ID: 1115135600

View in Genome Browser
Species Human (GRCh38)
Location 14:30103967-30103989
Sequence ACTACTACCCTGCTGATGAT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 104}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115135600_1115135604 -7 Left 1115135600 14:30103967-30103989 CCGATCATCAGCAGGGTAGTAGT 0: 1
1: 0
2: 0
3: 6
4: 104
Right 1115135604 14:30103983-30104005 TAGTAGTAGCTAAGTTTTGGGGG 0: 1
1: 6
2: 177
3: 397
4: 619
1115135600_1115135605 30 Left 1115135600 14:30103967-30103989 CCGATCATCAGCAGGGTAGTAGT 0: 1
1: 0
2: 0
3: 6
4: 104
Right 1115135605 14:30104020-30104042 AACAGCTTTTCAACTGTGTATGG 0: 1
1: 0
2: 1
3: 25
4: 238
1115135600_1115135601 -10 Left 1115135600 14:30103967-30103989 CCGATCATCAGCAGGGTAGTAGT 0: 1
1: 0
2: 0
3: 6
4: 104
Right 1115135601 14:30103980-30104002 GGGTAGTAGTAGCTAAGTTTTGG 0: 1
1: 0
2: 14
3: 244
4: 482
1115135600_1115135603 -8 Left 1115135600 14:30103967-30103989 CCGATCATCAGCAGGGTAGTAGT 0: 1
1: 0
2: 0
3: 6
4: 104
Right 1115135603 14:30103982-30104004 GTAGTAGTAGCTAAGTTTTGGGG 0: 1
1: 0
2: 17
3: 281
4: 646
1115135600_1115135602 -9 Left 1115135600 14:30103967-30103989 CCGATCATCAGCAGGGTAGTAGT 0: 1
1: 0
2: 0
3: 6
4: 104
Right 1115135602 14:30103981-30104003 GGTAGTAGTAGCTAAGTTTTGGG 0: 1
1: 3
2: 31
3: 348
4: 735

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115135600 Original CRISPR ACTACTACCCTGCTGATGAT CGG (reversed) Intronic
901122859 1:6909453-6909475 ACTGTTACCCTGCTGGAGATGGG - Intronic
903556168 1:24195113-24195135 ACTAATAGCCTACTGTTGATCGG + Intergenic
903671194 1:25036573-25036595 ACCATTACCCTGCTGGTAATTGG + Intergenic
911501519 1:98692141-98692163 ACTAGTAGCCTCCTGTTGATTGG + Intronic
911781543 1:101885853-101885875 ACTAATAGCCTGCTGTTGACTGG - Intronic
912195973 1:107397276-107397298 ATTTCTGCCATGCTGATGATTGG - Intronic
912747445 1:112256999-112257021 AGTACAACCCTGCTAATGAGGGG - Intergenic
913186784 1:116375772-116375794 ACTAAAGCCCTGCTGATAATTGG + Intronic
919837273 1:201583487-201583509 ACTCCTTCCCTGCTGGAGATAGG + Intergenic
919880864 1:201899661-201899683 AATACTACCCTGCTCAAGCTGGG - Exonic
920413477 1:205781152-205781174 ACTAATAGCCTACTGTTGATTGG + Intergenic
921919765 1:220654630-220654652 ACTAGTACCCTGCAGATGGCCGG - Intronic
922251613 1:223854379-223854401 AGTGCTCCCCTTCTGATGATTGG + Intergenic
1066463915 10:35637128-35637150 GCAGCTACCCTGCTAATGATGGG - Intergenic
1068020063 10:51570253-51570275 ACTAGTAGCCTACTGATGAGGGG + Intronic
1068669941 10:59712114-59712136 AATGCTCCCCTGCAGATGATGGG - Intronic
1071885228 10:89942495-89942517 ACTACTGTGCTGCTGATTATTGG + Intergenic
1073416747 10:103390054-103390076 ACTACCACCCTTCTGAAGTTAGG + Intronic
1076098943 10:127758446-127758468 ACTAATAGCCTGCTGGTGACTGG - Intergenic
1079943469 11:26711882-26711904 ACCACTACCCTGCTGGAAATAGG + Intronic
1081983191 11:47282948-47282970 ACTCCGAACCTACTGATGATAGG + Exonic
1083044899 11:59725575-59725597 ACTACTACAGTGCGGATCATAGG + Intronic
1085911312 11:80829956-80829978 ACAAATATCCTGCTGATGATGGG + Intergenic
