ID: 1115137917

View in Genome Browser
Species Human (GRCh38)
Location 14:30133191-30133213
Sequence CAAGCTGCTTCCACTCATAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 974
Summary {0: 1, 1: 16, 2: 141, 3: 281, 4: 535}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115137917_1115137919 2 Left 1115137917 14:30133191-30133213 CCACTATGAGTGGAAGCAGCTTG 0: 1
1: 16
2: 141
3: 281
4: 535
Right 1115137919 14:30133216-30133238 GCCCCACAGGAAGCAGATGCTGG 0: 1
1: 0
2: 14
3: 219
4: 1216

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115137917 Original CRISPR CAAGCTGCTTCCACTCATAG TGG (reversed) Intronic
900900903 1:5515210-5515232 CAGGCTGCTTCCACTCATGGTGG + Intergenic
901189284 1:7396285-7396307 CAAGCTTTTTCCACTCATGGTGG - Intronic
901214090 1:7544746-7544768 CACGCAGCTTCCACTCATGGTGG + Intronic
901518272 1:9764035-9764057 CAGGCTACTTCCACTCACTGCGG + Intronic
902246123 1:15121924-15121946 CAAGAAGCTTCCAATCATGGTGG - Intergenic
902541491 1:17158771-17158793 CAGGCTGCTTCCACTCATGGAGG - Intergenic
902994073 1:20210292-20210314 CTAGATGCCTCCACTCAGAGTGG - Intergenic
905042442 1:34971210-34971232 CAGTCTGCTTCCACTCATGGCGG - Intergenic
905402827 1:37715946-37715968 CAAGCAACTGCCACTCAAAGAGG + Intronic
905654541 1:39677570-39677592 GGGGCTGCTTCCACTCAGAGGGG + Intergenic
905965549 1:42092467-42092489 CAGGCTGTTTCCACCCATGGTGG + Intergenic
906591184 1:47025285-47025307 CAGACGGCTTCCACTCATAGTGG - Intronic
906708042 1:47909330-47909352 CAGGCTGCTTCCACTCCTGGCGG + Intronic
907295116 1:53446007-53446029 CAAGCTGCTTCCATTCATGGTGG + Intergenic
907829682 1:58052932-58052954 TAGGCTGCTTCCACTCATTATGG + Intronic
908390598 1:63680015-63680037 CAGGCTGCTTCCACTCATGGTGG - Intergenic
908470002 1:64434425-64434447 CAGGCTGCTTCCACTCATAGTGG - Intergenic
909278912 1:73723732-73723754 AATGCTGATTCCACTAATAGTGG + Intergenic
909385783 1:75054704-75054726 CAAGCTACTTCCACTGGTAAGGG - Intergenic
909492527 1:76241333-76241355 CAAACTGCTTCCACTCATGGTGG + Intronic
909607942 1:77525463-77525485 CAGGAAGCTTCCACTCACAGCGG + Intronic
910072742 1:83238653-83238675 CAGGCTGCTTCCACTGATTGTGG - Intergenic
910123753 1:83818298-83818320 CAGGATGTTTCCACTCATGGTGG - Intergenic
910124069 1:83820739-83820761 CAGGTTGCTTCCACTCATGGAGG - Intergenic
911858203 1:102909302-102909324 CAGGCTGCTCCCACTCATGCTGG - Intronic
911880102 1:103225905-103225927 CTGGCTGCTTCCAGTCATGGAGG - Intergenic
912123561 1:106504793-106504815 CAATCTGCTTCGACTCATCCAGG - Intergenic
912195374 1:107391632-107391654 CAGGAAGCTTCCACTCATGGTGG + Intronic
912346852 1:108971540-108971562 CAAGCAGCTTCCTATCATGGTGG - Exonic
912501415 1:110124791-110124813 CAAGCTACTTCCACTCATGTTGG - Intergenic
912656824 1:111493445-111493467 CATGCTGCTTCCACCCATGGTGG - Intronic
913076685 1:115346039-115346061 CAGGAAGCTTCCACTCATGGTGG - Intergenic
914235491 1:145806710-145806732 CAGGAAGCTTCCAGTCATAGTGG - Intronic
914437803 1:147675408-147675430 CAGGCTGCTTCCACTCATGGTGG - Intergenic
916884938 1:169058178-169058200 CAGGGGGCTTCCACTCATGGTGG - Intergenic
916899648 1:169207121-169207143 CAGGCTGTTTCTACTCATGGTGG + Intronic
917068441 1:171123294-171123316 CAGGCTGCTTCCACTCATGATGG + Intergenic
917265064 1:173212031-173212053 CATGGTGCTTCTACTCATAGTGG + Intergenic
917541872 1:175922312-175922334 CAGGCTGCTTCCATTCATGGTGG + Intergenic
917658526 1:177153306-177153328 TAGGCTGCTTCCACTCATGGTGG - Intronic
917813034 1:178678967-178678989 CAGATTGCTTCCACTCATAGTGG + Intergenic
918130537 1:181624029-181624051 CAAGCTGCTCCCACTCATGGTGG + Intronic
918157931 1:181868433-181868455 CAGGCTGCTTCCACTTATGGTGG + Intergenic
918354143 1:183690030-183690052 CAAGCTCCTTCAACTCATGTGGG - Intronic
918364055 1:183787911-183787933 CAGGCTACTTCCACTCATAGTGG - Intronic
918550936 1:185741120-185741142 CATGCTGCTTCCATTCACAGTGG - Intronic
919252959 1:195083079-195083101 CACACTGCTTCCACTCATGATGG + Intergenic
919886350 1:201937795-201937817 CAAGGTTCTTGCCCTCATAGAGG - Intronic
