ID: 1115132629

View in Genome Browser
Species Human (GRCh38)
Location 14:30072407-30072429
Sequence CAAAGCAATCAGTTTCAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1143
Summary {0: 1, 1: 0, 2: 7, 3: 244, 4: 891}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115132629 Original CRISPR CAAAGCAATCAGTTTCAAAA TGG Intronic
900822825 1:4902376-4902398 AAAGGCATTCAGTTTTAAAAGGG - Intergenic
901124746 1:6921105-6921127 AAAGGCATTCAGTTTCAAAAGGG - Intronic
902084721 1:13850203-13850225 AAAGGCATTCAGTTTCAAAAGGG + Intergenic
902798211 1:18813348-18813370 GAAAGCAGCCAGTTTCAACATGG + Intergenic
904057504 1:27681248-27681270 AAAGGCATTCAGTTTCAAAAGGG - Intergenic
904057517 1:27681378-27681400 AAAGGCATTCAGTTTCAAAAGGG - Intergenic
904386237 1:30143934-30143956 AAAAGCATTCAGTTTTATAAGGG - Intergenic
904653346 1:32023600-32023622 TAAAGGAGTCAGTTCCAAAAGGG + Intronic
905360343 1:37414995-37415017 CAAACCAATTAGTATCAAATGGG + Intergenic
906390714 1:45413183-45413205 CAAAGTTATCAGTTAAAAAAAGG - Intronic
906764045 1:48410099-48410121 AAAGGCATTCAATTTCAAAAGGG - Intronic
907021097 1:51067393-51067415 AAAAACATTCAGTTTTAAAAGGG - Intergenic
907439181 1:54468287-54468309 AAAGGCATTCAGTTTTAAAAGGG + Intergenic
908010164 1:59768248-59768270 TCAACCAATGAGTTTCAAAAGGG - Intergenic
908011943 1:59786884-59786906 TAAGGCATTCAGTTTTAAAAGGG - Intergenic
908047406 1:60185282-60185304 AAAGGCATTCAGTTTTAAAATGG - Intergenic
908068679 1:60434660-60434682 AAAGGCATTCAGTTTTAAAATGG - Intergenic
908729131 1:67208185-67208207 AAAGGCATTCAGTTTTAAAAGGG + Intronic
908987068 1:70037199-70037221 CATAGCAACAAGTTACAAAATGG - Intronic
909054144 1:70803369-70803391 AAAAGTATTCAGTTTTAAAAGGG + Intergenic
909065637 1:70931989-70932011 TAAAGCATTCTGTTTTAAAAGGG - Intronic
909096033 1:71290496-71290518 AAAGGCATTCAGTTTTAAAAGGG + Intergenic
909274342 1:73665808-73665830 AAAGGCATTCAGTTTTAAAAGGG + Intergenic
909373541 1:74914458-74914480 AAAGGCATTCAGTTTTAAAAGGG - Intergenic
909416813 1:75415931-75415953 AAAGGCATTCAGTTTCATAAGGG + Intronic
909755469 1:79220479-79220501 AAAAGCATTCAGTTTTAAAAAGG + Intergenic
909826068 1:80128150-80128172 AAGGGCATTCAGTTTCAAAAGGG - Intergenic
910020331 1:82581120-82581142 TAAGGCAAACAGTTTCAACAAGG + Intergenic
910122603 1:83807029-83807051 CAAAGCAAGGACTTTCAAATGGG + Intergenic
910512960 1:88026281-88026303 AAAAGCATTCAGTTTTAAAAGGG - Intergenic
911490715 1:98562810-98562832 AAAGGCATTCAGTTTCATAAGGG + Intergenic
911629523 1:100166653-100166675 AAAAGCACTCAGTTTTAAAAGGG + Intronic
911790863 1:102014067-102014089 AAAAGCATTCAGTTTTAAAAGGG + Intergenic
911855782 1:102872886-102872908 TAAAGCATTCAGTTTTATAAGGG - Intergenic
911880772 1:103236104-103236126 GAAGGCATTCAGTTTCATAAGGG + Intergenic
911907522 1:103588770-103588792 TAAAGCATTCAGTTTTAAAATGG - Intergenic
911985542 1:104617241-104617263 AAAGGCATTCAGTTTTAAAAGGG - Intergenic
912042609 1:105411119-105411141 AAAGGCATTCAGTTTTAAAAGGG + Intergenic
912080570 1:105931603-105931625 AAAGGCATTCAGTTTTAAAAGGG + Intergenic
912165601 1:107039453-107039475 AAAAGCATTCAGTTTTAAAAGGG + Intergenic
912577789 1:110690688-110690710 CAAAGAAATCAGTTTACAAATGG + Intergenic
912579211 1:110705005-110705027 AAAAGCATTCAGTTTTAAAACGG - Intergenic
912610077 1:111033924-111033946 AAAGGCATTCAGTTTTAAAAGGG + Intergenic
912829385 1:112938414-112938436 CAATGTATTCAGTTTCAAAGTGG - Intronic
912890366 1:113523682-113523704 AAAGGCAATCAGTTTTAAAAGGG + Intronic
912892483 1:113549547-113549569 CTAAGTCTTCAGTTTCAAAAAGG + Exonic
912907207 1:113719365-113719387 AAAGGCAATCAGTTTTATAAGGG - Intronic
913241996 1:116837520-116837542 AAAGGCATTCAGTTTTAAAAGGG + Intergenic
913402901 1:118455614-118455636 AAAGGCATTCAGTTTCAGAAGGG - Intergenic
914351692 1:146845370-146845392 AAAAGCATTCAGTTTTAAAAGGG - Intergenic
914924138 1:151869309-151869331 CAAAGAACCCAGTTTAAAAATGG - Intergenic
915752316 1:158223392-158223414 AAAGGCATTCAGTTTTAAAAGGG + Intergenic
915804406 1:158829300-158829322 AAAGGCATTCAGTTTTAAAAGGG - Intergenic
915858556 1:159418084-159418106 AAAAGCATTTAGTTTTAAAAGGG + Intergenic
916035746 1:160921308-160921330 AAAAGCATTCAATTTTAAAAGGG + Intergenic
916218932 1:162423522-162423544 CAAAGCAATCACGAACAAAAAGG + Intergenic
916477325 1:165182900-165182922 AAAAGCTTTCAGTTTTAAAAGGG + Intergenic
916734871 1:167598632-167598654 AAAGGCATTCAGTTTTAAAAGGG - Intergenic
916797654 1:168181633-168181655 TAAAGCAGTCAGCTTCAAACTGG + Intronic
917082576 1:171271811-171271833 AAAGGCATTCAGTTTTAAAAGGG + Intronic
917152245 1:171957561-171957583 AAAAGCATTCAGTTTTAAAAGGG - Intronic
917245493 1:172996508-172996530 TAAAGCATTCAGTTTTAAATGGG + Intergenic
917290776 1:173470570-173470592 AAAGGCATTCAGTTTCATAAGGG + Intergenic
917396741 1:174601734-174601756 AAAAGCATTCTGTTTTAAAAGGG - Intronic
917681890 1:177375840-177375862 AAAAGCATTTAGTTTTAAAAGGG - Intergenic
917892311 1:179452324-179452346 AAAGGCATTCAGTTTTAAAAGGG + Intronic
918486474 1:185034276-185034298 CAGAGCCATCAGTTACGAAAAGG + Intergenic
918591977 1:186250140-186250162 AAAGGCATTCAGTTTTAAAAAGG - Intergenic
918633451 1:186747333-186747355 ATAGGCATTCAGTTTCAAAAGGG + Intergenic
918651464 1:186968963-186968985 CAAACCATTCAGTCTCACAAAGG - Intronic
918831634 1:189405797-189405819 AAAGGCATTCAGTTTTAAAAGGG - Intergenic
918918683 1:190675812-190675834 GAAAGCAATCAAATTGAAAAAGG - Intergenic
918955838 1:191205716-191205738 CAAGGCAATTAGTTTTATAAGGG + Intergenic
919156863 1:193776455-193776477 AAAGGCATTCAGTTTTAAAAGGG - Intergenic
919242666 1:194935464-194935486 TAAACCATTCAGTTTTAAAAGGG + Intergenic
919591968 1:199515283-199515305 CAAATCAATAATTTTAAAAATGG + Intergenic
919869213 1:201807970-201807992 CAAAGCGTTCAGTATAAAAAAGG + Exonic
920597869 1:207291408-207291430 AAAGGCATTCAGTTTTAAAAGGG + Intergenic
920783651 1:209019837-209019859 AAAGGCATTCAGTTTTAAAATGG + Intergenic
921000511 1:211038823-211038845 AAAGGCATTCAGTTTTAAAAGGG + Intronic
921150935 1:212402492-212402514 CAAATAACTCAGTTTAAAAATGG - Intronic
921386640 1:214576764-214576786 CAAGGCATTCAGTTTTAAAAGGG + Intergenic
921525133 1:216208535-216208557 TAAAGGAACCACTTTCAAAAGGG + Intronic
921563005 1:216680948-216680970 TAAAGCCATCATTTTGAAAATGG - Intronic
921715954 1:218417456-218417478 AAAGGCATTCAGTTTTAAAAGGG + Intronic
921763127 1:218940188-218940210 AAAGGCATTCAGTTTCAAAAGGG + Intergenic
921792661 1:219308267-219308289 AAAGGCATTCAGTTTTAAAAGGG + Intergenic
922058455 1:222064173-222064195 AAAGGCACTCAGTTTTAAAAGGG - Intergenic
922115482 1:222608757-222608779 AAAGGCATTCAGCTTCAAAAGGG - Intergenic
922195808 1:223359552-223359574 CATAGCAATTATTTTCTAAATGG + Intronic
922709205 1:227814419-227814441 AAAAGCATTCAGTTTTAAAAGGG - Intergenic
923461140 1:234210691-234210713 AAAGGCATTCAGTTTGAAAAGGG + Intronic
923687304 1:236162323-236162345 AAAGGCATTCAGTTTTAAAAGGG + Intronic
923878539 1:238076861-238076883 CAAAGCAGGCAGTCTCTAAATGG - Intergenic
924806515 1:247366019-247366041 AAAAGCCTTCAGTTTTAAAAGGG + Intergenic
1063166834 10:3471041-3471063 CCATGCACTGAGTTTCAAAAGGG + Intergenic
1063808916 10:9681238-9681260 AAAAGCATTCAGTTTTAAAAGGG + Intergenic
1063815589 10:9767852-9767874 AAAAACAATAAGTTTTAAAAAGG + Intergenic
1064862363 10:19841368-19841390 AAAAGCATTAAGTTTTAAAATGG - Intronic
1064882071 10:20066768-20066790 AAAAGCAATTATTTGCAAAATGG + Intronic
1065159963 10:22909274-22909296 AAAAGCATTCAGTTTTAAAAGGG - Intergenic
1065347816 10:24765421-24765443 AAAAGCATTCTGTTTTAAAAGGG - Intergenic
1065494338 10:26313348-26313370 CAAGAAAATCACTTTCAAAAGGG + Intergenic
1065737491 10:28767401-28767423 CAAACCCATCCGTTTCCAAAAGG - Intergenic
1066480023 10:35786602-35786624 AAAGGCATTCAGTTTTAAAAGGG - Intergenic
1067731529 10:48815445-48815467 AAAAAAAATCTGTTTCAAAAAGG - Intronic
1067911381 10:50350331-50350353 CAAAGCATTCAGTTTGATAAGGG + Intronic
1068011351 10:51455486-51455508 AAAAGCATTCAGTTTTAAAAGGG - Intronic
1068103256 10:52582063-52582085 AAAAGCATTCAGTTTTAAAAGGG - Intergenic
1068259980 10:54567162-54567184 CAAACCACTCATTTTAAAAATGG - Intronic
1068301102 10:55141019-55141041 CAAAGAAATCAATTTAAAAAAGG - Intronic
1068354892 10:55897864-55897886 AAAACCATTCAGTTTTAAAAGGG - Intergenic
1068773517 10:60848325-60848347 CCAAGGAATCACTTTCAGAAAGG - Intergenic
1068797185 10:61096343-61096365 CAAAGAAATCAGATTACAAAGGG - Intergenic
1069101393 10:64325380-64325402 CCAAGGAAACAGTTTCCAAAGGG + Intergenic
1069367794 10:67712211-67712233 AAAGGCATTCAGTTTTAAAAGGG + Intergenic
1069424442 10:68277505-68277527 AAAAGCATTCAGTTTTAAAAGGG + Intergenic
1070376079 10:75832184-75832206 AAAGGCATTCAGTTTTAAAAGGG - Intronic
1070633441 10:78105179-78105201 AAAAGCATTCAGTTTTATAAGGG + Intergenic
1071019016 10:81030063-81030085 AAAGGCATTCAGTTTCAAAAGGG - Intergenic
1071329761 10:84547852-84547874 CAAAGCTAGCAGTCTCTAAATGG + Intergenic
1071818349 10:89254723-89254745 AAAAGAATTCAGTTTTAAAAGGG - Intronic
1071852216 10:89585381-89585403 CACAGCAATCTGTTTCCAAAAGG + Intronic
1072253250 10:93598556-93598578 TATAGCAATCACTTTCAAGATGG + Intronic
1072491815 10:95914246-95914268 CAATGAAATCATTTTCAACAAGG - Intronic
1072522082 10:96237776-96237798 CAAAGCAAGGAGCTGCAAAATGG + Intronic
1073401258 10:103259524-103259546 AAAAGCATTCAGTTTTAAAAGGG + Intergenic
1073736657 10:106355361-106355383 CAAAGCAAGCAGGCTCTAAATGG - Intergenic
1073847039 10:107568413-107568435 AAAGGCATTCAGTTTTAAAAGGG - Intergenic
1073880617 10:107975524-107975546 AAAAGCATTCTGTTTTAAAAGGG - Intergenic
1073883344 10:108008319-108008341 AAAGGCATTCAGTTTCAAAAGGG - Intergenic
1073928761 10:108548787-108548809 CAAAGCAATAAGATTCCAGAAGG - Intergenic
1073942332 10:108713134-108713156 AAAAGCATTCAGTTATAAAAGGG + Intergenic
1073950167 10:108798546-108798568 CAAAGAAATCAGTGTCCACAAGG + Intergenic
1074041488 10:109793752-109793774 AAAGGCATTCAGTTTTAAAAGGG - Intergenic
1074069077 10:110048742-110048764 AAAAGCATTCAGTTTTGAAAGGG + Intronic
1074242067 10:111649684-111649706 AAAGGCATTCAGTTTTAAAAGGG + Intergenic
1074286320 10:112101196-112101218 AAAAGCATTCAGGTTTAAAAGGG - Intergenic