1087624306 11:100579405-100579427 ACTAATACACTGCTGATCATAGG - Intergenic
1088861405 11:113803216-113803238 AATGCTGCCCTGCTGATGAAGGG - Exonic
1088875712 11:113934633-113934655 ACTCATACCCTCCTGATGGTGGG + Intronic
1089891065 11:121881425-121881447 ACTAATAGCCTGCTGCTGAATGG - Intergenic
1092588176 12:9921635-9921657 ACTAGTAGCCTGCTGTTGACTGG + Intronic
1094447774 12:30550429-30550451 ACTAATAGCCTACTGTTGATCGG - Intergenic
1103151933 12:118648380-118648402 TCTACTACCCTGCTGTAGGTTGG + Intergenic
1104531477 12:129575262-129575284 ACTAATAGCCTACTGTTGATGGG - Intronic
1104531633 12:129576726-129576748 ACTAATAGCCTACTGTTGATGGG + Intronic
1107538758 13:41364596-41364618 ACTATTAGACTGCTGGTGATTGG + Intronic
1108085092 13:46779839-46779861 ATTCCTACCCTGCTCATGTTAGG - Intronic
1108564819 13:51685426-51685448 ACTAATAGCCTGCTGTTGACTGG + Intronic
1113273772 13:108705340-108705362 ACAACTGACCTTCTGATGATAGG - Intronic
1115135600 14:30103967-30103989 ACTACTACCCTGCTGATGATCGG - Intronic
1115697470 14:35914727-35914749 ACTAATAACCTGCTGTTGACTGG + Intronic
1117890540 14:60417044-60417066 TCTACTACCCTGCTGATTCAAGG - Intronic
1130293857 15:82628944-82628966 ACTAATAGCCTGCTGTTGACCGG - Intronic
1131135499 15:89931691-89931713 ACTAATAGCCTGCTGTTGACTGG + Intergenic
1132010057 15:98267694-98267716 ACCACCACCCTGCTGGTTATGGG + Intergenic
1139205405 16:65023873-65023895 ACAAAGACCCTGCTGATGAAGGG - Intronic
1158129451 18:54136715-54136737 ACTAATAGCCTGCTGTTGACTGG - Intergenic
1161980022 19:7625414-7625436 ATTACTATCCTGCTGAGGGTGGG - Intronic
1164909924 19:32000869-32000891 ACTAGTACCCTACTGTTGACTGG - Intergenic
926377127 2:12242432-12242454 TCTACTTCCTTACTGATGATGGG + Intergenic
927795896 2:26048319-26048341 ACTCATACACTGCTGAGGATGGG - Intronic
930266691 2:49208607-49208629 ACTAGTAGCCTACTGTTGATAGG - Intergenic
930382146 2:50644254-50644276 ACTTCTACCCTGATTATGTTAGG + Intronic
932023414 2:68111408-68111430 ACACCTACCCTGCTGGTGATGGG + Intergenic
935302449 2:101704397-101704419 AACAAAACCCTGCTGATGATGGG + Intronic
941920935 2:170850059-170850081 ACTCCTACCTGGCTCATGATAGG - Intronic
943591063 2:189797491-189797513 ACTATTACCCTGTGGATGTTGGG + Intronic
1170634820 20:18095116-18095138 ACTAATACCCTACTGTTGACTGG - Intergenic
1170660119 20:18330254-18330276 GCTGCTACCAAGCTGATGATGGG - Intergenic
1174276004 20:49404726-49404748 ACACCTACCTTGCTGGTGATGGG + Intronic
1177492108 21:21839901-21839923 ACTAATACCCTACTGTTGACAGG + Intergenic
1185097183 22:48816790-48816812 ACTAGTAGCCTGCTGTTGACTGG - Intronic
949365211 3:3273106-3273128 ACTAATAACCTACTGTTGATGGG + Intergenic
949522011 3:4865505-4865527 ACTAATAGCCTACTGTTGATTGG + Intronic
950257884 3:11520958-11520980 ACTACTCCCCTGATGCTAATAGG - Intronic
952908347 3:38159346-38159368 ACTAATAGCCTACTGTTGATTGG + Intergenic
953268681 3:41418226-41418248 ACTAATAGCCTACTGTTGATTGG + Intronic
953432674 3:42852615-42852637 ACTCCTGCCCTGCTGAGGAATGG + Intronic
955084303 3:55687915-55687937 ACTAGTACCCTGATGAGGCTCGG - Intronic
955759443 3:62263027-62263049 ACTTCTACACTGTTGAAGATGGG - Intronic