921812303 1:219529057-219529079 CATGCTGCTTCTACTCATTGTGG + Intergenic
921884122 1:220287354-220287376 CAAGAAGCTTCCAATCATGGCGG - Intergenic
921887293 1:220319812-220319834 CAGGCTGCTTCCACTCGTGGTGG - Intergenic
921960401 1:221027869-221027891 CAGGAAGCTTCCACTCATGGTGG - Intergenic
922073411 1:222218421-222218443 CAGGAAGCTTCCACTCATGGTGG - Intergenic
922741514 1:228016755-228016777 CAGGGAGCTTCCACTCATGGTGG + Intronic
922876760 1:228945873-228945895 CAGGCTGCTGCCACTCATGGTGG + Intergenic
923005608 1:230047108-230047130 CTGGCTGCTTCCACTCATGATGG + Intergenic
923150216 1:231226358-231226380 GAAGCTGCTTCCGCTCATGAGGG - Intronic
923325649 1:232877861-232877883 CAGGCTGCTTCCACTCATGGTGG - Intergenic
923370837 1:233310789-233310811 CAGGCTGCTTCCACTCATAGTGG + Intergenic
923466383 1:234250747-234250769 CAGACTGCTTCCACTCATGATGG + Intronic
923920266 1:238556222-238556244 CAGGTTCCTTCCACTCATGGTGG + Intergenic
924021584 1:239789531-239789553 CAGGCTGCTTCCACTCATGGAGG + Intronic
924294416 1:242570843-242570865 CAGGCTGCTTCCACTCATGGAGG + Intergenic
924327390 1:242909464-242909486 CAAACTGCTTCTACTCATGGTGG - Intergenic
924883451 1:248188010-248188032 CATCCTGCTTCCGCTCAGAGAGG - Intergenic
924883464 1:248188075-248188097 CATCCTGCTTCCGCTCAGAGAGG - Intergenic
924883478 1:248188141-248188163 CATCCTGCTTCCGCTCAGAGAGG - Intergenic
1063770256 10:9189379-9189401 CAGGCTGCTTCCACTCTTGGTGG - Intergenic
1064161966 10:12954533-12954555 CAGGAAGCTTCCACTCATGGTGG + Intronic
1064457401 10:15500565-15500587 CAAGAAGCTTCCAATCATGGTGG - Intergenic
1064505913 10:16029693-16029715 CAAGAAGCTTCCAGTCATGGTGG + Intergenic
1064531177 10:16311790-16311812 CAGGTTGCTTCTACTCATGGTGG + Intergenic
1064548549 10:16475507-16475529 GAAGCTGCTTCCAATGATATGGG + Intronic
1064864016 10:19858956-19858978 CAGGAAGCTTCCACTCATGGTGG + Intronic
1065086215 10:22180075-22180097 CAGGCTGCTTCCACTCGTAGTGG - Intergenic
1065149723 10:22810631-22810653 CTGGCTGTTTCCACTCATAGTGG + Intergenic
1065416403 10:25492059-25492081 CAGGCTGCTTCCACTCATGGTGG + Intronic
1065561714 10:26970516-26970538 CACGAAGCTTCCAATCATAGTGG - Intergenic
1065624690 10:27618575-27618597 CAGGCTGCTTCCACTTAGCGAGG + Intergenic
1065787157 10:29227294-29227316 CAGGCTGCTTCCATTAATGGTGG + Intergenic
1065863075 10:29887709-29887731 CAGGAAGCTTCCACTCATGGTGG - Intergenic
1066224666 10:33370523-33370545 CAGGCTGCTTCCACTCATGGCGG + Intergenic
1066473935 10:35726063-35726085 CAGGAAGCTTCCACTCATGGTGG - Intergenic
1067084847 10:43232364-43232386 CAGGGAGCTTTCACTCATAGTGG - Intronic
1067151871 10:43742556-43742578 CAGGCTGCTTCCACTGATGGTGG + Intergenic
1067518169 10:46973160-46973182 TGGGCTGCTTCCACTCATGGTGG + Intronic
1067559078 10:47292034-47292056 CAGGGAGCTTCCACTCATGGTGG - Intergenic
1067644080 10:48078668-48078690 TGGGCTGCTTCCACTCATGGTGG - Intergenic
1067742862 10:48909569-48909591 ATAGGTGCTTCCACTCATGGTGG + Exonic
1067810893 10:49426307-49426329 CAGGCAGCTTCCACTCATGGTGG + Intergenic
1068100586 10:52547677-52547699 CAAGCTGCTTCCACTCATGGTGG + Intergenic
1068297991 10:55100547-55100569 CAGGCTGCTTCCACTCATGTTGG + Intronic
1068757841 10:60674367-60674389 CAGGAAGCTTCCACTCATGGTGG + Intronic
1068850311 10:61731339-61731361 GAAGCTGCTTCCACACATACTGG + Intronic
1068887682 10:62114475-62114497 CAGGCTGCTTCAACTTATGGTGG + Intergenic
1070052728 10:72904936-72904958 CAGGCTGCTCCCACTCATGGAGG + Intronic
1070419978 10:76226772-76226794 CAGGCTGATTCCACTCATGGAGG - Intronic
1070580760 10:77717370-77717392 CAGGCTGCTTCCACCCATGGTGG - Intergenic
1071002253 10:80843105-80843127 CAACCTGCTTCTACTCATAATGG - Intergenic
1071129187 10:82371736-82371758 CAGGGTGCTTCCACTCCTGGAGG + Intronic
1071344056 10:84674585-84674607 CAGGCTGCTTCTACTCACGGTGG + Intergenic
1071380279 10:85052587-85052609 CAGGAAGCTTCCACTCATGGTGG + Intergenic
1071396139 10:85225901-85225923 CAGGGTGCTTCCAATCATGGTGG + Intergenic
1071752989 10:88502502-88502524 CATGCTACTTCCACTCAAGGTGG - Intronic