1074622411 10:115138901-115138923 AAAGGCATTCAGTTTTAAAAGGG - Intronic
1074640177 10:115370667-115370689 AAAGGCATTCAGTTTTAAAAGGG + Intronic
1074743062 10:116503386-116503408 CACAGGCATCAGTCTCAAAATGG - Intergenic
1074846727 10:117405291-117405313 CAAAGCAGTCACTTCCAAGAAGG + Intergenic
1075439416 10:122467562-122467584 CAAAGCAACCAGGCTCAAGATGG - Intronic
1075532911 10:123245171-123245193 CAAAGCAGCCAGATACAAAAAGG + Intergenic
1075772717 10:124953506-124953528 CACAGCAATCAGCTTCATACAGG - Intronic
1075938053 10:126360384-126360406 AAAAGCATTCAGTTTTAAAAGGG - Intronic
1076026194 10:127115815-127115837 CAAAGCTGTCAGATTCAGAAAGG - Intronic
1076225626 10:128772798-128772820 AAATGCATTCAGTTTTAAAAGGG + Intergenic
1076572214 10:131440416-131440438 AAATGCAATAAATTTCAAAATGG + Intergenic
1076740871 10:132483936-132483958 CAAAGAAATAAATTTAAAAATGG + Intergenic
1077426282 11:2479839-2479861 AAAAGCATTCAGTTTTGAAAGGG - Intronic
1077827405 11:5826112-5826134 AAACGCATTCAGTTTTAAAAAGG + Intronic
1077942621 11:6859498-6859520 AAAAGCATTCAGTTTTATAAGGG - Intergenic
1077985100 11:7343305-7343327 AAAAGTATTCAGTTTTAAAAGGG - Intronic
1078364966 11:10699119-10699141 AAAACCATTCAGTTTTAAAAGGG + Intergenic
1078482141 11:11687100-11687122 AAAAGCATTCACTTTTAAAAGGG + Intergenic
1078651790 11:13201899-13201921 AAAAGCAAACATTTTTAAAATGG + Intergenic
1079586244 11:22129196-22129218 AAAAGCATTCAGTTTTAAAAAGG - Intergenic
1080065048 11:28001832-28001854 AAAAGCATGCAGTTTTAAAAGGG + Intergenic
1080151394 11:29056437-29056459 TAAAGCATTTAGTTTTAAAATGG + Intergenic
1080182958 11:29446059-29446081 GAAAGCATTCAGTTTTAAAGAGG + Intergenic
1080717651 11:34819371-34819393 AAAGGCATTCAGCTTCAAAAGGG - Intergenic
1080939185 11:36896033-36896055 CAAAGCAATCAGATTGCATAAGG - Intergenic
1080964672 11:37200930-37200952 GAAAGCAATCAATTGCTAAACGG - Intergenic
1080973385 11:37304662-37304684 CAAGGCATTCAGTTTTAAAAGGG - Intergenic
1080986370 11:37471486-37471508 CAAACGAATCAGTCGCAAAAAGG + Intergenic
1081083908 11:38775481-38775503 AAAAGCATTCAGTTTTATAAGGG - Intergenic
1081101477 11:39007443-39007465 AAAAGCATTCAGTTTTAAAAGGG - Intergenic
1081400289 11:42635578-42635600 AAAAGCATTCAATTTTAAAAGGG + Intergenic
1081463559 11:43294993-43295015 CAATGCAATCGCTATCAAAACGG + Intergenic
1082248848 11:49957942-49957964 CAAATCATTCAGCTACAAAATGG + Intergenic
1082652141 11:55806678-55806700 AAAGGCATTCAGTTTTAAAAGGG - Intergenic
1082692867 11:56326681-56326703 AAAAGCATTCAGTTTTAAAAGGG + Intergenic
1082759386 11:57112334-57112356 AAAATTAATCAGTTTCCAAATGG - Intergenic
1082973261 11:59045763-59045785 CAATGCAATTGGTTTCCAAAAGG + Intergenic
1082977659 11:59089354-59089376 CAATGCAATTGGTTTCCAAAAGG + Intergenic
1083506211 11:63160026-63160048 AAAAGCAGTCAGTTTTAAAAGGG + Intronic
1083814384 11:65124350-65124372 GAAAGCTATCAGAATCAAAATGG - Intronic
1083850860 11:65365956-65365978 CAAATCACTCAATTTAAAAATGG - Intergenic
1085866693 11:80303253-80303275 AAAGGCATTCAGTTTTAAAAGGG + Intergenic
1085930151 11:81071836-81071858 CAAAGCCATTAGTTTTTAAAAGG + Intergenic
1086604932 11:88685380-88685402 AAAAGCATTCAGTTTTATAAGGG + Intronic
1086794494 11:91083651-91083673 AAAGGCATTCAGTTTTAAAAGGG + Intergenic
1086837565 11:91644210-91644232 CAAAGCCATCAGAATCAAAAGGG - Intergenic
1087341741 11:96915679-96915701 GAAAGCATTCAGTTTTATAAGGG + Intergenic
1087496348 11:98894678-98894700 AAAAGCATTCAGTTTTATAACGG - Intergenic
1088038840 11:105351410-105351432 AAAAGCATTCAGTTTTAAAAGGG - Intergenic
1088175765 11:107051285-107051307 AAAGGCATTCAGTTTTAAAAGGG + Intergenic
1088427022 11:109715198-109715220 AAAAGCATTCAGTTTTACAAGGG - Intergenic
1088869743 11:113880413-113880435 AAAAGCATTCAGTTTTAAAAAGG - Intergenic
1090504576 11:127297708-127297730 AAAGGCATTCAGTTTTAAAAGGG + Intergenic
1090686236 11:129124022-129124044 GAAAGTAATCAGTTTTAAAGAGG - Intronic
1090692518 11:129199147-129199169 AAAAGCATTCAGTTTTATAAGGG + Intronic
1090890828 11:130920981-130921003 AAAAGCATTCAGTTTTATAAGGG - Intergenic
1091065636 11:132509275-132509297 AAAGGCATTCAGTTTTAAAAGGG + Intronic
1091350653 11:134891559-134891581 GAAAGCATTCAGTTTTAAAAGGG + Intergenic
1091520259 12:1232667-1232689 CAAAACAAACAGTTTAATAAAGG - Intronic
1092093678 12:5824300-5824322 AAAAGCATTCAGTTTTATAAGGG - Intronic
1092593601 12:9975569-9975591 AAAAGCATTCAGTTTTATAAGGG + Intronic
1093128068 12:15354231-15354253 CAAAGAAATCAGTTTACAAATGG - Intronic
1093141914 12:15518586-15518608 AAAGGCATTCAGTTTTAAAAGGG - Intronic
1093271516 12:17067987-17068009 CAAATCCATTAGTTTTAAAATGG + Intergenic
1093353046 12:18127795-18127817 AAAGGCATTCAGTTTCAAAAGGG + Intronic
1093663016 12:21779058-21779080 CAAAGCAATATGTTCCAAAGTGG - Intergenic
1094131891 12:27083291-27083313 CAATGAAATAAGTTTTAAAAGGG - Intergenic
1094211264 12:27894982-27895004 TTAAGCAGTTAGTTTCAAAATGG - Intergenic
1094259950 12:28483263-28483285 CAAGGCAATCAATTGGAAAATGG - Intronic
1094421924 12:30280115-30280137 CAAAGCATTCCATTTTAAAAGGG + Intergenic
1094489320 12:30948883-30948905 AAAAGCATTCAGTTTCATAAGGG - Intronic
1094786953 12:33859684-33859706 AAAGGCATTCAGTTTTAAAAGGG - Intergenic
1095122687 12:38437723-38437745 AAAAGCATTCAGTTTTAAAAGGG - Intergenic
1095131642 12:38549473-38549495 AAATGCATTCAGTTTTAAAAGGG - Intergenic
1095147598 12:38749767-38749789 AAAGGCATTCAGTTTCATAAGGG + Intronic
1095214050 12:39527388-39527410 TAAAGCATTCAGTTTTAAAAGGG - Intergenic
1095234936 12:39784968-39784990 AAAAGCACTCTGTTTTAAAAGGG + Intronic
1095426633 12:42081485-42081507 CAAAGCAATCACTTTTCAAAGGG - Intergenic
1095847133 12:46758544-46758566 AAAGGCATTCAGTTTTAAAAGGG + Intergenic
1096063388 12:48720552-48720574 AAAAGCATTCAGTTTTATAAGGG - Intergenic
1096955135 12:55518242-55518264 GAAAGCATTCTGTTTTAAAAGGG + Intergenic
1097297410 12:57981804-57981826 AAAAGCAATTTGTTTCAAAATGG - Intergenic
1097735740 12:63179185-63179207 AAAAACATTCAGTTTTAAAAGGG + Intergenic
1098926959 12:76361129-76361151 AAAAGCAGTCTGTTTTAAAAGGG - Intronic
1099501390 12:83418600-83418622 AAAAGCATTCAGTTTTAAAAGGG + Intergenic
1099700463 12:86076062-86076084 AAAGGCATTCAGTTTTAAAAGGG - Intronic
1099722493 12:86382409-86382431 AAATGCATTCAGTTTTAAAAGGG + Intronic
1100407674 12:94285389-94285411 CAACGCAACCACTTTCAAACTGG - Intronic
1100738841 12:97568630-97568652 GAAAGCAATCATTTTAGAAATGG + Intergenic
1100842242 12:98624519-98624541 GAAAGCAGTCAGTTACAAAAAGG - Exonic
1101083699 12:101214324-101214346 GAAAGCATTCAGTTTTAAAAAGG + Intergenic
1101113201 12:101506368-101506390 AAAGGCATTCAGTTTTAAAAAGG + Intergenic
1101340359 12:103837503-103837525 AAAGGCATTCAGTTTTAAAAGGG - Intronic
1101366089 12:104071986-104072008 GAAAACTATCAATTTCAAAACGG - Intronic
1101611587 12:106297751-106297773 AAAAGCAATCATTTAGAAAATGG + Intronic
1101863833 12:108504853-108504875 GACAGCAATCAAATTCAAAATGG + Intergenic
1102523108 12:113491746-113491768 AAAAGCATTCTGTTTTAAAAGGG + Intergenic
1102743338 12:115227485-115227507 CAAAGTCAACAGTTTCAACAGGG + Intergenic
1103129678 12:118456968-118456990 CATACCAATCATTTTCAAACAGG - Intergenic
1104172162 12:126292410-126292432 AAAAGCACTCAGTTTTAAAAGGG - Intergenic
1105650594 13:22372696-22372718 AAAAGCACTCAGTTTTAAAAGGG - Intergenic
1105911777 13:24875318-24875340 CAAAGAAAGCAGTTTACAAATGG + Intronic
1106031092 13:26004066-26004088 CAATGCAATCCCTATCAAAATGG - Intronic
1106594103 13:31122532-31122554 CAAAGCCATCACTTTGCAAATGG + Intergenic
1106754684 13:32810876-32810898 CACAGCTATAAGTGTCAAAAGGG - Intergenic
1106917279 13:34529301-34529323 AAAGGCATTCAGTTTCATAAGGG + Intergenic
1107274936 13:38667455-38667477 AAAGGCATTCAGTTTTAAAAGGG + Intergenic
1108100105 13:46945324-46945346 AAAAGTATTCAGTTTTAAAAAGG - Intergenic
1108175474 13:47788167-47788189 CAATGCAATCCCTATCAAAATGG + Intergenic
1108324903 13:49320488-49320510 AAATGCATTCAGTTTTAAAATGG - Intronic
1108419399 13:50233490-50233512 AAAAGCATTCTGTTTTAAAAGGG + Intronic
1108872683 13:55005839-55005861 AAAAGCATTCAGTTTTAAAAAGG - Intergenic
1108906767 13:55485584-55485606 CAAGTAATTCAGTTTCAAAATGG - Intergenic
1108944448 13:56003380-56003402 GAAAACATTCAGTTTTAAAAGGG - Intergenic
1108971470 13:56381651-56381673 AAAGGCATTCAGTTTTAAAAGGG - Intergenic
1109095675 13:58112500-58112522 CAAAGCAACAATTTTAAAAACGG + Intergenic
1109285944 13:60408720-60408742 AAAAGCATTCTGTTTTAAAAGGG + Intronic
1109324716 13:60853297-60853319 AAAAGCATTCATTTTTAAAAGGG - Intergenic
1109334917 13:60981621-60981643 AAAAGCTTTCAGTTTCAGAAGGG - Intergenic
1109522445 13:63531690-63531712 AAAGGCATTCAGTTTTAAAAGGG + Intergenic
1109616161 13:64836752-64836774 AAAAGCATTCAGTTTCAAAAGGG + Intergenic
1109641908 13:65202450-65202472 AAAGGCATTCAGTTTTAAAAGGG + Intergenic
1109681244 13:65756027-65756049 AAAAGCATTCAGTTTTAAAAGGG + Intergenic
1109812020 13:67525715-67525737 AAAAGCATTCAGTTTTAAAAGGG + Intergenic
1109830474 13:67780662-67780684 CAATGTACTCATTTTCAAAAGGG + Intergenic
1109859492 13:68179119-68179141 AAAAGCATTCAGTTTTAAAAGGG + Intergenic
1110083451 13:71346225-71346247 AAAAGCATTCAGTTTTAAAAGGG - Intergenic
1110395858 13:75028943-75028965 AAAGGCATTCAGTTTTAAAAGGG + Intergenic
1110511374 13:76355425-76355447 AAAAGGATTCAGTTTTAAAAGGG + Intergenic
1110514496 13:76393896-76393918 CAAAATAATCAATTTGAAAAAGG + Intergenic
1111045848 13:82812432-82812454 AAAAGCATTCAGTTTTAAAAAGG + Intergenic
1111103080 13:83612203-83612225 AAAGGCATTCAGTTTCATAAGGG - Intergenic
1111334187 13:86800213-86800235 AAAAGCATTCAGTTTTAAAAGGG + Intergenic
1111343047 13:86913570-86913592 AAAAGCATTCAGTTTTAAAAGGG + Intergenic
1111642368 13:90984798-90984820 CACAGCACTCACTTTGAAAAAGG + Intergenic
1111645000 13:91021627-91021649 CACAGCAAACAGTTTTAAACAGG - Intergenic
1112180321 13:97072054-97072076 CAAAGCAAACATTTTCTAACAGG - Intergenic
1112205931 13:97323205-97323227 TATTGCAATCAGTTTGAAAAAGG + Intronic
1112673186 13:101665710-101665732 GAAAGCTATCAGAATCAAAATGG + Intronic
1112761256 13:102695884-102695906 CATTGCAATCAGTTTTTAAAAGG - Intergenic
1112812355 13:103233613-103233635 AAAAGCATTCAGTTTTAAAAGGG + Intergenic
1113947793 13:114054258-114054280 CAAATAATTCAGTTTAAAAAGGG + Intronic
