAACAAAGCTGG - Intronic
1192753531 X:74020280-74020302 CCAAGCAAACAGAAAAAAGGAGG + Intergenic
1192759315 X:74079014-74079036 CTAAGAAAAGAGAACAAATGAGG - Intergenic
1192871921 X:75192783-75192805 AACAGAAAACAGAAGAAAGAAGG - Intergenic
1193083631 X:77428778-77428800 CTGAGAATAAAGAAGTAAGAAGG + Intergenic
1193110221 X:77721874-77721896 CTAAGCAAACAGAACAAAGCTGG + Intronic
1193173619 X:78365987-78366009 TTGAGAAAACTGAAGGAAAGAGG + Intergenic
1193375400 X:80753962-80753984 CTGAGCAAAAAGAACAAAGCTGG - Intronic
1193546318 X:82834734-82834756 CTGAGAAAAATGAATAAAGCTGG + Intergenic
1193576478 X:83204063-83204085 CTTAAACAACAGAAGAAAGGTGG - Intergenic
1193610396 X:83624555-83624577 CTAAGCAAACAGAATAAAGCTGG - Intergenic
1193631761 X:83898612-83898634 GTGAGAAAACTGAGGAAAAGTGG + Intergenic
1193663776 X:84289909-84289931 CTGAGCAAAAAGAAGAAAACTGG - Intergenic
1193804203 X:85973773-85973795 CTGGGAAAAAAGAACAAAGTAGG + Intronic
1193848690 X:86508029-86508051 CTGACAGAACAGGAGAAGGGTGG + Intronic
1193913481 X:87335176-87335198 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1193961408 X:87929439-87929461 CTAAGCAAACAGAACAAAGCTGG + Intergenic
1193970439 X:88044474-88044496 CTGAGTAAAAAGAACAAAGATGG + Intergenic
1193988701 X:88278877-88278899 CTCAGCAAAAAGAAGAAAGCTGG - Intergenic
1194012569 X:88581188-88581210 CTTAGAAATCAGAAGAATTGTGG - Intergenic
1194085409 X:89520969-89520991 CTAAGAAAAATGAAGAAAGTTGG - Intergenic
1194208088 X:91035581-91035603 CTGAGAAAAAAGAACAAAGCTGG - Intergenic
1194226779 X:91270367-91270389 CTGAGCAAAAAGAACAAAAGTGG - Intergenic
1194434214 X:93849706-93849728 CTAAGAAAAAAGAAAATAGGGGG - Intergenic
1194510775 X:94791632-94791654 CTAAGAAAAAAGAACAAAGCTGG - Intergenic
1194575927 X:95614383-95614405 CTAAGCAAAAAGAAGAAAGCTGG - Intergenic
1194631717 X:96293470-96293492 CTAAGAAAAAAGAACAAAGCTGG + Intergenic
1194708564 X:97204872-97204894 CTGAGCAAAAAGAACAAAGCTGG + Intronic
1194986766 X:100498570-100498592 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1195083492 X:101392280-101392302 CTGAGAATACAGAATTCAGGAGG - Intronic
1195660683 X:107374939-107374961 CTCAGAGAAGAGAAGAATGGTGG - Intergenic
1195666951 X:107440439-107440461 CTGAGCAAACAGAAGAGGGAGGG + Intergenic
1195678774 X:107527940-107527962 ATCAGAAATCAGAGGAAAGGGGG + Intronic
1195815231 X:108877939-108877961 TGAAGAAAGCAGAAGAAAGGGGG + Intergenic
1195934428 X:110111436-110111458 CTGAGAAAACAGGTACAAGGGGG - Intronic
1195976080 X:110528545-110528567 CTGAGTAAAAAGAATAAAGCTGG + Intergenic
1196024527 X:111026858-111026880 CTAAGAAAACAGAACAAATCTGG + Intronic
1196218229 X:113080846-113080868 CTAAGCAAAAAGAAGAAAGCTGG + Intergenic
1196305071 X:114092405-114092427 CTGAGCAAAGAGAACAAAGCTGG + Intergenic
1196467403 X:115986733-115986755 CTGAGAAAAAACAAGCAATGGGG + Intergenic
1196536579 X:116852232-116852254 CTGAGGAAAAACAAGAAATGGGG - Intergenic
1196597344 X:117560338-117560360 CTGAGCAAAAAGAATAAAGCTGG + Intergenic
1196658676 X:118246583-118246605 CTGACAAAAAAAAAGAAATGGGG + Intergenic
1196674988 X:118410264-118410286 AGGAGAAAGGAGAAGAAAGGTGG + Intronic