1071934388 10:90511330-90511352 CAGGCTGCTTCCTCTCATGATGG + Intergenic
1072036833 10:91570455-91570477 TAAGTTGCTTCCATTCATGGGGG - Intergenic
1072231993 10:93421712-93421734 CAAGAAGCTTCCACTCATGGGGG - Intronic
1072477108 10:95772998-95773020 CAGGCTGCTTCCACTCTTGGAGG + Intronic
1073158416 10:101368277-101368299 CAAGCGGCTTCCACTCACGGTGG - Intronic
1073502134 10:103949853-103949875 CAGGCTTCTTCCACTCACAGTGG + Intergenic
1073732831 10:106310872-106310894 CAGGCTGCTTCCACTCTTGGTGG - Intergenic
1073833709 10:107416438-107416460 CAGGAAGCTTCCACTCATATAGG + Intergenic
1073873537 10:107894658-107894680 CAGGCTGCTTCCCCTCATGGTGG + Intergenic
1073924462 10:108499084-108499106 CAGGCTGCTTCTACTCACAGAGG + Intergenic
1074197880 10:111205310-111205332 CTGGCTGCTTCCACTCATGATGG - Intergenic
1074264286 10:111885902-111885924 CAGGATGCTTCAACTCATGGTGG + Intergenic
1074650969 10:115524014-115524036 CAAGCTGTTTCCATTCATGGTGG + Intronic
1075009845 10:118858161-118858183 CAGGCTGCTTCCACTCATGGTGG - Intergenic
1075077438 10:119360543-119360565 CAGGCTCCTTCCACTCACACAGG - Intronic
1075354732 10:121761150-121761172 CAAGCTGCTCCCACCCATGGTGG - Intronic
1076194587 10:128508046-128508068 TAAGCTGCTTCCATTCACAGTGG + Intergenic
1076932770 10:133544650-133544672 CAGGCTGCTTCCACATATAGTGG + Intronic
1077378879 11:2218741-2218763 CAGCCTGCATCCACTCATGGCGG + Intergenic
1077379186 11:2220724-2220746 CAGGCTGCTTCCACTCATGGTGG + Intergenic
1078195821 11:9135862-9135884 CAAGCTGCTTCCACACATGGTGG - Intronic
1078415922 11:11164791-11164813 CAGGCTGCTTCCACTCGTGATGG + Intergenic
1078443245 11:11385049-11385071 CAGGCTGCTTCCACTCATGGTGG + Intronic
1079533690 11:21485630-21485652 TAAGCTGCTCCCACTGAGAGTGG + Intronic
1079574813 11:21990335-21990357 CGTGATGCTTCCACTCATGGTGG + Intergenic
1080209109 11:29765046-29765068 CATGCTGCTTCCACTCAAGGCGG - Intergenic
1080440396 11:32288966-32288988 CAGGGTGCTTCCACTCATGGTGG - Intergenic
1080720676 11:34845359-34845381 CAGGATGCTTCCATTCATAGTGG - Intergenic
1080805266 11:35647620-35647642 CAAGCTGCTTCCCCTTATGGTGG + Intergenic
1080964083 11:37194439-37194461 CAGGCTGCTTCCACTTCTGGTGG + Intergenic
1081327543 11:41764159-41764181 TAGGCTGCTTCCACTCATGGCGG + Intergenic
1081380465 11:42408316-42408338 AATGCTTCTTCCACTGATAGAGG - Intergenic
1081469412 11:43356008-43356030 CACGCTGCTTCCACTTAGGGAGG - Intergenic
1081744057 11:45460712-45460734 CAGGAAGCTTCCAATCATAGTGG - Intergenic
1082822997 11:57557337-57557359 CAGGAAGCTTCCACTCATGGTGG - Intronic
1083086784 11:60156338-60156360 CAGGCTGCTTGCACTCATTGTGG - Intergenic
1083255510 11:61493084-61493106 CAGGAAGCTTCCACTCATGGTGG - Intergenic
1084643889 11:70443172-70443194 TCAGCTGCTTCCACTCATGGGGG + Intergenic
1084682426 11:70674160-70674182 CAGGAAGCTTCCACTCATGGCGG - Intronic
1084976980 11:72806572-72806594 CAGGCTGCTTCCACTCACTGTGG + Intergenic
1085147107 11:74210692-74210714 CAGGCTGCTTCCACTCATGGTGG - Intronic
1085506131 11:77060776-77060798 CAGGCTGCTTCCACTCATGGTGG - Intergenic
1085544895 11:77309235-77309257 CAGGCTGCCTCCACTCACAGTGG + Intergenic
1086280608 11:85183178-85183200 AAAGCTGATTCCATTCATACTGG - Intronic
1086333389 11:85776171-85776193 TCAGCTGCTTCCACTCCTAGAGG - Intronic
1086495946 11:87404618-87404640 CAGGCTGCTTCTACTTATGGTGG + Intergenic
1086537727 11:87868343-87868365 CAGGCTGCTTCCACTCATGCTGG - Intergenic
1086874915 11:92083993-92084015 CAGGCTGCTTCCATTCCTAGCGG - Intergenic
1087334815 11:96830216-96830238 CAGGCTGCTTCCACTCATGGAGG - Intergenic
1088386798 11:109267530-109267552 CAAGATGCTGCCACTCCTTGAGG - Intergenic
1089925756 11:122255736-122255758 CATGCTTCTTCAACTCATGGTGG - Intergenic
1090039501 11:123277858-123277880 CAGGGAGCTTCCACTCATGGTGG + Intergenic
1090040771 11:123289470-123289492 CAGGCTGCTTCCAGTCATGGCGG + Intergenic
1090040791 11:123289568-123289590 CAAGCTGCTTCCAGTCATGGCGG + Intergenic
1090131639 11:124148322-124148344 CAAGATTCTTCCACTCAAACAGG + Intergenic