1114129004 14:19766941-19766963 CAATGCAATCCCTATCAAAATGG - Intronic
1114152601 14:20061525-20061547 CAGAGCATTTGGTTTCAAAAAGG - Intergenic
1114321087 14:21547604-21547626 AAAGGCATTCTGTTTCAAAACGG - Intergenic
1114380450 14:22198253-22198275 AAAAGCATTCAGTTTTATAAGGG + Intergenic
1114785840 14:25597502-25597524 CAAGGCAATCAGATAAAAAATGG + Intergenic
1114931857 14:27480838-27480860 TAAAACAATCAGTTTCCAAGAGG + Intergenic
1114989819 14:28272788-28272810 TAAGGCATTCAGTTTTAAAAGGG - Intergenic
1115068916 14:29297530-29297552 AAAAGCATTCAGTTTTATAAGGG - Intergenic
1115113609 14:29854518-29854540 AAAGGCACTCAGTTTTAAAAGGG + Intronic
1115132629 14:30072407-30072429 CAAAGCAATCAGTTTCAAAATGG + Intronic
1115199183 14:30834804-30834826 AAAAGCATTCAGTTTCAAAAGGG - Intergenic
1115840357 14:37462585-37462607 AAAGGCATTCAGTTTCAGAAAGG - Intronic
1115841942 14:37482235-37482257 CAAAACACCCAGTTTAAAAATGG + Intronic
1115878713 14:37891463-37891485 AAAAGCCTTCAGTTTTAAAAAGG + Intronic
1115893874 14:38062004-38062026 AAAGGCATTCAGTTTTAAAAGGG - Intergenic
1115929698 14:38477608-38477630 AAAAGCATTCAGTTTTATAAGGG + Intergenic
1116095239 14:40359281-40359303 AAAAGCATTCAATTTTAAAAGGG + Intergenic
1116127115 14:40801475-40801497 AAAAGCATTCAGTTTCAAAAGGG - Intergenic
1116133631 14:40892015-40892037 AAAACCACTCAGTTTTAAAAGGG - Intergenic
1116281614 14:42915257-42915279 AAAGGCATTCAGTTTTAAAAGGG - Intergenic
1116377526 14:44222649-44222671 CAAAGTAATTAGTTTCAAGTGGG - Intergenic
1116590180 14:46761647-46761669 AAAGGCATTCAGTTTCATAAAGG - Intergenic
1116762030 14:49026669-49026691 AAAGGCATTCAGTTTTAAAAGGG + Intergenic
1117186220 14:53243470-53243492 CAGAGTATTCAGTTTCAAAAGGG + Intergenic
1117192995 14:53312114-53312136 AAAGGCATTCAGTTTTAAAAGGG - Intergenic
1117840908 14:59859942-59859964 AAAGGCAGTCAGTTTCATAAGGG + Intronic
1118243028 14:64080120-64080142 CAAAACATTCTGTTTAAAAAGGG - Intronic
1118402931 14:65395866-65395888 AAAAGCATCCAGTTTTAAAAGGG - Intergenic
1118524349 14:66622562-66622584 AAAGGCATTCAGTTTTAAAAGGG - Intronic
1118532928 14:66727730-66727752 AAAGGCATTCAGTTTTAAAAGGG + Intronic
1119142898 14:72284127-72284149 AAAAGCATTCAGTTTTGAAAGGG + Intronic
1120068704 14:80077760-80077782 CAAAGGAATAAGAGTCAAAATGG + Intergenic
1120083133 14:80237581-80237603 AAAAGCATTCAGTTTTAAAAGGG - Intronic
1120152647 14:81054805-81054827 AAAGGCATTCAGTTTTAAAAAGG + Intronic
1120384789 14:83830921-83830943 CAAAGCAAACAATTTTTAAATGG + Intergenic
1120467703 14:84882349-84882371 AAAAGCAATCAGTCCCAAAGAGG + Intergenic
1120636926 14:86964675-86964697 AAAAGCATTCAGTTTTATAAGGG + Intergenic
1120789960 14:88571207-88571229 AAAACCCATCAATTTCAAAACGG + Intronic
1121462023 14:94087758-94087780 AAAAGCAGTCAGAGTCAAAATGG - Intronic
1121483899 14:94298793-94298815 CAAAGCATTCAGTTTTATAAGGG - Intergenic
1121881825 14:97507770-97507792 AAAAGCATTCTGTTTTAAAAGGG + Intergenic
1122756423 14:103984114-103984136 AAAGGCATTCAGTTTTAAAAGGG + Intronic
1123209462 14:106745434-106745456 CAAGGCAATCAGGTACACAAAGG + Intergenic
1123959470 15:25381015-25381037 GACAGCAATCAGTTTAAAAATGG + Intronic
1124171428 15:27376958-27376980 AAAGGCATTCAGTTTTAAAAGGG - Intronic
1124529883 15:30496403-30496425 CAAAGCAACCAGCATAAAAATGG + Intergenic
1124691464 15:31826709-31826731 AAAAGCATTCAGTTTTAAAAGGG - Intronic
1124768776 15:32511285-32511307 CAAAGCAACCAGCATAAAAATGG - Intergenic
1125067961 15:35514504-35514526 CAAAGCAATTAATTTAAAAGAGG + Intronic
1125578996 15:40772754-40772776 CAAAGCAATCTGTTCCACCAAGG + Intronic
1125696685 15:41643547-41643569 CAAAAAAATCACTTTAAAAATGG - Intronic
1126126283 15:45297396-45297418 AAAGGCATTCAGTTTTAAAAGGG + Intergenic
1126411415 15:48376543-48376565 AAAGGCACTCAGTTTTAAAAGGG + Intergenic
1126647939 15:50893936-50893958 AAAGGCATTCAGTTTCATAAGGG + Intergenic
1127164745 15:56232648-56232670 AAAAGCATTCAGTTTTAAAAAGG - Intronic
1127455526 15:59153008-59153030 AAGAGCTATCAGTTTTAAAAGGG - Intronic
1127563964 15:60168369-60168391 CACATCAATCTTTTTCAAAAGGG + Intergenic
1128136388 15:65266687-65266709 CAAAGTACTCAATTTCAAACAGG + Exonic
1128434682 15:67634980-67635002 TAAAGCAATCACTTAAAAAAGGG - Intronic
1128461823 15:67875050-67875072 CAAAGAAACCAATTTTAAAATGG - Intergenic
1129549154 15:76429696-76429718 AAAAGCATTCAATTTTAAAAGGG + Intronic
1130416837 15:83702237-83702259 AAAGGCATTCAGTTTAAAAAGGG + Intronic
1130778349 15:87008932-87008954 AAAAGCATTCAGTTTTAAAAGGG + Intronic
1131471787 15:92704043-92704065 CAAAGCAAGCAGCAGCAAAATGG + Intronic
1131724496 15:95206912-95206934 AAAGGCATTCAGTTTTAAAAGGG + Intergenic
1131743708 15:95421824-95421846 AAAAGCATTCAGTTTTAAAAGGG - Intergenic
1133133582 16:3693676-3693698 CAAACTAGGCAGTTTCAAAAAGG + Intronic
1133694880 16:8253331-8253353 CAAAGCCTTCAGCTTCAAATGGG + Intergenic
1134224278 16:12379570-12379592 AAGAGTCATCAGTTTCAAAAGGG + Intronic
1135864695 16:26090567-26090589 AAAAGCAACTAGATTCAAAAAGG + Intronic
1135919101 16:26632231-26632253 AAAAGCATTTAGTTTTAAAAGGG - Intergenic
1137627899 16:49921173-49921195 CAAAGGACTCAATTTCAACAGGG + Intergenic
1137832879 16:51561040-51561062 AAAAGTTATCAGTATCAAAATGG + Intergenic
1137981525 16:53074283-53074305 AAAGGCATTCAGTTTTAAAAGGG + Intronic
1138153111 16:54677755-54677777 CAAAGCAATAAGTGCCTAAAGGG + Intergenic
1138355971 16:56380566-56380588 AAAGGCATTCAGTTTTAAAAGGG - Intronic
1138818548 16:60230735-60230757 GAAAGCAAATAATTTCAAAAAGG - Intergenic
1139266487 16:65644444-65644466 AAAAGCACTCAGTATCAATATGG + Intergenic
1139932767 16:70542625-70542647 CAAAGCAATTAATTTCAGATGGG - Intronic
1139982343 16:70870166-70870188 AAAAGCATTCAGTTTTAAAAGGG + Intronic
1140671417 16:77283592-77283614 CAAAGACATCTGTTTTAAAAAGG - Exonic
1140926310 16:79587850-79587872 CAAAGCATTTACTTTCAAAAGGG + Intronic
1141037886 16:80644043-80644065 AAAAGCATTCAGTTTTAAAAGGG - Intronic
1141127574 16:81411783-81411805 CAAAGATATCATTTGCAAAATGG - Intergenic
1144319218 17:14097257-14097279 CAAAGCAATTAATTTGAAAAAGG - Intronic
1146110903 17:30088343-30088365 CAATGAAATCTGTTTTAAAAAGG - Intronic
1148097026 17:45059631-45059653 CAAGGAAATCAGTTACTAAAAGG - Intronic
1148640645 17:49184710-49184732 AAAGGCATTCAGTTTTAAAAGGG + Intergenic
1149216263 17:54357941-54357963 AAAGGCATTCAGTTTCATAAGGG - Intergenic
1149294732 17:55251876-55251898 CAAAGAAATCAGATGTAAAAGGG - Intergenic
1149336452 17:55640984-55641006 CAATGCAAACAATTTCAAAGTGG + Intergenic
1149366654 17:55952122-55952144 AAAAGCATTCAGTTTTACAAGGG + Intergenic
1149371046 17:55993540-55993562 AAAAGCATTCAAGTTCAAAAGGG - Intergenic
1149507682 17:57208915-57208937 CAAAGGAATAATTTTGAAAAAGG + Intergenic
1150139051 17:62713293-62713315 CAAATCAATCAGCTAGAAAATGG + Intronic
1151266015 17:72955634-72955656 CAAAGCCATGAGGCTCAAAATGG + Intronic
1153064225 18:1026759-1026781 CAAAGGAAACACTATCAAAATGG - Intergenic
1153335087 18:3915192-3915214 CAAATCACCCAGTTTAAAAATGG - Intronic
1153341013 18:3974913-3974935 AAAATTAATCAGTCTCAAAAAGG + Intronic
1153769499 18:8403821-8403843 GAAAGAAATCAGATTCAAAAGGG - Intronic
1153846009 18:9050594-9050616 AAAAGCATTCAGTTTTAAAAGGG + Intergenic
1155679599 18:28473716-28473738 AAAAGCATTCAGTTTTAAAAAGG + Intergenic
1155764034 18:29605302-29605324 TAAAGGCATCAGTTTCATAAGGG + Intergenic
1155944438 18:31832277-31832299 AAAAACAATCAGATTCAAGAAGG + Intronic
1156265974 18:35488808-35488830 AAAAGCATTCCGTTTTAAAAGGG - Intronic
1156678036 18:39554672-39554694 CAAAGCAATCAGAAACATAAAGG - Intergenic
1156858918 18:41814176-41814198 AAAAGCATTCAGTTTTAAAAGGG - Intergenic
1156892284 18:42204417-42204439 AAAAGCATTCAGTTTCAAAAGGG + Intergenic
1157003152 18:43550843-43550865 AAAAGCATTCAGTTTTATAAGGG - Intergenic
1157137714 18:45073212-45073234 CAAAGAATACAGTTTCAAAATGG - Intergenic
1158364589 18:56718757-56718779 AAAAGCAACGAGTTTCAAAAAGG - Intronic
1158574892 18:58628532-58628554 AATAGCAATAATTTTCAAAAAGG + Intronic
1158617130 18:58998438-58998460 AAACACAATCAATTTCAAAATGG - Intergenic
1159131078 18:64281091-64281113 AAAAGCCTTCAGTTTTAAAAGGG + Intergenic
1159215499 18:65386562-65386584 AAAGGCATTCAGTTTTAAAAGGG + Intergenic
1159321138 18:66850697-66850719 CCAAGCAATCAGATGTAAAATGG + Intergenic
1159392483 18:67811003-67811025 CAAGGCAAACTGTTTCAAACTGG - Intergenic
1159410793 18:68072658-68072680 AAAAGCATTCAGTTTTCAAAGGG + Intergenic
1159705361 18:71679459-71679481 AAAAACATTCAGTTTTAAAAGGG + Intergenic
1160435618 18:78850144-78850166 CCAAGCAATCTGATTAAAAATGG - Intergenic
1162877707 19:13633052-13633074 CAAAGGAAACAGATACAAAAGGG + Intergenic
1163328795 19:16622770-16622792 CAAAGCACCCAGTTTCCAGAAGG + Intronic
1163539633 19:17900106-17900128 AAAAGCATTCAGTTTTAAAAGGG + Intergenic
1164209981 19:23090465-23090487 AAAAGCACTCTGTTTTAAAAGGG + Intronic
1164330572 19:24250688-24250710 CAAAGAATCCAGTGTCAAAATGG + Intergenic
1164414135 19:28032057-28032079 AAAAGCATTCAGTTTTGAAAGGG - Intergenic
1164447337 19:28329376-28329398 AAAGGCATTCAGTTTCAAAAGGG + Intergenic
1164488837 19:28687866-28687888 AATAACAATCAGTTTCAAAAAGG + Intergenic
1164494872 19:28750535-28750557 AAAGGCATTCAGTTTCAAAAGGG - Intergenic
1164541526 19:29124931-29124953 AAAAGCATTCAGTTTTAAAAGGG - Intergenic
1164666446 19:30041959-30041981 AAAGGCATTCAGTTTTAAAAGGG + Intergenic
1165503590 19:36209950-36209972 CAAAGAAAGGAGTTACAAAAAGG + Intronic
1165568888 19:36758221-36758243 CAAAGCATTTTGTTTGAAAATGG - Intronic
1165888458 19:39096235-39096257 AAAGGCATTCAGTTTTAAAAGGG - Intronic
1167403406 19:49288174-49288196 AAAAGCATTCCGTTTTAAAAGGG + Intergenic
1168380672 19:55919871-55919893 CAAAACAATCAGAAGCAAAAAGG + Intronic
1168702376 19:58448811-58448833 AAAAGCATTCAGTTTTAAAAGGG + Intergenic
925572753 2:5329415-5329437 AAAAGCAGACAGTTACAAAAAGG + Intergenic
926947380 2:18203117-18203139 AAAGGCATTCAGTTTTAAAAGGG + Intronic
926962470 2:18373470-18373492 CAAAGAAAACAGTTTACAAATGG + Intergenic
927409339 2:22806606-22806628 AAAAGCATTCAGTTTTAAAAGGG - Intergenic
927438275 2:23089096-23089118 AAAGGCATTCAGTTTTAAAAGGG - Intergenic
927641018 2:24845578-24845600 AATGGCAATCAGTTTTAAAAAGG + Intronic
928048812 2:27967939-27967961 GAAAGCATTCAGTTTTATAAGGG + Intronic