1197156786 X:123278866-123278888 CTGAGCAAAAAGAACAAAGCTGG - Intronic
1197166833 X:123386899-123386921 CTGAGCAAAAAGAACAAAGCTGG - Intronic
1197224317 X:123941277-123941299 CAGAGAAAAAGGAATAAAGGTGG + Intergenic
1197436985 X:126442092-126442114 CTGAGCAAAAAGAAGAAAACTGG - Intergenic
1197478409 X:126951424-126951446 CTAAGCAAAAAGAAGAAAGCTGG + Intergenic
1197499516 X:127226784-127226806 CTAAGCAAAAAGAAGAAAGCTGG + Intergenic
1197530588 X:127619645-127619667 GTGAGAAAACAGTTAAAAGGGGG + Intergenic
1197823327 X:130563459-130563481 CTGAGAGAACAGAGCACAGGTGG + Intergenic
1197906693 X:131432962-131432984 CTAAGCAAACAGAACAAAGCTGG + Intergenic
1197950238 X:131887299-131887321 ATCAGAAAACAGTAGAAAGCTGG + Intergenic
1198165728 X:134054123-134054145 CTGAGCAAAAAGAACAAAGTTGG - Intergenic
1198255190 X:134918258-134918280 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1198411937 X:136379482-136379504 AGGAGAAGACAGGAGAAAGGAGG - Intronic
1198488482 X:137112657-137112679 GTGAGAAAAAAGAAGCAATGGGG - Intergenic
1198531380 X:137551751-137551773 CTGAGCAAAAAGTGGAAAGGAGG - Intergenic
1198545010 X:137682300-137682322 CCCAGCAGACAGAAGAAAGGAGG - Intergenic
1198557032 X:137806297-137806319 CTGAGCAAACAGAACAAAGCTGG - Intergenic
1198628585 X:138607875-138607897 CTAAGAAAAAAGAACAAAGCTGG - Intergenic
1198785081 X:140278386-140278408 CTGAGAAAAAAGAACAAAATGGG - Intergenic
1199119693 X:144036977-144036999 CTGCGAAAATCGAAGCAAGGTGG + Intergenic
1199161557 X:144618050-144618072 CTGAGCAAAAAGAACAAAGCTGG - Intergenic
1199182061 X:144869313-144869335 CTAAGGAAAAAGAAGAAAGCTGG - Intergenic
1199332537 X:146579656-146579678 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1199365639 X:146978888-146978910 CTTAGCAAAAAGAAGAAAGCTGG - Intergenic
1199376264 X:147113436-147113458 CTGAGCAAAAAGAACAAAGCTGG + Intergenic
1199410803 X:147519916-147519938 ATGGGAAAACAGAAAAAAGCAGG + Intergenic
1199422760 X:147663964-147663986 CTAAGCAAAAAGAAGAAAGCTGG - Intergenic
1199633956 X:149797449-149797471 CAGAGAAAATAGAAGAGAAGGGG - Intergenic
1199755516 X:150861311-150861333 CTGAGCAAAAAGAATAAAGCTGG + Intronic
1199774334 X:150997596-150997618 CTAAGAAAGCATAAGACAGGGGG - Intergenic
1200032775 X:153309836-153309858 AGGAGAAAAAAGAAGAAAAGTGG + Intergenic
1200295168 X:154912642-154912664 CTGAGCAAAGAGAACAAAGCTGG - Intronic
1200386232 X:155893632-155893654 CTGAGAACACAGCAAGAAGGTGG - Intronic
1200438052 Y:3176846-3176868 CTAAGAAAAATGAAGAAAGTTGG - Intergenic
1201223589 Y:11794164-11794186 CTGAAAAGAGAGAGGAAAGGAGG - Intergenic
1201346733 Y:12992653-12992675 CTGAGCCAAAAGAACAAAGGTGG - Intergenic
1201606644 Y:15792921-15792943 ATGAGAACAAAGAAGAAAAGAGG - Intergenic
1201679584 Y:16629184-16629206 CAGAGGAACCAGAAGACAGGAGG + Intergenic
1201688389 Y:16733433-16733455 CTAAGCAAAAAGAAGAAAGCCGG - Intergenic
1201689613 Y:16748473-16748495 CTAAGATAAAAGAACAAAGGTGG - Intergenic
1202040594 Y:20679161-20679183 CTGAGCAAACAGAACAAAGCTGG + Intergenic
1202301153 Y:23415892-23415914 CTGAGCAAGCTGAAGAATGGAGG + Intergenic
1202569658 Y:26254706-26254728 CTGAGCAAGCTGAAGAATGGAGG - Intergenic