1090313599 11:125765184-125765206 CTAGTTCCTTCCACTCATTGTGG - Intergenic
1090822695 11:130357879-130357901 CAGGCTGCTTCCACTCATGGTGG - Intergenic
1090871438 11:130753264-130753286 CAAGAAGCTTCCAATCATGGTGG - Intergenic
1091091637 11:132776629-132776651 CAGGGAGCTTCCACTCATGGTGG - Intronic
1091257512 11:134202687-134202709 CCAGCTGTTTCAACTCTTAGGGG + Intronic
1091385823 12:93932-93954 CAGGCTGCTTCCATTCATAGTGG - Intronic
1091772519 12:3162224-3162246 CAGGCTGCTTCTGCTCATGGTGG - Intronic
1091910706 12:4228318-4228340 CAGGCTGCTTCCACTCATGGCGG - Intergenic
1092327670 12:7550614-7550636 CAAGCTACTTCTGCTCATGGGGG - Intergenic
1092602157 12:10078941-10078963 CAGGCAGCTTCCACACATGGGGG - Intronic
1092735291 12:11576741-11576763 CAGGAAGCTTCCAATCATAGTGG + Intergenic
1092751767 12:11725844-11725866 CAGGCTGCTTCCACTCGTGGCGG - Intronic
1092962108 12:13606294-13606316 CAGGCTGCTTCCACTCATGGTGG + Intronic
1093191281 12:16077886-16077908 CAGGCTTCTTCCACTCATGGTGG - Intergenic
1093334181 12:17880484-17880506 CACACTGCTTCAACTTATAGTGG + Intergenic
1093656944 12:21705825-21705847 CAGGCTGCTTCCACTCGTGGTGG - Intronic
1093713331 12:22352971-22352993 GAGGCTGCTTCCACTCAAGGTGG - Intronic
1093732225 12:22578342-22578364 CAGGCTACTTCCATTCATGGCGG + Intergenic
1093783259 12:23161835-23161857 CAGACTGCTTCCACTCCTGGTGG + Intergenic
1093874292 12:24330667-24330689 CAAGCTGTTTCCAAAGATAGAGG - Intergenic
1094030516 12:26006996-26007018 CAGGCTGCTTCCACTCATGGTGG + Intronic
1094156932 12:27347017-27347039 CAGGCTGCATCCACTCAAGGTGG - Intronic
1095304708 12:40625978-40626000 CAGGCTGCTTCCACTCATGGTGG + Intergenic
1095317621 12:40785319-40785341 CAGGGAGCTTTCACTCATAGTGG + Intronic
1095433240 12:42157188-42157210 CATGCTGCTTCAACTCATGGTGG + Exonic
1095728906 12:45483566-45483588 CATGCTGCTTTCACTCATGGTGG + Intergenic
1095837016 12:46649701-46649723 CAGGCTGCTCACACTCATGGTGG - Intergenic
1096034600 12:48454916-48454938 CAAGTTTCTTCAAATCATAGGGG + Intergenic
1096122002 12:49094392-49094414 CGAGCTGCTTGCGCGCATAGCGG + Exonic
1096145609 12:49276738-49276760 CAACCTGCTTCCCCCCACAGAGG + Intergenic
1096905948 12:54935667-54935689 CAGGCTGCTTGCAGTCATGGTGG + Intergenic
1097532441 12:60821394-60821416 CATGCTGCTTCAACTAATGGTGG + Intergenic
1097708764 12:62895792-62895814 CAGGCTGCTTCCACTCATGGTGG - Intronic
1098761192 12:74427415-74427437 CAGGCTGCTTCCACTCATGGTGG - Intergenic
1098880042 12:75907747-75907769 TGTGCTGCTTCCACTCATGGTGG - Intergenic
1098961693 12:76745724-76745746 CAGGTTGCTTTCACTCATGGTGG - Intergenic
1099184441 12:79502661-79502683 CAAGAAGCTTCCAATCATGGAGG + Intergenic
1099963426 12:89418760-89418782 CAAGCTGCTTTCACTCATGGTGG - Intergenic
1100192911 12:92212003-92212025 CAGGCTGCTTCCACTCATGGTGG - Intergenic
1100286640 12:93173181-93173203 TAGGCTGCTTCCACTCATGGTGG + Intergenic
1100368836 12:93946586-93946608 CAGGCTGCTTCAACTCATGGTGG + Intergenic
1100380720 12:94059245-94059267 CAGACTGCTTCCACTCATGGTGG - Intergenic
1100453584 12:94730871-94730893 CATGCTGCTTCTACCCATGGTGG + Intergenic
1100795499 12:98177440-98177462 CAGGCTGCTTCCTCTCATGGTGG - Intergenic
1100807789 12:98305304-98305326 CAAGAAGCTTCCAATCATGGTGG - Intergenic
1100849665 12:98696239-98696261 TCGGCTGCTTCCACTCATGGTGG + Intronic
1100872346 12:98923266-98923288 CATGCTGCTTCTACTGATGGTGG - Intronic
1103023292 12:117553923-117553945 CAGGCTGCTTCCACTCATGTTGG - Intronic
1103164088 12:118755352-118755374 CAGGCTGCTTCCATTCATGGTGG + Intergenic
1103532921 12:121614924-121614946 CAAGAAGCTTCCAATCATGGCGG + Intergenic
1104140026 12:125979064-125979086 CAGGCTGCTTCTATTCATGGGGG + Intergenic
1104245960 12:127041742-127041764 CAAGAAGCTTCCAATCATGGTGG + Intergenic
1104385929 12:128351601-128351623 CAGGCTGCTTCCACTCATGGTGG + Intronic
1106095403 13:26639000-26639022 CAGGCTGCTTCCACTCATGGTGG - Intronic
1106130706 13:26937100-26937122 CAGGATGCTTCCACTCATGGTGG - Intergenic
1106360904 13:29029694-29029716 CAGGCTGCTTCCACTCAAGGGGG + Intronic