928474798 2:31615581-31615603 AAAAGCATTCAGTTTTAAAAAGG + Intergenic
928715752 2:34058047-34058069 CATAGAAATGAGTTTCAAATAGG + Intergenic
928853770 2:35780902-35780924 AAAAGCATTCTGTTTTAAAAGGG + Intergenic
929275503 2:40020944-40020966 AAAAGCATTCAGTTTTAAAAGGG + Intergenic
929358051 2:41050363-41050385 AAAGGCATTCAGTTTCAAAAGGG + Intergenic
930076087 2:47406846-47406868 AAAGGCATTCAGTTTTAAAAGGG + Intronic
930254421 2:49073639-49073661 CAATGCAATCCCTATCAAAATGG + Intronic
930263081 2:49169901-49169923 AAAGGCATTCAGTTTTAAAAGGG + Intergenic
930484777 2:51998470-51998492 AAAGGCATTCAGTTTTAAAATGG + Intergenic
930503774 2:52256169-52256191 AAAGACATTCAGTTTCAAAAGGG - Intergenic
930558550 2:52930289-52930311 AAAAGCATTCAGTTTTATAAGGG - Intergenic
930942179 2:57026251-57026273 GAAAGCATTGAGTTTTAAAAGGG - Intergenic
931033569 2:58211630-58211652 AAAAGCATTTAGTTTTAAAAGGG - Intronic
931610589 2:64095237-64095259 GAAACCAATCAGTTACAAGATGG - Exonic
932365193 2:71147029-71147051 CAAAGCTATCAATTACAAAAAGG - Intronic
932428362 2:71658047-71658069 AAAAGCATTCTGTTTTAAAAGGG - Intronic
932487349 2:72092204-72092226 CTGAGTAATCAGGTTCAAAAGGG + Intergenic
932912353 2:75818786-75818808 AAAAGCATTCTGTTTTAAAAGGG - Intergenic
932927201 2:75990143-75990165 AAAAGCATTCAGTTTTATAAGGG - Intergenic
932960579 2:76408449-76408471 GAAGGCATTCAGTTTTAAAAGGG + Intergenic
932976245 2:76602840-76602862 AAAAGCATTCCGTTTTAAAAGGG - Intergenic
933397953 2:81755283-81755305 AAAAGCATTCTGTTTTAAAAGGG - Intergenic
933419871 2:82031389-82031411 AAAGGCATTCAGTTTCAAAAGGG - Intergenic
933461646 2:82594954-82594976 CTTATCAATCAGTCTCAAAAAGG - Intergenic
933790689 2:85881719-85881741 AAAGGCATTCAGTTTTAAAAGGG + Intronic
934054923 2:88243584-88243606 TAAAGCATTCGGTTTTAAAAGGG + Intergenic
934106983 2:88703853-88703875 AAAAGCATTCAGTTTTAAAAGGG - Intronic
934128980 2:88928112-88928134 CAAAGCAAGCAGTGTCTAAATGG + Intergenic
934981175 2:98843227-98843249 CAAATAACTCAGTTACAAAATGG - Intronic
935112662 2:100106486-100106508 CAAAGCAAACATTTCCAACAAGG - Intronic
935492534 2:103737740-103737762 CAATATGATCAGTTTCAAAATGG + Intergenic
935923540 2:108041767-108041789 AAAATCATTCAGTTTCAAAAAGG + Intergenic
936471393 2:112801866-112801888 GAAAGCAATCAGCTCCACAAGGG - Intergenic
936915661 2:117637078-117637100 AAAAGCCTTCAGTTTTAAAAGGG + Intergenic
937427581 2:121813061-121813083 AAAAGCATTCTGTTTTAAAAGGG + Intergenic
937589092 2:123591955-123591977 AAAGGCAATCAGTTTTACAAGGG - Intergenic
937730391 2:125223025-125223047 AAAAGCATTCAGTTTTAAAAGGG - Intergenic
938698093 2:133852846-133852868 AAAGGCATTCAGTTTTAAAAGGG + Intergenic
939069987 2:137527534-137527556 CAAAAAAAGGAGTTTCAAAATGG - Intronic
939174845 2:138736757-138736779 TAAAGGATTCAGTTTTAAAAGGG - Intronic
939287764 2:140154715-140154737 AAAAGCATTCTGTTTTAAAAGGG - Intergenic
939506345 2:143052240-143052262 AAAGGCATTCAGTTTTAAAAGGG + Exonic
939758066 2:146138062-146138084 AAAAGTATTCAGTTTTAAAAGGG - Intergenic
940135860 2:150435460-150435482 AAAGGCATTCAGTTTTAAAAGGG + Intergenic
940537420 2:154963294-154963316 TAAAGCACTGAGTTTAAAAAGGG - Intergenic
940815039 2:158288388-158288410 AAAGGCATTCAGTTTTAAAAGGG - Intronic
941099122 2:161277770-161277792 CCAACCAATCAATTTCAACATGG - Intergenic
941137200 2:161733015-161733037 GAAAGCATTCAGTTTTAAAAGGG + Intronic
941157937 2:162001743-162001765 CAAAGGAATCAGATCCAAAGAGG - Intronic
941303222 2:163829295-163829317 TAAGGCATTCAGTTTTAAAAGGG - Intergenic
941374382 2:164708826-164708848 GAAAGCAATCAGTTGAAACAAGG - Intronic
941649708 2:168080266-168080288 AAAGGCATTCAGTTTTAAAAGGG + Intronic
941803667 2:169688358-169688380 AAGAGCATTCAGTTTCAAAAGGG - Intronic
942118246 2:172749788-172749810 AAAAACATTCAGTTTTAAAAGGG - Intronic
942191851 2:173478210-173478232 CAAAGCCAGAAGTTTGAAAATGG - Intergenic
942423581 2:175835238-175835260 CAAAGCAAACACTTTAACAAGGG - Intergenic
942517869 2:176772729-176772751 AAAGGCATTCAGTTTTAAAAGGG + Intergenic
942772100 2:179533890-179533912 CACAGCTCTCAGGTTCAAAATGG + Intronic
942873119 2:180760449-180760471 CAAAACAAACAGTTTGCAAAAGG + Intergenic
943017223 2:182528449-182528471 AAAAGCATTCAGTTTTAAAAGGG + Intergenic
943100103 2:183477888-183477910 CAAAGCAATTAATTACTAAAAGG + Intergenic
943483905 2:188456089-188456111 AAAGGCATTCAGTTTCAAATGGG + Intronic
943511181 2:188829892-188829914 TAAAGCATTCAGTTTTGAAAGGG + Intergenic
943543347 2:189244289-189244311 AAAGGCATTCAGTTTTAAAAGGG - Intergenic
943717187 2:191165150-191165172 CAAAGAACACAGTTTTAAAATGG + Intergenic
943804842 2:192111523-192111545 AAAAGCATTCAGTTTTAAAAGGG + Intronic
944021505 2:195110785-195110807 CCTAGAAAACAGTTTCAAAAGGG - Intergenic
944639332 2:201707265-201707287 CAGAGAAATCAGCCTCAAAATGG - Intronic
944748771 2:202686081-202686103 CAAACCTATCAGTTAAAAAATGG + Intronic
945073570 2:206015114-206015136 AGAAGCATTCAGTTTTAAAAGGG + Intronic
945098212 2:206239472-206239494 AAAAGAAATGAGGTTCAAAAAGG - Intergenic
945181016 2:207091190-207091212 AAAAGCAAACAGTTTGAAATGGG - Intronic
945433715 2:209795335-209795357 AAAGGCATTCAGTTTTAAAAGGG + Intronic
945713408 2:213329578-213329600 AAAGGCATTCAGTTTCAAAAGGG + Intronic
946499503 2:220231334-220231356 CAAAGCAAGCAGCTCTAAAATGG - Intergenic
946978779 2:225183550-225183572 CAAAGCTACCCATTTCAAAACGG - Intergenic
947099453 2:226604182-226604204 CAGAGAGATCAGTTTCAAACAGG - Intergenic
947296496 2:228636138-228636160 AAAGGCATTCAGTTTTAAAAGGG - Intergenic
947416721 2:229904097-229904119 CAAAGCTAGCATTTTTAAAAAGG + Intronic
947886589 2:233576829-233576851 AAAGGCATTCAGTTTTAAAAGGG - Intergenic
947888501 2:233595293-233595315 AAAGGCATTCAGTTTTAAAAGGG + Intergenic
947893506 2:233646469-233646491 AAAGGCATTCAGTTTTAAAAGGG - Intronic
948296705 2:236865919-236865941 AAATGCATTCAGTTTCATAAGGG - Intergenic
1169098051 20:2920999-2921021 TTAAGCAAACAGTTCCAAAAAGG - Intronic
1169357636 20:4921039-4921061 TAAAGCAATCAGATACAATAAGG + Intronic
1169594002 20:7177229-7177251 AAAAGCATTCAGTTTTAAAAGGG - Intergenic
1169609613 20:7364355-7364377 AAAGGCATTCAGTTTTAAAAGGG + Intergenic
1169780341 20:9302509-9302531 CACAGCCACCAGTTTCAAATTGG + Intronic
1170062456 20:12273359-12273381 AAAAGCATTCTGTTTTAAAAGGG - Intergenic
1170310006 20:14982248-14982270 AAATGCATTCAGTTTCAGAAGGG + Intronic
1170474952 20:16705687-16705709 AAAAGCATTCAGTTTAAAAAGGG + Intergenic
1170701105 20:18704425-18704447 CAATGGACTCAGGTTCAAAAGGG + Intronic
1170710663 20:18787468-18787490 AAAGGCACTCAGTTTCAAAAGGG - Intergenic
1170741752 20:19064735-19064757 AAGAGCATTCAGTTTTAAAAGGG + Intergenic
1171183483 20:23108374-23108396 CAAAGAAATCAGATCCAGAAAGG + Intergenic
1171999399 20:31760962-31760984 CAAAAGAATCAATTTCAAGAAGG - Intronic
1172924185 20:38515544-38515566 TAAAGCCATAAATTTCAAAACGG - Intronic
1173405737 20:42762875-42762897 CAAGGCAAGCAGTTGAAAAAGGG - Intronic
1173541206 20:43852801-43852823 CATACCAATCAATTACAAAAGGG - Intergenic
1175008422 20:55710422-55710444 AAAAGCATACAGTTTTAAAAGGG + Intergenic
1175255591 20:57644952-57644974 AAAGGCATTCAGTTTTAAAAGGG + Intergenic
1176358551 21:5973392-5973414 CAAGGCATTCAGTTTTATAAGGG + Intergenic
1177067879 21:16463649-16463671 AAAGGCAATCAGTTTTATAAGGG + Intergenic
1177177218 21:17713291-17713313 AAAGGCAATCAGTTTTATAAGGG - Intergenic
1177204915 21:17999027-17999049 AAAAGCATTCTGTTTTAAAAGGG - Intronic
1177242961 21:18484991-18485013 TAAAACAATCAGTATCAGAAAGG - Intronic
1177258278 21:18693605-18693627 AAAGGCATTCAGTTTTAAAAGGG - Intergenic
1177285233 21:19040768-19040790 AAAAGAATTCAGTTTTAAAAGGG - Intergenic
1177333513 21:19693383-19693405 CAAAGCAGACAGTCTCTAAATGG + Intergenic
1177334604 21:19707354-19707376 AAAGGCATTCAGTTTTAAAAGGG + Intergenic
1177339836 21:19784350-19784372 AAAGGCATTCAGTTTTAAAAGGG - Intergenic
1177393265 21:20502740-20502762 CAAGGCATTCAGTTTTATAAGGG - Intergenic
1177472076 21:21572016-21572038 AAAGGCATTCAGTTTTAAAAGGG + Intergenic
1177487548 21:21778443-21778465 TAAAGCATTCAGTTTTATAAGGG - Intergenic
1177495849 21:21890509-21890531 GAAGGCAATCAGTTTTACAATGG - Intergenic
1177555455 21:22682184-22682206 AAACGCATTCAGTTTTAAAAGGG - Intergenic
1177599168 21:23288709-23288731 AAAAGCATTCAGTTTTAAAGGGG + Intergenic
1177684591 21:24419422-24419444 AAAGACATTCAGTTTCAAAAGGG - Intergenic
1177741075 21:25154471-25154493 AAAAGCATTTAGTTTTAAAAGGG + Intergenic
1178679673 21:34663046-34663068 AAAAGAAATCAGTATAAAAAAGG + Intergenic
1179332007 21:40412646-40412668 AAAGGCATTCAGTTTTAAAAGGG + Intronic
1179450122 21:41462835-41462857 AAAGGCATTCAGTTTCAAAAGGG + Intergenic
1179518999 21:41929960-41929982 GAAAGCAGGCACTTTCAAAAGGG + Intronic
1179764967 21:43565158-43565180 CAAGGCATTCAGTTTTATAAGGG - Intronic
1180730463 22:17978274-17978296 GAAAGCAGCCAGTTACAAAAGGG + Intronic
1182383032 22:29909357-29909379 CAAAGCACTCAATCTCAAAAAGG - Intronic
1182813440 22:33137414-33137436 AAAGGCATTCAGTTTCATAAGGG + Intergenic
1184507177 22:44911183-44911205 AAAGGCATTCAGTTTTAAAAGGG + Intronic
1184713326 22:46265998-46266020 AAAAGCATTCGGTTTTAAAAGGG - Intergenic
1184979042 22:48083031-48083053 AAAAGCAATCAGTATAAATATGG - Intergenic
1185240423 22:49740163-49740185 AAAGGCATTCAGTTTTAAAAGGG + Intergenic
949214070 3:1544226-1544248 TAAAGCAATCACTTTCCAAAGGG - Intergenic
949442725 3:4100295-4100317 CAAAGCAATAATAATCAAAATGG + Intronic
949477074 3:4458044-4458066 CAAAGAACTCAATTTAAAAATGG + Intronic
949975337 3:9452341-9452363 CAAAGCACTCATTTTATAAATGG - Intronic
950245068 3:11408077-11408099 AAAGGCATTCAGTTTCAAAAGGG - Intronic
950627901 3:14261508-14261530 CAAAGCCATCCGTTTACAAATGG - Intergenic
951115140 3:18852529-18852551 CAAAGCAATTTATTTCAAGAAGG + Intergenic
951127084 3:18996638-18996660 AAAAACATTCAGTTTTAAAAGGG - Intergenic
951192387 3:19785939-19785961 AAAAGCATTCTGTTTTAAAAGGG + Intergenic
951290038 3:20863791-20863813 AAAGGCATTCAGTTTTAAAAGGG - Intergenic
951317507 3:21204889-21204911 AAAGGCATTCAGTTTTAAAAGGG + Intergenic
951324510 3:21286116-21286138 AAAAGCATTCAGATTTAAAAGGG + Intergenic
951410852 3:22364410-22364432 CAAAGCAACCTGATTAAAAATGG + Intronic