955855498 3:63268438-63268460 ACTAATAGCCTGCTGTTGACCGG + Intronic
957159496 3:76591093-76591115 ACTAATAGCCTACTGATGACTGG + Intronic
958071752 3:88623105-88623127 ACTAATACCCTACTGTTGACCGG - Intergenic
965756272 3:172030804-172030826 ACTACTACCCTACTGTTGACTGG - Intergenic
966884022 3:184365196-184365218 AATACAACCCCACTGATGATAGG + Exonic
967448899 3:189599559-189599581 GCTACTATCCTGTTGCTGATTGG - Intergenic
976921297 4:90447035-90447057 ACTAATAACCTACTGTTGATAGG - Intronic
981948904 4:150382251-150382273 GCTACTCTCCTGCTAATGATAGG - Intronic
983589287 4:169389907-169389929 ACTAATAGCCTGCTGTTGACTGG + Intergenic
988629827 5:32917039-32917061 ACAACTCCCCTGCTTATGAAAGG + Intergenic
989322924 5:40158036-40158058 ACTAATACCCTACTGTTGACAGG + Intergenic
991651007 5:68853423-68853445 ACTAATAGCCTTCTGTTGATGGG - Intergenic
992018487 5:72599319-72599341 ACTACATCCCTTCTGATGAATGG + Intergenic
992461559 5:76965521-76965543 AGTACTTCCATGCTCATGATTGG + Intronic
997897273 5:137730382-137730404 ACTACTTCACTTCTGATTATGGG + Intronic
999367143 5:151030462-151030484 ACTCCTTCCCTGCTGCTGAGTGG - Exonic
1004976164 6:20969201-20969223 ACTAATAGCCTACTGTTGATAGG + Intronic
1006465651 6:34192948-34192970 ACTACTCTCCTGCTGAGAATAGG - Intergenic
1009988255 6:70807882-70807904 ACTAATAGCCTACTGTTGATTGG + Intronic
1014427136 6:121322033-121322055 ACTTCTAACCTGCTGAAGTTTGG - Intronic
1016056611 6:139584548-139584570 ACTAATAGCCTGCTGTTGACCGG + Intergenic
1017795821 6:157843329-157843351 ACTAATAGCCTGCTGTTGACTGG + Intronic
1018014350 6:159698676-159698698 ACTAATAGCCTGCTGTTGACCGG + Intronic
1018050162 6:160001971-160001993 GCTAATAGCCTGCTGTTGATGGG + Intronic
1018131742 6:160738386-160738408 ATTACTACCATCCTGATGCTGGG + Intronic
1020192563 7:6011277-6011299 TCTTCTACCCTGCTGGTGAGCGG - Intronic
1021062846 7:16134527-16134549 ACTACTAACCTACTGTTGACCGG - Intronic
1021286941 7:18792022-18792044 ACTACTATACTGCTGTTTATAGG + Intronic
1028298468 7:89166330-89166352 ACTAATAACCTGCTGTTGACAGG + Intronic
1039296311 8:36159630-36159652 ACTACTACTCTGGTTATGACTGG - Intergenic
1041484053 8:58354572-58354594 ACTAATAGCCTACTGTTGATCGG - Intergenic
1043969959 8:86517892-86517914 ACTATTAAACTGCTCATGATTGG + Intronic
1051869970 9:21726474-21726496 ACTACTACCCGGCTAATTTTTGG - Intergenic
1053594827 9:39549073-39549095 ACCTCTACCCTGCTGATGCCTGG + Intergenic
1054571426 9:66815894-66815916 ACCTCTACCCTGCTGATGCCTGG - Intergenic
1058392677 9:104513771-104513793 ACTAGTAGCCTGCTGTTGATTGG - Intergenic
1060164768 9:121402226-121402248 ACTTCTTCTTTGCTGATGATAGG + Intergenic
1061798572 9:133102356-133102378 AATCCTACCCTGCTGCTGACTGG - Intronic
1186311270 X:8322452-8322474 ACTAATACCCTGCTGTTGACAGG + Intergenic
1186381427 X:9064310-9064332 ACTAATACCTTGCTGTTGACTGG - Intronic
1186900757 X:14052900-14052922 ACTAATAGCCTACTGTTGATTGG + Intergenic
1188218986 X:27516761-27516783 ACTACTACACCTCTGATGACTGG - Intergenic
1188712776 X:33422062-33422084 ACTAGTAGCCTGCTGTTTATTGG + Intergenic
1199605030 X:149570590-149570612 ACTATTAGCCTGCTGTTGACTGG - Intergenic