1106366428 13:29085148-29085170 CAGGAAGCTTCCACTCATGGTGG - Intronic
1106653847 13:31721104-31721126 CAGGAAGCTTCCACTCATGGTGG - Intergenic
1106662009 13:31809594-31809616 CAGTCTGCTTCCAGTCATTGTGG - Intergenic
1106667760 13:31870553-31870575 CAGGCTGCTTCCACTCATGGTGG + Intergenic
1106856941 13:33864054-33864076 CAGGAAGCTTCCACTCATGGTGG + Intronic
1107034199 13:35883455-35883477 CAAGCTACTTCCACTCATGGTGG - Intronic
1107648836 13:42523739-42523761 CAAAATGCTACCAGTCATAGGGG + Intergenic
1108027717 13:46195883-46195905 CAGGCTGCTTTCACTCATGGCGG - Intronic
1108041188 13:46340676-46340698 GTGGCTGCTTCCACTCATGGTGG + Intergenic
1108083286 13:46759445-46759467 CAAGCTGCTTCCACTTATGGTGG - Intergenic
1108190019 13:47928823-47928845 CAGACTGCTTCCACTCATGCTGG + Intergenic
1108855758 13:54790967-54790989 CAAGTTTCTTCCACTTATAGCGG + Intergenic
1109050308 13:57472407-57472429 CAGTCTGCTTCCATTCATGGTGG + Intergenic
1109371620 13:61428284-61428306 CAGGCTGCTTCCACCTATGGTGG + Intergenic
1109819951 13:67639565-67639587 CAGGCTGCTTTCACTCATGGTGG - Intergenic
1109977223 13:69854270-69854292 CAGGCTGTTTCTACTCATTGAGG + Intronic
1109978156 13:69870194-69870216 CAAGATGCTGCCACTCGTAGTGG + Intronic
1110002994 13:70229419-70229441 CAAGCTGCTTCCACTCATGGTGG - Intergenic
1110027569 13:70560498-70560520 CATGCTGCTTGCACTCATGGTGG - Intergenic
1110182662 13:72635945-72635967 CAGGCTGCCTCTACTCATGGTGG - Intergenic
1110466947 13:75813256-75813278 CAAGCTGCTTCAAATCAGAGAGG - Intronic
1110924100 13:81128706-81128728 CAGGCTGTTTCCGCTCATGGTGG - Intergenic
1111668301 13:91297037-91297059 CAGTCTCCTTCCACTCATGGTGG - Intergenic
1112267530 13:97938746-97938768 CAAGCTGCTTCTGCTCATGGCGG + Intergenic
1112288256 13:98123059-98123081 CAGGCTGCTTCCACTCACAGTGG - Intergenic
1112361770 13:98725149-98725171 CAGGCTGCTTCCATTCATGGAGG - Intronic
1112586643 13:100724157-100724179 CAGGCTGCTTCCACTTATAATGG - Intergenic
1113050455 13:106205825-106205847 CAGGCTGCTTCCACTCATGGAGG + Intergenic
1113429898 13:110240700-110240722 CAAGCCGCTTCCACTCCGAGTGG - Intronic
1113818077 13:113189204-113189226 CAGGCTGCTTCCACTCATGCTGG - Intronic
1114378616 14:22176440-22176462 CCGGCTCCTTCCACTCATGGTGG - Intergenic
1114764233 14:25352059-25352081 TAGGCTGCTTCTACTCATGGTGG + Intergenic
1115137917 14:30133191-30133213 CAAGCTGCTTCCACTCATAGTGG - Intronic
1115282721 14:31682917-31682939 CAGGCTGCTCCCACTCATGGTGG + Intronic
1115765054 14:36614647-36614669 CAGGCTGCTTCCACTCGTGGTGG - Intergenic
1116604162 14:46968264-46968286 TAAGCTGCTCCCACTGACAGTGG + Intronic
1117301960 14:54438981-54439003 CAGCCTGCTTCCACTCATGGTGG - Intronic
1117761196 14:59030728-59030750 CAGGCTGTTTCTACTCATGGTGG - Intergenic
1117784669 14:59270302-59270324 CAGCCTGCTTCCACTCATGGTGG + Intronic
1117942718 14:60985824-60985846 CAGGCTGCTTTCATTCATTGTGG + Intronic
1118038073 14:61889713-61889735 CAGACTGCTTCCACTCAGAGTGG - Intergenic
1118233244 14:63974317-63974339 TAGGCTACTTCCATTCATAGTGG + Intronic
1118767108 14:68917210-68917232 CAAGGAGCTTCCACACATAAAGG - Intronic
1119115321 14:72015153-72015175 CCAGCTGCTTCCACTCATGGAGG + Intronic
1119178351 14:72586422-72586444 GAGGCTGCTTCCACCCATGGTGG - Intergenic
1119385666 14:74257015-74257037 CAAGCTGCTTTCTCCCACAGAGG - Intronic
1119617590 14:76109037-76109059 CAGGCTGCTTCCACTCACGGCGG + Intergenic
1119957668 14:78817602-78817624 CATGCTGCTTCCACTCATGGAGG + Intronic
1120073762 14:80132903-80132925 CAGGCTGGTTCCACTCATGGTGG - Intergenic
1120179470 14:81328876-81328898 CAGGCTGCTTCCACTCATGGTGG - Intronic
1120263016 14:82212428-82212450 CAGGCTGTTTCCACTCATGGTGG - Intergenic
1120733712 14:88030361-88030383 CAGGCTACTTCCACTCATGGTGG - Intergenic
1120768387 14:88352952-88352974 CCAGCTGCTTCTACTCATGACGG - Intergenic
1120819592 14:88899858-88899880 CAGGAAGCTTCCACTCATGGTGG - Intergenic
1121210408 14:92204115-92204137 CAGGCTGCTTCTACTCATGGTGG - Intergenic
1121215399 14:92243940-92243962 CAGGCTGCTTCCACTCATGGTGG + Intergenic