951447331 3:22798062-22798084 AAAAGCACTCAATCTCAAAAGGG + Intergenic
951452265 3:22852786-22852808 AAAGGCATTCAGTTTCATAAGGG - Intergenic
952105601 3:30066001-30066023 AAAGGCAATCAGTTTTATAAGGG - Intergenic
952541220 3:34370288-34370310 AAAGGCATTCAGTTTTAAAAGGG + Intergenic
952635442 3:35523532-35523554 CAAAGAAACCAGTTTAAAAAGGG - Intergenic
952666266 3:35908308-35908330 CAAAGCAGTCAGGTTCTAAATGG - Intergenic
952715158 3:36472524-36472546 AAAAGCATTCAGTTTTAAAAGGG - Intronic
952732021 3:36648684-36648706 CAAATGAATGAGTTTGAAAAGGG - Intergenic
953715994 3:45317508-45317530 AAAAACAATGAGTTTCAACATGG + Intergenic
954891901 3:53938340-53938362 CAAAGGAATGAGCTACAAAATGG + Intergenic
955009799 3:55002988-55003010 GAAGGCATTCAGTTTTAAAAGGG - Intronic
955265290 3:57437479-57437501 AAAAGAACTCAGTTTCAGAAAGG + Intronic
955435551 3:58895289-58895311 AAAGGCATTCAGTTTTAAAAGGG - Intronic
955584273 3:60459478-60459500 CAATGCCCTCACTTTCAAAATGG + Intronic
955669573 3:61389231-61389253 CAAAACAATCTTTTTAAAAAAGG + Intergenic
955950462 3:64238029-64238051 CAAGGCCATCATTTTGAAAATGG + Intronic
956169606 3:66422325-66422347 AAAGGCATTCAGTTTCAAAAGGG - Intronic
956363146 3:68470725-68470747 AAAAGCATTCTGTTTTAAAAGGG + Intronic
956474897 3:69609610-69609632 AAAGGCATTCAGTTTTAAAAGGG + Intergenic
956709814 3:72029410-72029432 GAAAGCAATGTCTTTCAAAAAGG - Intergenic
956932130 3:74055593-74055615 CAAAGCAAACAGTGCAAAAAGGG - Intergenic
957105710 3:75884102-75884124 AAAAGCATTCAGTTTTAAAAGGG - Intergenic
957407542 3:79790873-79790895 AAAAGCATTCTGTTTTAAAAGGG - Intergenic
957674231 3:83346530-83346552 AAAGGCATTCAGTTTTAAAAGGG + Intergenic
957697121 3:83653543-83653565 CAAAGGAAGAAGTTTAAAAAAGG + Intergenic
957787391 3:84900697-84900719 AAAAGCATTCTGTTTTAAAAAGG + Intergenic
957873056 3:86112287-86112309 TAAAGCATTCAGTTTTAAAAGGG + Intergenic
957949467 3:87106752-87106774 CAAAGCATTCAGTTTTAAATGGG + Intergenic
957981665 3:87519219-87519241 AAAAGCATTCAATTTTAAAAGGG + Intergenic
958157368 3:89771860-89771882 AAGAGCATTCAGTTTCATAAGGG - Intergenic
958175235 3:89989113-89989135 AAAAGCATTCAGTTTTACAAGGG + Intergenic
958467787 3:94479632-94479654 CAAAGCAAACATTTTTAAACAGG - Intergenic
958611962 3:96437178-96437200 AAAAGCATTCAGTTTTATAAGGG - Intergenic
958860943 3:99445055-99445077 AAAAGCATTCAATTTTAAAAGGG + Intergenic
959054391 3:101553337-101553359 AAAGGCGTTCAGTTTCAAAAGGG + Intergenic
959100190 3:102001333-102001355 AAAAGCAGCCAGTTTGAAAAGGG - Intergenic
959172591 3:102860527-102860549 AAAAGCATTTAGTTTTAAAAGGG - Intergenic
959235726 3:103719089-103719111 AAAAGCATTCTGTTTTAAAAGGG - Intergenic
959268013 3:104168239-104168261 AAAACCATTCAGTTTTAAAAGGG - Intergenic
959277293 3:104292695-104292717 GAAAGCTGTCAGATTCAAAATGG - Intergenic
959316970 3:104821540-104821562 AAAAGCATTCAGTTATAAAAGGG + Intergenic
959342609 3:105149622-105149644 AAAGGCATTCAGTTTTAAAAGGG - Intergenic
959465190 3:106677485-106677507 TAAAGCAAATAGTTTCAGAATGG - Intergenic
959752978 3:109860037-109860059 CAAAGCCCTCCATTTCAAAAAGG + Intergenic
959754798 3:109884202-109884224 GAAGGCATTCAGTTTTAAAAGGG - Intergenic
960506236 3:118498158-118498180 AAGAGCAATTTGTTTCAAAATGG - Intergenic
961007658 3:123415548-123415570 AAAAGTAATCATTTTCTAAACGG - Intronic
961132539 3:124482439-124482461 AAAGGAAATCAGTTCCAAAAAGG - Intronic
962466977 3:135669660-135669682 CAAAGCAGTCAGCCTAAAAAGGG + Intergenic
962689311 3:137877839-137877861 AAAGGCATTCAGTTTTAAAAGGG + Intergenic
962946327 3:140174097-140174119 AAAAGCATTCAGTTTTAAAAGGG - Intronic
963160132 3:142142547-142142569 CAAGGCAATCCCTATCAAAATGG + Intronic
963167354 3:142218907-142218929 CAAAGAACTCAATTTGAAAATGG + Intronic
963267046 3:143250089-143250111 CAGGGCAATCATCTTCAAAATGG + Intergenic
963368495 3:144368038-144368060 AAAAGCATTCAGTTTTAAAAGGG - Intergenic
963422157 3:145073786-145073808 AAAAGCACTCAGTTTTAAAAGGG - Intergenic
963494561 3:146043171-146043193 AAAGGCATTCAGTTTTAAAAGGG - Intergenic
963952772 3:151221231-151221253 AAAAGCATTCAGTTTTATAAGGG + Intronic
964426659 3:156561361-156561383 AAAAGCATTCTGTTTTAAAAGGG + Intergenic
964427327 3:156567843-156567865 AAAGGCATTCAGTTTTAAAAGGG + Intergenic
964534545 3:157705493-157705515 CAAGGCAATCAGGTACAAGAGGG - Intergenic
964605452 3:158555878-158555900 AAAAGCATTCAGTTTTAAAAGGG + Intergenic
964912701 3:161801559-161801581 AAAGGCATTCAGTTTTAAAAGGG - Intergenic
965244383 3:166248780-166248802 AAAGGCATTCAGTTTTAAAAGGG + Intergenic
965251490 3:166349430-166349452 AAAGGCATTCAGTTTTAAAAGGG + Intergenic
965408249 3:168297496-168297518 AAAACAAATCAGTTTAAAAATGG - Intergenic
965838752 3:172880137-172880159 AAAGGCATTCGGTTTCAAAAGGG + Intergenic
965989532 3:174800056-174800078 AAAGGCATTCAGTTTTAAAAGGG + Intronic
966031632 3:175356036-175356058 AAAAACAAACAGTTTCAATAGGG + Intronic
966059298 3:175735019-175735041 AAAGGCATTCAGTTTTAAAAGGG - Intronic
966124981 3:176565186-176565208 CAAATCAATCACTTTTAACATGG - Intergenic
966466331 3:180234312-180234334 AAAGGCATTCAGTTTTAAAAGGG - Intergenic
966512248 3:180776900-180776922 AAAAGCATTCAGTTTTAAAAGGG - Intronic
967462352 3:189761286-189761308 AAATGCATTCAGTTTCAAAAGGG - Intronic
967505309 3:190246562-190246584 AAAGGCATTCAGTTTCAAAAGGG - Intergenic
967513730 3:190341770-190341792 AAATGCATTCAGTTTTAAAAGGG - Intronic
967614445 3:191547793-191547815 AAAAGCATTCAGTTTTAAAAGGG - Intergenic
968295071 3:197570251-197570273 AAAAGCATTCAGTTTTAAAAGGG + Intronic
968387449 4:154686-154708 AAAAGCATTCAGTTTTAAAAGGG + Intronic
969904611 4:10382597-10382619 AAAAGCATTCAGTTTTATAAGGG + Intergenic
970344093 4:15136393-15136415 AAAAGCATTCAGTTTTAAAAGGG - Intergenic
970801390 4:19976914-19976936 AAAGGCATTCAGTTTCAACAGGG - Intergenic
971510392 4:27416933-27416955 AAAGGCATTCAGTTTTAAAAAGG + Intergenic
971613651 4:28759298-28759320 CAATGGAATCAGTAGCAAAAAGG - Intergenic
971814927 4:31475553-31475575 TAAAGCATTCAGTTTCAAAAGGG - Intergenic
971875275 4:32300598-32300620 AAAGGCATTCAGTTTTAAAAGGG + Intergenic
971899630 4:32642736-32642758 CAAAACATTCACTTTCTAAATGG - Intergenic
972063372 4:34909703-34909725 AAAAGCATTCAGTTTTAAAAGGG + Intergenic
972108139 4:35519716-35519738 CAAATGGATCAGTATCAAAATGG - Intergenic
972467445 4:39370908-39370930 AAAGGCATTCAGTTTCAAATGGG + Intergenic
972857182 4:43120921-43120943 AAAAGCATTCTGTTTTAAAAGGG - Intergenic
973015797 4:45135371-45135393 AAAAGTATTCAGTTTTAAAAGGG - Intergenic
973022820 4:45224794-45224816 AGAGGCATTCAGTTTCAAAAGGG + Intergenic
973107928 4:46362783-46362805 CAAAGCAATGGTTTGCAAAATGG + Intronic
973182870 4:47290857-47290879 AAAGGCATTCAGTTTCATAAGGG + Intronic
973224706 4:47770062-47770084 CAAAGAAATAACTTACAAAATGG + Intronic
974012960 4:56624291-56624313 AAAAGCATTCTGTTTTAAAAGGG + Intergenic
974191494 4:58509848-58509870 CAAAGCAGCCAGGTTTAAAAGGG - Intergenic
974322446 4:60369003-60369025 AAAAGTATTCAGTTTTAAAAAGG + Intergenic
974395077 4:61323457-61323479 GAAGGCATTCAGTTTCAAAGGGG - Intronic
974480669 4:62438619-62438641 AAAAGCATTTAGTTTTAAAATGG - Intergenic
974614786 4:64267027-64267049 AAAGGCATTCAGTTTTAAAAGGG - Intergenic
974721884 4:65750777-65750799 CAAAGCAATAAATTTTTAAATGG - Intergenic
974846085 4:67352279-67352301 AAAGGCATTCAGTTTTAAAAGGG - Intergenic
975214487 4:71737944-71737966 AAAGGCATTCAGTTTCATAAGGG + Intergenic
975216444 4:71761390-71761412 AAAGGCATTCAGTTTCAAAAGGG + Intronic
975237918 4:72022247-72022269 CAAAGAAAGCATTTTAAAAAGGG - Intergenic
975350459 4:73339927-73339949 AGAAGCATTCAGTTTTAAAAGGG - Intergenic
975456427 4:74596867-74596889 AAAAGTATTCAGTTTTAAAAGGG + Intergenic
975507080 4:75149218-75149240 AAAAGCATTCAGTTTTAAAAAGG - Intergenic
975549547 4:75597343-75597365 TAAAGAAAACAGTTTCAAAAAGG - Intronic
975680741 4:76873448-76873470 CAAAGTAGTCAGTTTAGAAATGG - Intergenic
975890238 4:79018788-79018810 CATAGAAATCAGTTTCACATGGG + Intergenic
975952282 4:79788584-79788606 AAAGGCATTCAGTTTCAAAAGGG + Intergenic
976051053 4:81012001-81012023 AAAAGCATTCAGTTTTATAAGGG + Intergenic
976057026 4:81081015-81081037 AAAGGCATTCAGTTTTAAAAGGG + Intergenic
976235724 4:82894649-82894671 CAAAGAAATCAGTTTACAAATGG - Intronic
976237745 4:82917500-82917522 CAAAGCATTCAGTTTATTAATGG + Exonic
976444741 4:85117612-85117634 AAAAGCATTCAGTTTTAAAAGGG + Intergenic
976461255 4:85314987-85315009 AAAAGCATTCAGTTTTAAAAGGG - Intergenic
976723232 4:88190923-88190945 CAAATAACTCAGTTTAAAAAGGG + Intronic
976935733 4:90629834-90629856 TAAATCAATTACTTTCAAAAAGG + Intronic
977022282 4:91773005-91773027 AAAGGCATTCAGTTTTAAAAGGG - Intergenic
977080779 4:92524794-92524816 CAAAGATATCAGTTTCCAGAAGG - Intronic
977189073 4:93977441-93977463 AAAGGCATTCAGTTTTAAAAGGG + Intergenic
977339792 4:95743998-95744020 AAAGGCATTCAGTTTCATAAGGG + Intergenic
977393870 4:96448249-96448271 TAAAGCATTCAGTTTTAAAAGGG + Intergenic
977395820 4:96469210-96469232 AAAGGCATTCAGTTTTAAAAGGG - Intergenic
977435391 4:96988907-96988929 AAAAGCATTCAGTTTTATAAGGG + Intergenic
977463727 4:97357456-97357478 AAAAGCATTCAGTTGTAAAAGGG - Intronic
977504011 4:97878892-97878914 AAAAGGATTCAGTTTTAAAAGGG - Intronic
977579000 4:98704415-98704437 AAAGGCATTCAGTTTTAAAAGGG + Intergenic
977770640 4:100854108-100854130 CAAAGCAACCAGTTTAAATTTGG - Intronic
977953897 4:103004624-103004646 CAAAGCAATCAGATTCTCCAAGG + Intronic
977996473 4:103502198-103502220 AAAAGCATTCAGTTTTAAAAGGG + Intergenic
979093696 4:116518488-116518510 AAAAGCATTCAGTTTTAAAAGGG - Intergenic
979136212 4:117115300-117115322 AAAAGCATTCATTTTTAAAAGGG - Intergenic
979166867 4:117544762-117544784 CAAAGCAGGCAGTCTCTAAATGG + Intergenic
979177077 4:117678850-117678872 AAAGGCATTCAGTTTTAAAAGGG + Intergenic
979390189 4:120118425-120118447 AAAGGCATTCAGTTTTAAAAGGG - Intergenic
979391976 4:120138594-120138616 AAAGGCATTCAGTTTTAAAAGGG - Intergenic
979426477 4:120573003-120573025 AAAGGCATTCAGTTTTAAAAGGG - Intergenic
979500552 4:121434886-121434908 AAAGGCACTCAGTTTTAAAAGGG - Intergenic
980005988 4:127542908-127542930 AAAAGTTATCAGTATCAAAATGG + Intergenic
980266676 4:130525000-130525022 AAAAGCATTCAGTTTAAAAAGGG + Intergenic