1121240463 14:92426272-92426294 CAGGCTGCTTTCACTCACGGTGG + Intronic
1121530354 14:94648463-94648485 CAGGCTGCTTCCACTCATGGTGG + Intergenic
1121752698 14:96370720-96370742 CCAGCTGCTTCCGCTCGTGGTGG - Intronic
1121924381 14:97914604-97914626 CAGGGTGCTTCCACACAGAGAGG - Intergenic
1121989160 14:98538385-98538407 CAAAATACTTCAACTCATAGTGG + Intergenic
1122149158 14:99715515-99715537 CTAGCTGCCTCCACTCATCAGGG + Intronic
1122182040 14:99962373-99962395 CAGGCTGCTTGCATTCATGGTGG - Intergenic
1122398057 14:101449295-101449317 CAAGCTGCTTCCACCTGTACAGG - Intergenic
1122525925 14:102384331-102384353 CATGCTGCTTCCACTCATGGTGG + Intronic
1122562982 14:102630299-102630321 CAGGCTGCTTCCACACATGGCGG - Intronic
1122831468 14:104399257-104399279 CAGGTTGCTTCCACTCATGATGG - Intergenic
1122842744 14:104474384-104474406 CACGCTGCTTGCACCTATAGAGG + Intergenic
1123794263 15:23755876-23755898 GAGGCTGCTTCCATTCATGGTGG + Intergenic
1124006006 15:25795972-25795994 TCAGCTGCTTCCTCTCATAGGGG - Intronic
1124073312 15:26415749-26415771 CAGGCTGCTTCCACTCATGGTGG - Intergenic
1124117088 15:26854718-26854740 CAGGCTGCTTCCACTCAAGGTGG - Intronic
1124227894 15:27911520-27911542 CCGGCTGCTTCCCCTCATAGTGG + Intronic
1124601428 15:31135816-31135838 CAGGCTGCCTCCACTCATGGTGG - Intronic
1124601957 15:31140644-31140666 CAGCCTGCTTCCATTCATGGAGG - Intronic
1124793701 15:32754494-32754516 CAGGCTGTTTCCACTTATGGTGG - Intergenic
1125093989 15:35829871-35829893 CAGGGTGCTTCCACTCTTGGTGG + Intergenic
1125259457 15:37806372-37806394 CCAGCTGCTTCCAAACATAATGG + Intergenic
1125423843 15:39530570-39530592 CAGGCTGCTTCCACTTGTGGTGG + Intergenic
1125780079 15:42257407-42257429 CAGGCTGTTTCTACTCATGGTGG - Intronic
1125881144 15:43197087-43197109 CAGGCTGCTTCCACTTATGCAGG - Exonic
1126174511 15:45723006-45723028 CATGCTGTTTCAACTCATGGTGG - Intergenic
1126389518 15:48131586-48131608 CAGGCTGCTTCCACTCATGGTGG - Intronic
1126815202 15:52447344-52447366 CAGGAAGCTTCCACTCATGGTGG - Intronic
1127052156 15:55095821-55095843 CAGGTTGCTTCCACTCATGGTGG + Intergenic
1127404773 15:58631119-58631141 CAGGCTGCTTCCACTTATGATGG - Intronic
1127542157 15:59951454-59951476 CAGGCTACTTCCACTCATGATGG - Intergenic
1129345048 15:74912141-74912163 CAGGCTGCTTCCACTCATGGCGG - Intergenic
1129958244 15:79659000-79659022 CAGGCTGCTTCCTCTCATGGAGG + Intergenic
1130038027 15:80379195-80379217 CAGGCTGCTTCCACTCATGGTGG - Exonic
1130349117 15:83075004-83075026 CAGGCTGCTTCTACTCATGGTGG + Intergenic
1130562747 15:84971534-84971556 CAGGCTGCTTCCTCTCATGGTGG - Intergenic
1130812435 15:87393980-87394002 CAGGCAGCTTCCACTCATGGTGG + Intergenic
1130815766 15:87430726-87430748 CCAGCTGCTTCCACTCATGGTGG - Intergenic
1131409908 15:92198901-92198923 CAAGAAGCTTCCACTCATGATGG - Intergenic
1131428032 15:92362994-92363016 CAGGAAGCTTCCACTCATGGTGG - Intergenic
1131453847 15:92567906-92567928 CAAGAAGCTTCCACTCATGATGG + Intergenic
1132993193 16:2807986-2808008 CAAGAAGCTTCCACTCATGGCGG + Intergenic
1133256519 16:4519844-4519866 CAGGCTGCTTCCATTCATGGTGG - Intronic
1133450071 16:5896503-5896525 CAGGCTGCTTCCACTCATGTTGG - Intergenic
1133813570 16:9179594-9179616 CAGGAAGCTTCCAATCATAGTGG + Intergenic
1133837649 16:9381020-9381042 CAGGCAGCTTCCACTCATGGTGG + Intergenic
1133865294 16:9636647-9636669 CAGGAAGCTTCCAATCATAGTGG + Intergenic
1133927870 16:10207929-10207951 CAGGCTGCTTCCAATCATGGTGG - Intergenic
1134432841 16:14227389-14227411 CAGGCTGCTTCCACTCATGGTGG - Intronic
1134560278 16:15203119-15203141 CAGGCTGCTTCCACTCATGGTGG + Intergenic
1134773200 16:16828899-16828921 CAGACTGCTTCAACTCATGGTGG + Intergenic
1134920820 16:18114733-18114755 CAGGCTGCTTCCACTCATGGTGG + Intergenic
1135020774 16:18961245-18961267 CAGGCTTCTTCTACTCATGGTGG + Intergenic
1135196068 16:20395868-20395890 CGAGCTGCTTCTACTCATGGTGG - Intronic
1135289791 16:21225456-21225478 CAAGCATCTTCCACACACAGTGG - Intergenic
1135397498 16:22142348-22142370 CAGGCTGCTTCCACTCATGGTGG + Intronic
1135673792 16:24396987-24397009 CAGGCTGTTTCTACTCCTAGTGG + Intergenic
1135678543 16:24437818-24437840 CAGGCTACTTCCACTCATGGTGG - Intergenic
1135885027 16:26297948-26297970 CATGCTTCTTCCACTCTTGGCGG + Intergenic
1135937532 16:26793734-26793756 CAGGCCGCTTCCACTCATGGCGG - Intergenic
1136093387 16:27936517-27936539 CAGGCTGCTTCCACTCATGGAGG - Intronic
1136127748 16:28196852-28196874 CAGGCTACTTCCACTCCTGGTGG - Intronic
1136528240 16:30847337-30847359 CAGGCTACTTCCACTCACAAGGG - Intronic
1138073205 16:54014455-54014477 CAGGAAGCTTCCACTCATGGTGG - Intronic
1138849708 16:60612608-60612630 CATGCTGCTTTCACCCATTGTGG + Intergenic
1139099777 16:63751203-63751225 CAAGGTGCTTCCACGCACGGTGG - Intergenic
1140248971 16:73277836-73277858 CAAGAAGCTTCCAATCATGGTGG + Intergenic
1140628451 16:76822804-76822826 CAAGCTGCTGCCACTACTGGTGG + Intergenic
1140687992 16:77451947-77451969 CAGCCTGTTTCCACTCATGGTGG - Intergenic
1140704595 16:77614978-77615000 CAAGCTACTTCCACTTATGGTGG + Intergenic
1140818913 16:78645536-78645558 CAGGCAGCTTCTACTCATGGTGG + Intronic
1141001399 16:80311667-80311689 CAGGCTGCTTCCGCTCGTGGTGG - Intergenic
1141236539 16:82222944-82222966 CAGGCTGCTTCCACTCATGGTGG - Intergenic
1141718687 16:85742461-85742483 CAGGCTGCTTCCACTCAAGGCGG - Intronic
1143439280 17:6955924-6955946 CAGGCTGCTTCTACTAATGGTGG - Intronic
1143662931 17:8338233-8338255 CAGGCTGCTTTCACTTATGGTGG + Intergenic
1144012161 17:11159440-11159462 CCGGCTCCTTCCACTCATGGTGG - Intergenic
1144088357 17:11831264-11831286 CAAGCTGCTTCTTTTCATGGTGG + Intronic
1144264566 17:13555522-13555544 CAAGATGCTTCCACTCTAAGGGG - Intronic
1144599294 17:16598644-16598666 CAGGCTGCTTCCACTCATGGCGG - Intergenic
1144751677 17:17653169-17653191 CAAGAAGTTTCCACTCATGGTGG + Intergenic
1145290667 17:21543147-21543169 CAGGCTGCCTCCAGTCATGGTGG + Intronic
1150732158 17:67705068-67705090 CAGGCTGCTTCCACTCACGGTGG + Intergenic
1151123351 17:71817760-71817782 CAGGCTGCTTCCACTCATGGAGG - Intergenic
1151141028 17:71992495-71992517 GAAGCTGCTTCCACTCGTGGTGG - Intergenic
1151362344 17:73596250-73596272 CAGGCTGCCTTCTCTCATAGAGG - Intronic
1151386890 17:73760431-73760453 GAGGCTGCTTCCACTTACAGAGG + Intergenic
1152300550 17:79493098-79493120 CAGGAAGCTTCCACTCATGGTGG + Intronic
1153062878 18:1012402-1012424 CAAGATGCTGCCACTCAGAAAGG + Intergenic
1153206817 18:2711988-2712010 CAGGCTGCTTCCACTCATGGTGG - Intronic
1153841572 18:9012730-9012752 CAGGCTGCTTCCACACATGGTGG + Intergenic
1153951993 18:10065225-10065247 CAGGAAGCTTCCACTCATGGTGG - Intergenic
1154003938 18:10509831-10509853 CAGGCTGCTTCTACTTATGGTGG - Intergenic
1154371216 18:13764949-13764971 CAGGCTGCCTCCACTCATGGTGG - Intergenic
1155313742 18:24550392-24550414 CAGGCTGCTTCAACTCATGGTGG - Intergenic
1155442387 18:25875839-25875861 CAGGCTGCTTCCACTCACGGGGG - Intergenic
1155735362 18:29215977-29215999 CAGGCTGCTTCTATTCATGGTGG + Intergenic
1155848691 18:30743266-30743288 CAGGCTGCTTCTTCTCATGGAGG + Intergenic
1156312639 18:35938997-35939019 CAAGCTGCTTCCACTGGCACTGG + Intergenic
1156806857 18:41194554-41194576 CATGCTGTTTCCACTCATGGTGG - Intergenic
1157718277 18:49904337-49904359 CAGGCTGCTTCCACTCATGGTGG - Intronic
1157768108 18:50318094-50318116 CAGGCTGCTTCCACTCATGGTGG - Intergenic
1157904673 18:51558974-51558996 CAGGCTGCTTCCATTCATGGTGG + Intergenic
1157908361 18:51590948-51590970 CAGACTGCTTCCACTCATGGTGG + Intergenic
1158143257 18:54280253-54280275 CAGGCTGTTTCCACTCATGGTGG + Intronic
1158839143 18:61364729-61364751 CAGGCTGCTTCCATTCATTGTGG - Intronic
1158855839 18:61542756-61542778 CAAGCTGCTTCCATGCATGGAGG + Intronic
1159262026 18:66026452-66026474 CAGGCTGTTTCTACTCATGGTGG - Intergenic
1159814506 18:73056082-73056104 CAGGCTGCTTCCACTGATGGTGG + Intergenic
1159821695 18:73154129-73154151 AAACCTGCTTTCCCTCATAGAGG + Intronic
1160144676 18:76353718-76353740 CAGGCTGCTTCCACTCATGGTGG - Intergenic
1160617612 18:80144649-80144671 CAAGCTGCTTCATCCCAAAGGGG - Intronic
1160629957 18:80239935-80239957 CTGGCTGCTTCTACTCACAGTGG + Intronic