980445297 4:132898428-132898450 CAAATGACTCAGTTTAAAAATGG + Intergenic
980577645 4:134705578-134705600 ACAAGCAATAAGTTTCTAAAAGG + Intergenic
980618717 4:135268893-135268915 CAAAGAAATCTGTTTTTAAAAGG + Intergenic
980850467 4:138374722-138374744 AAAGGCATTCAGTTTTAAAAGGG - Intergenic
980977829 4:139628059-139628081 CAAGGCAAACAGTTTAAAATGGG - Intergenic
981271742 4:142853780-142853802 GAAAGTTATCAGTATCAAAATGG + Intergenic
981820431 4:148880707-148880729 AAAAGCATTCAGTTTTAAAAGGG - Intergenic
981947379 4:150363541-150363563 CAAAACAATAAATTCCAAAAGGG + Intronic
982133412 4:152249949-152249971 CAAAGCAATTAAATTCAAAAGGG + Intergenic
982923351 4:161304352-161304374 AAAGGCATTCAGTTTTAAAAGGG + Intergenic
983068190 4:163236173-163236195 AAAGGCATTCAGTTTTAAAAGGG - Intergenic
983144154 4:164191761-164191783 CAAAGAAATCCATTTAAAAATGG - Intronic
983164514 4:164459237-164459259 AAAAGCATTCAGTTTTAAAGGGG + Intergenic
983245683 4:165284299-165284321 AAAGGCATTCAGTTTCGAAAGGG - Intronic
983437164 4:167730718-167730740 AAAGGCATTCAGTTTTAAAAGGG + Intergenic
984011914 4:174381638-174381660 CAAAGCTGTCAGAATCAAAATGG - Intergenic
984031714 4:174612506-174612528 AAAGGCATTCAGTTTTAAAAGGG - Intergenic
985156109 4:186988479-186988501 ATAAGCATTCAGTTTTAAAAGGG - Intergenic
985159888 4:187033737-187033759 GAAAGCATTCAGTTTTATAAGGG + Intergenic
985304199 4:188521300-188521322 CGAGGCATTCAGTTTTAAAAGGG + Intergenic
985487738 5:161304-161326 CATATTAACCAGTTTCAAAATGG + Intronic
986105577 5:4656358-4656380 GAAGGCAATCAGTTTTATAAGGG - Intergenic
986521023 5:8618443-8618465 CAAAACCTCCAGTTTCAAAATGG - Intergenic
986873489 5:12079051-12079073 CAAGGCATTCAGTTTTATAAGGG - Intergenic
986948088 5:13048431-13048453 AAAGGCATTCAGTTTTAAAAGGG - Intergenic
987252213 5:16111562-16111584 AAAAGCATTCAGTTTTAAAAGGG + Intronic
987511734 5:18848148-18848170 AAAGGCATTCAGTTTCAAAAGGG - Intergenic
987512333 5:18856238-18856260 GAAAGCATTCAGTTTCAAATGGG + Intergenic
987654902 5:20795024-20795046 AAAAGCATTCAGTTTTATAAGGG + Intergenic
987980323 5:25076141-25076163 CAATGAAATCATTTTGAAAAAGG - Intergenic
988028279 5:25727768-25727790 AAAAGCATTCAGTTTCAAAAAGG - Intergenic
988047745 5:25980168-25980190 AAAGGCATTCAGTTTTAAAACGG - Intergenic
988091152 5:26542701-26542723 AAAGGCATTCAGTTTTAAAAGGG - Intergenic
988173016 5:27683354-27683376 AAAAGCATTCAGTTCTAAAAGGG - Intergenic
988336085 5:29910342-29910364 AAAGGCATTCAGTTTTAAAAGGG - Intergenic
988394375 5:30678879-30678901 AAAGGCATTCAGTTTTAAAAGGG + Intergenic
988426918 5:31074750-31074772 AAAGGCATTCAGTTTTAAAAGGG - Intergenic
988603174 5:32657761-32657783 AAAAGCATTCAGTTTTAAAAAGG - Intergenic
988740742 5:34066913-34066935 AAAAGCATTCAGTTTTATAAGGG - Intronic
988886104 5:35559560-35559582 AAAGGCATTCAGTTTTAAAACGG - Intergenic
988886350 5:35562790-35562812 AAAGGCATTCAGTTTCACAAGGG + Intergenic
989162407 5:38404175-38404197 AATAGCAATCAGATTGAAAATGG - Intronic
989212862 5:38874051-38874073 CAAAGAACTCAATTTAAAAATGG - Intronic
989389118 5:40882235-40882257 CAAGGCATTCAGTTTTATAAGGG + Intergenic
989753352 5:44922247-44922269 AAAAGCATTCAGTTTTAAAAGGG + Intergenic
989778176 5:45233589-45233611 AAAAGCATTCAATTTTAAAAGGG - Intergenic
990077773 5:51872724-51872746 AAAAGCATTCAGTTGTAAAAGGG + Intergenic
990127057 5:52531770-52531792 AAAAGCATTCAGTTTTAAAAGGG - Intergenic
990264482 5:54060882-54060904 AAAAGCATTCAGTTTTAAAAGGG + Intronic
990429083 5:55717226-55717248 AAAAGCATTCAGTTTTATAAGGG + Intronic
990697930 5:58443112-58443134 TAAAGCAATCAGTTTCATCATGG - Intergenic
991183779 5:63784882-63784904 AAAAGCATTCTGTTTTAAAAAGG + Intergenic
991358216 5:65791923-65791945 AAAAGCATTCTGTTTCAAAAAGG + Intronic
991586942 5:68211238-68211260 AAAAGCATTCAGTTTTAAAAGGG - Intergenic
991598298 5:68326871-68326893 TAAGGCTATCAGTTTCAAAAGGG + Intergenic
992215779 5:74523632-74523654 AAAGGCATTCAGTTTTAAAAGGG + Intergenic
993015717 5:82532368-82532390 AAAAGCATTCAGTTTTAAAAGGG - Intergenic
993024095 5:82626350-82626372 AAAGGCATTCAGTTTCATAAGGG + Intergenic
993575092 5:89590753-89590775 AAAAGCATTCTGTTTTAAAAGGG + Intergenic
993869598 5:93236744-93236766 CCAAGCAATCTAATTCAAAAAGG + Intergenic
993890069 5:93462894-93462916 AAAAGCATTCAGTTTTAAAAGGG + Intergenic
993893781 5:93506017-93506039 AAAAGCATTCTGTTTTAAAAGGG - Intergenic
994440864 5:99801016-99801038 AAAGGCATTCAGTTTTAAAAGGG - Intergenic
994542864 5:101121924-101121946 AAAGGCATTCAGTTTTAAAAGGG - Intergenic
994552728 5:101258311-101258333 AAAAGCATTCTGTTTTAAAAGGG + Intergenic
994553114 5:101261845-101261867 AAAGGCATTCAGTTTTAAAAGGG + Intergenic
994576430 5:101585556-101585578 CAAAGCATTCAGTTTTAACAGGG + Intergenic
994649014 5:102503905-102503927 AAAGGCATTCAGTTTTAAAAGGG + Intergenic
994755692 5:103790884-103790906 AAAAGCATTCAGTTTTATAAGGG - Intergenic
994823259 5:104680306-104680328 TAAAGCATTCAGTTTTAAAAGGG + Intergenic
995113451 5:108453525-108453547 AAAGGCATTCAGTTTTAAAAGGG + Intergenic
995147708 5:108805814-108805836 AAAGGCATTCAGTTTCATAAAGG + Intronic
995312763 5:110731946-110731968 AAAAGCATTCAATTTTAAAAGGG - Intronic
995576460 5:113540903-113540925 CAAAGGAATACATTTCAAAAAGG + Intronic
995770070 5:115659437-115659459 GAAAGAAATCAGTCACAAAATGG + Intergenic
995852167 5:116558063-116558085 CCAAACAAACAGTTTCATAAAGG + Intronic
995975259 5:118027683-118027705 CAAATCAATCAATTTCAAACTGG + Intergenic
996004029 5:118399785-118399807 CAAATCAAGAAGTGTCAAAAAGG + Intergenic
996011325 5:118484086-118484108 AAAAGCATTCAGTTTTATAAGGG - Intergenic
996030997 5:118703664-118703686 AAAAGCATTCAGTTTTAAAAGGG - Intergenic
996196269 5:120611205-120611227 AAAAGCATTCAGTTTTATAAGGG + Intronic
996246630 5:121271872-121271894 AAAGGCATTCAGTTTTAAAAGGG - Intergenic
996247482 5:121282533-121282555 AAAGGCATTCAGTTTTAAAAGGG + Intergenic
996460113 5:123732221-123732243 AAAAGCATTCTGTTTCAAAAGGG + Intergenic
996636074 5:125691672-125691694 AAAAGAATTCAGTTTTAAAAGGG + Intergenic
996744667 5:126836405-126836427 CAAAACTTTCAGTGTCAAAAAGG - Exonic
997057243 5:130459474-130459496 AAAGGCATTCAGTTTTAAAAGGG + Intergenic
997108306 5:131046351-131046373 AAAAGCATTTAGTTTTAAAAGGG - Intergenic
998215184 5:140232812-140232834 CAAAACATTGAGTTCCAAAAAGG + Intronic
998576727 5:143324728-143324750 AAAAGCATTCTGTTTTAAAAGGG - Intronic
999345127 5:150811417-150811439 AAAAGGAACCAGTTTCTAAAAGG + Intergenic
999975281 5:156906220-156906242 CAAACAAACCAATTTCAAAATGG - Intergenic
1000947133 5:167436432-167436454 AAAGGTATTCAGTTTCAAAAGGG + Intronic
1001199374 5:169702084-169702106 CTAGGAAATCAGTTGCAAAAAGG - Intronic
1001352209 5:170980216-170980238 AAAGGCATTCAGTTTTAAAAGGG + Intronic
1001361463 5:171090429-171090451 AAAGGCATTCAGTTTTAAAAGGG + Intronic
1001684980 5:173586579-173586601 AAAGGCATTCAGTTTTAAAAGGG - Intergenic
1001968198 5:175929817-175929839 GAAAGAAATCAGTTTGAAAAAGG + Intronic
1002249247 5:177913993-177914015 GAAAGAAATCAGTTTGAAAAAGG - Intergenic
1002464797 5:179402014-179402036 CAAACAACTCAGTTACAAAATGG + Intergenic
1002624907 5:180519368-180519390 AAAAGTTATCAGTATCAAAATGG - Intronic
1002757059 6:172216-172238 AAAAGCATTCAGTTTTAAAAGGG + Intergenic
1003679930 6:8243019-8243041 CAAATCAGGCAGTTTCTAAATGG - Intergenic
1003834208 6:10050462-10050484 AAAAGCAATCATATTTAAAAAGG + Intronic
1003926957 6:10885280-10885302 CAAATCAATTAATTTCTAAAGGG + Intronic
1004514298 6:16308721-16308743 AAAAGCATTCAATTTAAAAAAGG + Intronic
1004685015 6:17934891-17934913 CAAACATATCAGTTTCACAAGGG + Intronic
1005329024 6:24731405-24731427 AAAAGTATTCAGTTTTAAAAGGG + Intergenic
1005655330 6:27929563-27929585 AAAGGCATTCAGTTTCAAAAGGG - Intergenic
1006240334 6:32672501-32672523 AAAAGCATTCCGTTTTAAAAGGG + Intergenic
1006280288 6:33047134-33047156 AAAAGCATTCAGTTTTAAAAGGG + Intergenic
1007185853 6:39971826-39971848 AAAGGCATTCAGTTTTAAAAGGG + Intergenic
1008481549 6:51991170-51991192 CCAAGAAATCTGTTTAAAAATGG + Intronic
1008541751 6:52551897-52551919 CAAAGAAGTCAGTTTTTAAAAGG - Intronic
1008774480 6:55019937-55019959 CAAACAAATCAATTTTAAAAAGG - Intergenic
1009309591 6:62133940-62133962 AAAAGCATTCAGTTTTAAAAGGG + Intronic
1009532808 6:64842816-64842838 AAAAGCACTCTGTTTTAAAAGGG + Intronic
1009701044 6:67181461-67181483 AACAGGAATCAGCTTCAAAAAGG - Intergenic
1009732112 6:67621973-67621995 AAAAGCATTTAGTTTTAAAAGGG + Intergenic
1009736578 6:67684230-67684252 CAAAAAAATTAGTTTTAAAAAGG - Intergenic
1009772413 6:68160701-68160723 AAAAGCATTCAGTTTTATAAGGG + Intergenic
1009824996 6:68856648-68856670 AAATGCATTCAGTTTTAAAAGGG + Intronic
1009882643 6:69588037-69588059 CAAAGAAATAAATTTAAAAATGG + Intergenic
1009963393 6:70552079-70552101 TAAAGCAATCAGTTTTATACAGG - Intronic
1010073494 6:71772504-71772526 GATACCAATCAGTTTGAAAACGG + Intergenic
1010550967 6:77222239-77222261 AAAGACATTCAGTTTCAAAAGGG + Intergenic
1010636161 6:78261158-78261180 AAAAGCATTCAATTTTAAAATGG - Intergenic
1010713826 6:79206084-79206106 AAAGGCAATCAGTTTTAAAAGGG + Intronic
1010810482 6:80293725-80293747 AAAAGCATTCAGTTTTAAAAGGG - Intronic
1010909605 6:81537006-81537028 AAAAGCATTCAGTTTTGAAAGGG - Intronic
1011110560 6:83833244-83833266 AAATGCATTCGGTTTCAAAAGGG + Intergenic
1011122019 6:83964532-83964554 AAAGGCATTCAGTTTTAAAAGGG + Exonic
1011236989 6:85228798-85228820 AAAGGCATTCAGTTTTAAAAGGG - Intergenic
1011326662 6:86156101-86156123 CAAAGCAGGCAATTTCTAAATGG - Intergenic
1011346169 6:86371454-86371476 TAAAGCATTCAGTTTTAAAAGGG - Intergenic
1011439235 6:87369776-87369798 AAACGCATTCAGTTTTAAAAGGG - Intronic
1012161389 6:95889201-95889223 AAAAGCATTCAGTTTAAAAAGGG - Intergenic
1012195386 6:96335311-96335333 AAAAGCATTCAATTTTAAAAGGG + Intergenic
1012239864 6:96859769-96859791 AAAGGCATTCAGTTTCAAAAGGG + Intergenic
1012569022 6:100699922-100699944 AAAAGCATTCAGTTTTAAAAGGG + Intronic
1012683162 6:102209177-102209199 AAAGGCATTCAGTTTGAAAAGGG + Intergenic
1012691578 6:102319629-102319651 AAAGGCATTCAGTTTTAAAAGGG + Intergenic
1012694759 6:102364964-102364986 AAAGGCAATCAGTTTCTACATGG + Intergenic
1012756599 6:103240019-103240041 AAAGGCACTCAGTTTTAAAAGGG + Intergenic
1013086574 6:106862803-106862825 AAAGGCATTCAGTTTTAAAAGGG + Intergenic
1013214639 6:108016060-108016082 AAAGGCACTCAGTTTTAAAAGGG - Intergenic
1013398253 6:109765873-109765895 GAAAGTAATCAGTTTACAAATGG + Intronic
1013558834 6:111284098-111284120 AAAAGCATTCAGTTTTAAATGGG - Intergenic
1013688023 6:112608871-112608893 AAAGGCATTCAGTTTTAAAAGGG + Intergenic
1013829598 6:114256055-114256077 AAAAGCATTCAGTTTTAAAAGGG - Intronic
1013890584 6:115021622-115021644 AAAAGCATTCAGTTTTATAAGGG - Intergenic
1013913121 6:115302193-115302215 CAAATAACTCAATTTCAAAAAGG - Intergenic
1014068207 6:117151153-117151175 AAAGGCATTCAGTTTCAAAAGGG - Intergenic
1014170737 6:118276583-118276605 AAATGCCATCACTTTCAAAATGG - Intronic
1014327665 6:120018827-120018849 AAAGGCATTCAGTTTTAAAAGGG - Intergenic
1014576727 6:123082625-123082647 AAAAGCATTCGGTTTTAAAAGGG - Intergenic
1014635219 6:123837550-123837572 AAAATCAAACAGTTACAAAAGGG - Intronic
1014665295 6:124230317-124230339 AAAGGCATTCAGTTTTAAAAGGG + Intronic
1014714492 6:124848708-124848730 AAAAGCATTCAGTTTTAAAAGGG + Intergenic
1014731023 6:125031420-125031442 AAAAGCATTCAGTTTTAAAAGGG - Intronic
1014771732 6:125465258-125465280 AAAGGCATTCAGTTTTAAAAGGG + Intergenic
1014932914 6:127355056-127355078 CAAAGCAATCATAGGCAAAAAGG + Intergenic
1015053737 6:128874856-128874878 AAAGGCATTCAGTTTTAAAAGGG + Intergenic
1015279840 6:131421261-131421283 CAGAACCATCAGTTTCACAATGG - Intergenic
1015947774 6:138520924-138520946 GAAAGTTATCAGTATCAAAATGG + Intronic
1016101836 6:140112327-140112349 CAAAGCAATAAGTGTCATAAAGG - Intergenic
1016177532 6:141098821-141098843 AAAAGCATTCAGTTTTATAAGGG + Intergenic
1016185358 6:141192072-141192094 AAAAGCATTCAATTTTAAAAGGG - Intergenic
1016209048 6:141505873-141505895 AAAGGCATTCAGTTTTAAAAGGG - Intergenic
1016253150 6:142071510-142071532 AAAGGCACTCAGTTTTAAAAAGG + Intronic
1016281832 6:142427204-142427226 AAAATCATTCAGTTTCAAAAGGG - Intronic
1016424096 6:143915840-143915862 AAAGGCATTCAGTTTTAAAAGGG + Intronic
1016537564 6:145125938-145125960 AAAGGCATTCAGTTTTAAAAGGG + Intergenic
1016579651 6:145615903-145615925 AAAGGCATTCAGTTTTAAAAGGG + Intronic
1016611093 6:145990508-145990530 AAAGGCATTCAGTTTTAAAAGGG - Intergenic
1017142704 6:151206266-151206288 CAAAGAAACCAGTAACAAAAGGG - Intergenic
1017637611 6:156458116-156458138 CAAAGCAATCAGCTGCACATGGG + Intergenic
1017837932 6:158196747-158196769 CAAGGAAATCAGTTTACAAATGG + Exonic
1018031946 6:159848494-159848516 AAAGGCATTCAGTTTTAAAAGGG + Intergenic
1018040942 6:159921746-159921768 AAAGGCATTCAGTTTTAAAAGGG + Intergenic
1018537546 6:164837546-164837568 CAGAACAATAAGTTTCAGAATGG - Intergenic
1019050689 6:169180720-169180742 AAATGCATTCAGTTTTAAAAGGG - Intergenic
1020418916 7:7977469-7977491 CAAAGCAATTATTTTCCAAATGG + Intronic
1020453481 7:8346295-8346317 AAAGGCATTCAGTTTCAAAAGGG + Intergenic
1020455922 7:8373846-8373868 AAAAACATTCAGTTTTAAAAGGG + Intergenic
1020584974 7:10054815-10054837 AAAGGCAATCAGTTTTAAAAGGG + Intergenic
1020718280 7:11707145-11707167 CAAAGCAACCACTTTCAAGTAGG + Intronic
1021548046 7:21838469-21838491 CAACACAATCTGTTTTAAAATGG + Intronic
1022397240 7:30000216-30000238 AAAAGCATTCTGTTTTAAAAGGG - Intergenic
1022596042 7:31714115-31714137 AAAAGCATTCAGTTTTAAAAGGG - Intergenic
1022607793 7:31833750-31833772 AAAAGCATTCGGTTTTAAAAGGG + Intronic
1023386443 7:39662418-39662440 AAAAGCATTCAGTTTTAAAAGGG - Intronic
1023788949 7:43736912-43736934 CAAAGCACAGAGTTACAAAAAGG + Intergenic
1024158346 7:46648781-46648803 GAAAGCATTCAGTTTTAAAAGGG - Intergenic
1024438619 7:49388635-49388657 AAAGGCATTCAGTTTTAAAAGGG - Intergenic
1024792716 7:52985077-52985099 AAAGGCATTCAGTTTTAAAATGG + Intergenic
1024804644 7:53123598-53123620 CATTGCAATCATTTTCACAAAGG - Intergenic
1024844736 7:53629409-53629431 CAAATCAACCAATTTAAAAATGG + Intergenic
1025064911 7:55845435-55845457 CTTAGCAAACAGTTTCAAACAGG + Intronic
1026485990 7:70821870-70821892 CAAAGAACTCAATTTAAAAATGG + Intergenic
1027466889 7:78526253-78526275 CAAATGCATCAGTTTCAAAAGGG + Intronic
1027519723 7:79190451-79190473 CAAATAAACCAGTTTAAAAATGG - Intronic
1027625969 7:80545276-80545298 AAAGGCATTCAGTTTCAAAAGGG + Intronic
1027680649 7:81216709-81216731 CAAAGAAATGAGTGCCAAAATGG + Intergenic
1027767498 7:82363920-82363942 CAAAGGAATATGATTCAAAAAGG + Intronic
1027842674 7:83333513-83333535 CAAAGAAATCAGTTACAAAAGGG + Intergenic
1028011454 7:85649230-85649252 AAAAGCATTCTGTTTTAAAAGGG - Intergenic
1028133703 7:87205453-87205475 AAAAGCATTAAGTTTTAAAAGGG - Intronic
1028143807 7:87299377-87299399 AAAGGCACTCAGTTTTAAAAAGG - Intergenic
1028253043 7:88558532-88558554 AAAAGCATTCAGTTTTAAAAGGG + Intergenic
1028790104 7:94844141-94844163 AAAGGCATTCAGTTTTAAAAGGG + Intergenic
1028814585 7:95129926-95129948 AAAGGCACTCAGTTTCAAAAGGG + Intronic
1029253196 7:99251333-99251355 CACAGCAATCAGAATCAAATTGG + Intergenic
1029818062 7:103117045-103117067 CCAAGCCATCAGTTTCAAGGAGG + Intronic
1030079009 7:105761462-105761484 CAAAGCATTTACTTTCCAAAGGG - Intronic
1030738861 7:113084641-113084663 CAAGGAAGTCAGTTTCAGAAAGG + Exonic
1030784338 7:113641323-113641345 TAAAGCATTCAGTTTTGAAAGGG - Intergenic
1030786553 7:113670521-113670543 AAAGGCATTCAGTTTTAAAAGGG + Intergenic
1031419760 7:121537378-121537400 AAAAGCAATCAATTTTAAAAAGG - Intergenic
1031545849 7:123050592-123050614 AAAAGCATTCAGTTTTAAAAAGG - Intergenic
1031807841 7:126328904-126328926 AAAGGCATTCAGTTTTAAAAGGG + Intergenic
1031816644 7:126446185-126446207 CAAAGCAAACTGATCCAAAAAGG - Exonic
1031958890 7:127971117-127971139 CAAAACAATCAGTCTGCAAAGGG - Intronic
1032107757 7:129048954-129048976 CAAAACACTTATTTTCAAAAAGG + Intronic
1032488503 7:132306243-132306265 CAAACCAGTCAGTTTGCAAAAGG + Intronic
1033289778 7:140073645-140073667 CAAAGAAATTAGGTTCAACATGG + Intergenic
1033446533 7:141427863-141427885 CAAATAATTCAGTTTAAAAATGG + Intronic
1033760059 7:144427969-144427991 AAAAGCATTCAGTTTTATAAGGG - Intergenic
1033871654 7:145761908-145761930 AAAAGCATTCAGTTTAAAAAGGG + Intergenic
1034158769 7:148977046-148977068 CAAAGCAGTTAGTTACAACATGG + Intergenic
1034622970 7:152470627-152470649 AAAAGCATTCAGTTTTTAAAGGG + Intergenic
1034740032 7:153465385-153465407 AAAGGCATTCAGTTTTAAAAGGG + Intergenic
1034750108 7:153560480-153560502 AAAAGTATTCAGTTTTAAAAGGG - Intergenic
1034751773 7:153575709-153575731 AAAAGAATTCAGTTTTAAAAGGG + Intergenic
1036457783 8:8924754-8924776 AAAAGCATTCGGTTTTAAAAGGG - Intergenic
1037003434 8:13748119-13748141 CAAGGCATTCAGTTTTATAAGGG - Intergenic
1037243522 8:16804793-16804815 CAAGGCATTCAGTTTTATAAAGG - Intergenic
1037364777 8:18109706-18109728 AAAGGTATTCAGTTTCAAAAGGG + Intergenic
1037631756 8:20664032-20664054 CATTGCAATAAATTTCAAAAAGG - Intergenic
1038725319 8:30077082-30077104 TAAAACAATCATTTTTAAAAGGG + Intronic
1039642802 8:39241945-39241967 AAAGGCATTCAGTTTTAAAAGGG - Intronic
1039657337 8:39423888-39423910 AAAAGCATTCTGTTTTAAAAGGG - Intergenic
1040616803 8:49045907-49045929 CAAGGCAAACATTTTCAAACTGG + Intergenic
1040738672 8:50544004-50544026 CTAACAAATCAATTTCAAAATGG - Intronic
1041111097 8:54483238-54483260 CAAATAACTCAGTTTAAAAATGG + Intergenic
1041351449 8:56951540-56951562 AAAATCATTCAGTTTTAAAAGGG - Intergenic
1041792345 8:61711354-61711376 CAAATCAATAAATTTGAAAAAGG + Intronic
1041960504 8:63609884-63609906 CACAGAAATCATTTTCAACATGG + Intergenic
1042169720 8:65979790-65979812 GAAAGCATTCAGTATTAAAAGGG + Intergenic
1042466415 8:69133870-69133892 TAAAACATTCAGTTTTAAAAGGG - Intergenic
1042682687 8:71404011-71404033 CACAACAATCAATTCCAAAAAGG - Exonic
1042773013 8:72399329-72399351 AAAGGCATTCAGTTTTAAAAGGG - Intergenic
1043040245 8:75253624-75253646 AAAAGCATTCAGTTTTAAAAGGG - Intergenic
1043519045 8:81025054-81025076 AATAGCTATCAGTTTAAAAAGGG + Intronic
1043623705 8:82229350-82229372 AAAGGCATTCAGTTTTAAAAGGG + Intergenic
1043993073 8:86780248-86780270 AAAGGCATTCAGTTTCAAAAGGG + Intergenic
1044010047 8:86983799-86983821 AAAAGCATTCAGTTTTATAAGGG + Intronic
1044273572 8:90274883-90274905 AAAGGCATTCAGTTTTAAAAGGG + Intergenic
1044282678 8:90375072-90375094 AAAAGTACTCAGTTTTAAAAGGG - Intergenic
1044443144 8:92243874-92243896 AAAGGTATTCAGTTTCAAAAGGG - Intergenic
1044538298 8:93382125-93382147 AAAGGCATTCAGTTTCAAAAGGG - Intergenic
1044687324 8:94839577-94839599 CAAAGCAATACTTTTAAAAAGGG - Intronic
1044769306 8:95613215-95613237 CAAGGCAATCGTTTTCCAAACGG - Intergenic
1044877151 8:96681034-96681056 AAAGGCATTCAGTTTTAAAAGGG + Intronic
1045588245 8:103563267-103563289 AAAGGCATTCAGTTTTAAAAGGG - Intronic
1045597257 8:103670510-103670532 AAAAGCATTCAGTTTTAAAAGGG - Intronic
1045784701 8:105907224-105907246 TAAAGAAATCTGTTTCACAATGG + Intergenic
1045995721 8:108359297-108359319 AAAGGCATTCAGTTTTAAAAGGG - Intronic
1046052964 8:109045113-109045135 AAAAGCATACAGTTTTAAAAGGG - Intergenic
1046300231 8:112277194-112277216 AAAAGCATTCAGTTTTAAAAGGG - Intronic
1046305245 8:112357362-112357384 AAAAGCATTCAGTTTTATAAGGG + Intronic
1046366814 8:113243933-113243955 CAAATAAATCAGTTTAAATATGG - Intronic
1046606108 8:116373868-116373890 AAAAGCATTCAGTTCTAAAAGGG - Intergenic
1046618173 8:116500062-116500084 AAAGGCATTCAGTTTTAAAAGGG - Intergenic
1046640128 8:116720898-116720920 AAAATCATTCAGTTTTAAAAGGG + Intronic
1046656274 8:116898814-116898836 AAAAGCATTCAGTTTTGAAAGGG + Intergenic
1046882012 8:119319666-119319688 AAAAGCATTCAGTTTTAAAAGGG - Intergenic
1047149094 8:122240874-122240896 AAAGTCATTCAGTTTCAAAAGGG + Intergenic
1047490487 8:125370256-125370278 AAAGGCATTCAGTTTTAAAAGGG - Intergenic
1048217579 8:132510468-132510490 GAAAGTATTCAGTTTCAAAAGGG - Intergenic
1048660845 8:136599574-136599596 AAAAGCATTCAGTTTTATAAGGG + Intergenic
1049076240 8:140398686-140398708 AAAAGCATTCAGTTTTAAAAGGG + Intronic
1049085831 8:140477876-140477898 AAAAGCATTCAGTTTGAAAAGGG - Intergenic
1049862879 8:144912317-144912339 CAAGGCATTCAGTTTTAAAAGGG + Intergenic
1050138331 9:2491535-2491557 CAAACTTATCAGTTTGAAAATGG + Intergenic
1050264117 9:3871945-3871967 AAAAGCATTCAGTTTTAAAAAGG - Intronic
1050929105 9:11301594-11301616 AAAGGCATTCAGTTTTAAAAGGG - Intergenic
1051771470 9:20584017-20584039 AAAAGCATTTAGTTTTAAAAGGG - Intronic
1051902740 9:22060220-22060242 AAAGGCATTCAGTTTTAAAAGGG - Intergenic
1052049381 9:23827597-23827619 TAAAGGAATCCCTTTCAAAAAGG - Intergenic
1052080752 9:24203036-24203058 AAAAGCATTCAGTTTTATAAGGG + Intergenic
1052235373 9:26207091-26207113 CAAATCAATTATTTTCAACAAGG + Intergenic
1052294502 9:26882092-26882114 AAAAGCATTCAGTTTTAAAAGGG + Intronic
1052515897 9:29479121-29479143 AAAAAAAATCAGTTACAAAATGG - Intergenic
1052599117 9:30600879-30600901 AAAGGCAATCAGTTTTAAAAGGG - Intergenic
1052701279 9:31941001-31941023 AAAGGCATTCAGTTTTAAAAGGG + Intergenic
1052705461 9:31989034-31989056 AAAAGCATTCCGTTTTAAAAGGG - Intergenic
1052787505 9:32843347-32843369 CAAAGCAGTCAGATTCTAACTGG - Intergenic
1052846476 9:33340668-33340690 AAAGGCACTCAGTTTTAAAAGGG - Intronic
1052863183 9:33449270-33449292 CAAAGAAATCATTTTCCAGAGGG + Intergenic
1052969489 9:34368430-34368452 AAAAGCATTCAGTTTTAAAAGGG - Exonic
1054960077 9:70958192-70958214 CATGGGAAACAGTTTCAAAAGGG + Intronic
1055341971 9:75293457-75293479 AAAGGCATTCAGTTTTAAAAGGG - Intergenic
1056077709 9:83058589-83058611 CAAGGCAATCATTCTGAAAAGGG + Intronic
1056595091 9:88001562-88001584 AAAGACATTCAGTTTCAAAAGGG + Intergenic
1057301213 9:93884669-93884691 TAAAACAATCCGTTTCAAAATGG + Intergenic
1057419468 9:94899093-94899115 CAAGGCAACCAGTGTTAAAAAGG - Intronic
1057740552 9:97707730-97707752 CAAATGAATCAATTTTAAAATGG - Intergenic
1058082307 9:100712935-100712957 AAAGGCATTCAGTTTCAAAAGGG - Intergenic
1058181649 9:101807349-101807371 AAAAGCATTCTGTTTTAAAAGGG + Intergenic
1058380387 9:104371385-104371407 AAAGGCATTCAGTTTTAAAAGGG + Intergenic
1058880308 9:109279849-109279871 CAAAGTAATCTGTTTCCACAAGG + Exonic
1059082662 9:111266443-111266465 AAAAGCATTCAGTTTTAAAAGGG - Intergenic
1059370267 9:113825131-113825153 TAAAGCAGTCAGTTTCTAATAGG - Intergenic
1060136489 9:121160422-121160444 CAAAGCAAGCAGGTTATAAAAGG + Intronic
1060311882 9:122469957-122469979 AAAGGCATTCAGTTTTAAAAAGG + Intergenic
1060324535 9:122600448-122600470 CAAAGTCATCAGAATCAAAATGG + Intergenic
1060437281 9:123604840-123604862 CAAAGCCATCAGCTTAACAATGG + Intronic
1060449328 9:123722293-123722315 AAAGGCATTCAGTTTTAAAAGGG + Intronic
1060698112 9:125727197-125727219 CAACGCAATTAATTTAAAAAAGG - Intergenic
1185893574 X:3840382-3840404 GAAAGCATTCTGTTTTAAAAGGG + Intronic
1185898689 X:3878806-3878828 GAAAGCATTCTGTTTTAAAAGGG + Intergenic
1185903806 X:3917235-3917257 GAAAGCATTCTGTTTTAAAAGGG + Intergenic
1186700226 X:12082928-12082950 AAAAGCAATCCATTTTAAAAGGG + Intergenic
1186954794 X:14669978-14670000 AAAGGCATTCAGTTTCAAAAGGG - Intronic
1186992367 X:15084115-15084137 AAAAGCATTCAGTTTTAAAAGGG + Intergenic
1187667458 X:21628968-21628990 AAAGGCATTCAGTTTTAAAAGGG - Intronic
1187818750 X:23262296-23262318 CAGAGCAAACACTTTTAAAATGG + Intergenic
1187851106 X:23592599-23592621 AAAAGCATTCAGTTTTAAAAGGG + Intergenic
1187856484 X:23641433-23641455 CAAATAACTCAGTTTAAAAATGG + Intergenic
1188155531 X:26737211-26737233 AAAGGCACTCAGTTTTAAAAGGG - Intergenic
1188196335 X:27239998-27240020 AAAAGCATCCAGTTTTAAAAGGG + Intergenic
1188266445 X:28081756-28081778 CAATGCAATCCCTATCAAAATGG + Intergenic
1188449506 X:30294601-30294623 AAAAGCATTCAGTTTTAAAAGGG + Intergenic
1188660372 X:32751518-32751540 TAAGGCATTCAGTTTTAAAAGGG + Intronic
1188731232 X:33648437-33648459 AAAAGCATTCAGTTTTAAAAGGG - Intergenic
1188785160 X:34336579-34336601 AAAAGCATTCAGTTTTAAAAGGG - Intergenic
1188794277 X:34442482-34442504 AAAAGCATTCAGTTTTCAAAGGG - Intergenic
1188857075 X:35209583-35209605 AAAAGTATTCAGTTTTAAAAGGG - Intergenic
1188997539 X:36904494-36904516 AAAGGCATTCAGTTTTAAAAGGG + Intergenic
1189088063 X:38047733-38047755 AAAAGCATTCAGTTTTAAAAGGG - Intronic
1189206734 X:39246360-39246382 CTCAGCCATCAGTTCCAAAAAGG - Intergenic
1189228850 X:39436138-39436160 AAAAGCACTCAATTTTAAAAAGG - Intergenic
1189637358 X:43024905-43024927 CAAAGAAATAAGTTTACAAATGG - Intergenic
1189750927 X:44221985-44222007 CAAAGGAATCAATTTTAAAATGG - Intronic
1189945383 X:46171967-46171989 AAAAGCATTCAGTTTTATAAGGG - Intergenic
1191202832 X:57803118-57803140 AAAGGCATTCAGTTTTAAAAGGG + Intergenic
1191598516 X:62974761-62974783 AAAAGCATTCAGTTTTAAAAGGG - Intergenic
1191688136 X:63913672-63913694 AAAAGCATTCAGTTTTAAAAGGG + Intergenic
1191986715 X:66988713-66988735 AAAAGCATTCAGCTTTAAAAAGG - Intergenic
1192070375 X:67933560-67933582 CAAAGGAAACAGTTTTAAAAGGG + Intergenic
1192162402 X:68798340-68798362 AAAGGCATTCAGTTTTAAAAGGG + Intergenic
1192309359 X:69997452-69997474 AAAAGCATTTAGTTTTAAAAGGG + Intronic
1192501413 X:71655894-71655916 AAAAGCATTCAGTTTTAAAAGGG - Intergenic
1192676639 X:73203343-73203365 AAAAGCATTCAGTTTTAAAAGGG - Intergenic
1192866858 X:75143133-75143155 AAAAGCATTCAGTTTTAAAAAGG - Intronic
1193136876 X:77981705-77981727 CAAAGTACTCAGTTTAAAGATGG + Intronic
1193167729 X:78301355-78301377 AAAAGCATTCAGTTTTAAAAGGG - Intronic
1193183347 X:78483913-78483935 AAAAGCATTCAGTTTTAAAAGGG - Intergenic
1193226398 X:78989304-78989326 AAAGGCATTCAGTTTTAAAAGGG + Intergenic
1193279308 X:79628250-79628272 AAAAGCATTCAGTTTTATAAGGG + Intergenic
1193320337 X:80114473-80114495 AAAAGCATTCAGTTTTAAAAGGG + Intergenic
1193449119 X:81644907-81644929 AAAAGCATTCAGTTTTAAAAGGG + Intergenic
1193459784 X:81776324-81776346 AAAGGCATTCAGTTTTAAAAGGG - Intergenic
1193498335 X:82240459-82240481 AAAAGCATTCAGTTTTAAAAGGG + Intergenic
1193502978 X:82302910-82302932 CAAATAAATCAGTTTAAAAATGG + Intergenic
1193542999 X:82794501-82794523 TAAAGCATTCAGTTTTAACAGGG + Intergenic
1193570265 X:83132779-83132801 CAAAGCAATCAGTTAAGAGAGGG + Intergenic
1193707944 X:84845336-84845358 TAAAGCATTCAGTTTTAAAAGGG - Intergenic
1193813802 X:86082404-86082426 AAAGGCATTCAGTTTTAAAAGGG - Intergenic
1193918694 X:87399761-87399783 AAAGGCATTCAGTTTTAAAAGGG + Intergenic
1194089136 X:89564041-89564063 AAAATCATTCAGTTTTAAAAAGG - Intergenic
1194110718 X:89830581-89830603 CAAAGCTATCTTTTTCAAAAAGG + Intergenic
1194256858 X:91645755-91645777 AAAAGCATTCAGTTTTAAAAGGG + Intergenic
1194330895 X:92582055-92582077 AAAAACATTCAGTTTTAAAAGGG + Intronic
1194335368 X:92640172-92640194 AAAGGCATTCAGTTTTAAAAGGG + Intergenic
1194389556 X:93299652-93299674 AAAAGCATTCAGTTTTAAAAGGG + Intergenic
1194496413 X:94621785-94621807 TAAAGCATTCTGTTTTAAAATGG - Intergenic
1194527074 X:94989964-94989986 AAAAGCATTCAGTTTTAAACAGG - Intergenic
1194560251 X:95411414-95411436 AAAAGCATTCAGTTTTAAAAGGG + Intergenic
1194626064 X:96227849-96227871 AAAAGCATTCCATTTCAAAAGGG - Intergenic
1195126802 X:101815938-101815960 AAAAGCATTCAGTTTTAAAAGGG - Intergenic
1195287372 X:103398100-103398122 CAAAGCCATCATCTTCCAAATGG + Intergenic
1195468342 X:105205828-105205850 CAAAGTAATCATTTTTTAAATGG - Intronic
1195554926 X:106210890-106210912 GAAGGCATTCAGTTTCATAAGGG - Intergenic
1195863641 X:109407377-109407399 AAAAGCATTCTGTTTTAAAAGGG + Intronic
1196129254 X:112136320-112136342 CAAAGCAATCAGGTAAGAAAAGG - Intergenic
1196169733 X:112574410-112574432 AAAAGCATTCAATTTTAAAAGGG + Intergenic
1196391263 X:115210012-115210034 AAAAGCACTCAGTTTTAAAAGGG + Intronic
1196472365 X:116042995-116043017 TAAAGCAATCTGATTAAAAATGG + Intergenic
1196503277 X:116410834-116410856 AAAAGCATTCAGTTTTAAAAGGG + Intergenic
1197007240 X:121515893-121515915 CAAAGGAATCACCTTCAAAAAGG + Intergenic
1197092498 X:122555824-122555846 AAAAGCATTCAATTTTAAAAGGG + Intergenic
1197290062 X:124644726-124644748 CAAAGAAAACATTTGCAAAATGG + Intronic
1197348897 X:125358756-125358778 AAAAGCATTCAGTTTTATAAGGG + Intergenic
1197431941 X:126377232-126377254 AAAAGCATTCAGTTTTATAAAGG - Intergenic
1197442913 X:126512374-126512396 AAAATCATTCAGTTTTAAAAGGG - Intergenic
1197466143 X:126806722-126806744 AAAAGCATTCAGTTTTAAAAGGG + Intergenic
1197485801 X:127049781-127049803 CAATGCAAACAGTAACAAAAGGG - Intergenic
1197561297 X:128025113-128025135 AAAGGCATTCAGTTTCATAAGGG - Intergenic
1197566589 X:128095460-128095482 AAAAGCATTCAGTTTTAAAAGGG - Intergenic
1197567225 X:128102097-128102119 TAAAGCATTCAGTTTTATAAGGG - Intergenic
1197773175 X:130103346-130103368 CAAACAATTCAGTTTAAAAATGG + Intronic
1197910918 X:131482001-131482023 AAAGGCATTCAGTTTCAAAAGGG + Intergenic
1197975605 X:132162989-132163011 AAAAGCATTCAGTTTTAAAAGGG + Intergenic
1198367478 X:135956419-135956441 CAAACAAACCAGTTTTAAAATGG + Intergenic
1198491870 X:137149259-137149281 AAATGCAATCAGTTTCTAAAAGG + Intergenic
1198697511 X:139358155-139358177 CATAGCAAACAGATTCAAGATGG - Intergenic
1198707155 X:139461893-139461915 AAAGGCATTCAGTTTTAAAAGGG + Intergenic
1198888250 X:141362632-141362654 AAAGGCATTCAGTTTTAAAAGGG - Intergenic
1199020251 X:142870173-142870195 GAAGGCATTCAGTTTTAAAAGGG + Intergenic
1199042166 X:143126933-143126955 AAAAGCATTCTGTTTTAAAAGGG + Intergenic
1199112064 X:143946847-143946869 AAAGGCATTCAGTTTTAAAAGGG + Intergenic
1199240842 X:145545694-145545716 AAAGGCATTCAGTTTTAAAAGGG - Intergenic
1199278034 X:145969535-145969557 AAAAGCATTCAGTTTTATAAGGG + Intergenic
1199480862 X:148297263-148297285 AAAAGCATTCAGTTTTAAAAGGG + Intergenic
1199569439 X:149252793-149252815 AAAAGCATTCAGTTTTAAAAGGG - Intergenic
1199653055 X:149967116-149967138 GAAAACAATCAATTTAAAAATGG - Intergenic
1199820742 X:151443200-151443222 AAAAGCATTCAGTTTTAAAAGGG + Intergenic
1200008648 X:153105099-153105121 AAAAGCATTCAGTTTTAAAAGGG + Intergenic
1200332385 X:155311239-155311261 AAAAGCATTCACTTTTAAAAAGG - Intronic
1200381537 X:155842596-155842618 AAAGGCATTCAGTTTTAAAAGGG + Intergenic
1200441803 Y:3220091-3220113 AAAATCATTCAGTTTTAAAAAGG - Intergenic
1200463377 Y:3485319-3485341 CAAAGCTATCTTTTTCAAAAAGG + Intergenic
1200575218 Y:4881360-4881382 CAAAGGAACCTCTTTCAAAAGGG - Intergenic
1200575576 Y:4885022-4885044 AAAAGCATTCAGTTTTAAAAGGG + Intergenic
1200639595 Y:5701126-5701148 AAAAACATTCAGTTTTAAAAGGG + Intronic
1200643839 Y:5757206-5757228 AAAGGCATTCAGTTTTAAAAGGG + Intergenic
1200795762 Y:7339868-7339890 CAAAGCAGGCACTTTTAAAATGG + Intergenic
1202091320 Y:21193973-21193995 AAAAGCATTCAGTTTTATAAGGG + Intergenic