1161074252 19:2277425-2277447 CAGGAAGCTTCCAATCATAGTGG - Intronic
1161174736 19:2834621-2834643 CACACTGCTTACATTCATAGGGG - Exonic
1162619809 19:11833149-11833171 CAAATTGCTTACACTCATAGGGG - Exonic
1162653757 19:12112795-12112817 CACATTGCTTACACTCATAGGGG - Exonic
1162868425 19:13566811-13566833 CAGGCTGCTTCTACTCATAGTGG - Intronic
1163086608 19:14985529-14985551 CAGGCAGCTTCCAGTCATGGTGG - Intronic
1163318509 19:16557692-16557714 CAGGCTGCTTTCACTCAGTGTGG + Intronic
1164157792 19:22607081-22607103 CAAGCCGCTGCCACTCACACAGG - Intergenic
1164475955 19:28576186-28576208 CAGGAAGCTTCCACTCATGGTGG + Intergenic
1164871426 19:31647524-31647546 CAGGGTGCTTCCAATCATGGTGG + Intergenic
1165181284 19:33973117-33973139 CAGGCTGCTTGCACTTGTAGTGG - Intergenic
1165288990 19:34867996-34868018 CAAGAAGCTTCCAATCATGGTGG + Intergenic
1165661096 19:37580766-37580788 CAGGCTGCTTCCATTCATGATGG - Intronic
1166441537 19:42819578-42819600 CAGGGAGCTTCCACTCATGGTGG - Intronic
1166449670 19:42887567-42887589 CAGGGAGCTTCCACTCATGGTGG - Intronic
1166478259 19:43147852-43147874 CAGGGAGCTTCCACTCATGGTGG - Intronic
1167214920 19:48158081-48158103 CAGGATGCTTCCAGTCATGGTGG - Intronic
1167712180 19:51119155-51119177 CAGGCTGCTTCCAATCCTAGTGG + Intergenic
1167714436 19:51132224-51132246 CAGGAAGCTTCCACTCATGGTGG - Intronic
1168068464 19:53934394-53934416 CAAGCTGGTACCACTCACTGTGG - Intronic
1168701901 19:58445384-58445406 CATGCTGGCTGCACTCATAGAGG - Intergenic
925516747 2:4691588-4691610 CAAGAAGCTTTCAATCATAGAGG + Intergenic
925763823 2:7211823-7211845 CAAGGAGCTTCCAATCATAGTGG - Intergenic
925923231 2:8652165-8652187 CAGGCTGCTTCCCCTCATGGCGG + Intergenic
926058137 2:9788420-9788442 CAGGAAGCTTCCAGTCATAGTGG - Intergenic
926381933 2:12299678-12299700 CAGGCTGTTTCCACTCATGGTGG + Intergenic
926924773 2:17976436-17976458 CAGGAAGCTTCCACTCATGGGGG + Intronic
927063047 2:19442245-19442267 CAAGCTTCCTCCACTCCTAGTGG + Intergenic
927300427 2:21505989-21506011 CAGGTTACTTCCACTCATGGTGG - Intergenic
927311748 2:21639391-21639413 CAAGAGGCTTCCAATCATTGTGG + Intergenic
927514749 2:23665657-23665679 CAGGCAGCTTCCACTCATGGTGG + Intronic
928592931 2:32835552-32835574 CAGGCTGCTTCTACTCATGATGG - Intergenic
928977660 2:37105500-37105522 CCGGCTGCTTCCACTCATGGTGG - Exonic
929025020 2:37592128-37592150 CAGGCTGCTTCCACTCATGATGG - Intergenic
929804629 2:45134051-45134073 CTGGCTGCTTCCATTCATGGTGG + Intergenic
930162804 2:48175697-48175719 CAGGCTGCTTCTACTCATGGTGG + Intergenic
930453169 2:51570233-51570255 CAGGCTGCTTCCACTCATGGTGG - Intergenic
930653553 2:53986246-53986268 CAGGCTGTTTCCACTCATGGTGG - Intronic
930945881 2:57075181-57075203 CCAGATGCTTCCACTAATGGTGG + Intergenic
930966602 2:57336122-57336144 CAGGCTGCTTTCACTCTTGGTGG + Intergenic
931803118 2:65778126-65778148 CAGGCTGCTTCCACTCCTGCAGG + Intergenic
931952316 2:67379215-67379237 CATGCTTTTTCCACTCATGGTGG - Intergenic
932063946 2:68533449-68533471 CAAGCTACTCCAACTCTTAGTGG + Intronic
932072176 2:68631695-68631717 CAAGGTGCTTCCATACAAAGTGG + Intergenic
932360999 2:71105595-71105617 CAAACTGCTTCCACTTATGGTGG + Intergenic
932948938 2:76270316-76270338 CAACCTGCTTGCACTCATAGTGG - Intergenic
933203668 2:79480044-79480066 GAAGGTGCTTCCACTCATGGTGG + Intronic
933439907 2:82298870-82298892 CAAGGAGCTTTAACTCATAGTGG + Intergenic
934865614 2:97807496-97807518 TAGGCTGCTTCCACTCATATTGG - Intronic
934936161 2:98467050-98467072 CAGGCTGCTTCTACTCGTGGTGG + Intronic
935164457 2:100558027-100558049 CAGGCTGCTTCCACTCATCGTGG + Intergenic
935264785 2:101384960-101384982 CAGACTGCTTCCACTCATGGTGG - Intronic
935368824 2:102323515-102323537 CAGGCTGCTTCCAATCCTGGTGG + Intronic
935822633 2:106909400-106909422 CAAGCTGCTTCCACTCATGGCGG - Intergenic
935870768 2:107446664-107446686 CAGGCTGCTTCCACTCATAGTGG + Intergenic
936611121 2:114003003-114003025 CAGGCTGCTTTCACTCATGGTGG + Intergenic
936723161 2:115278573-115278595 CAGGCTGCTTCTACTTATGGTGG + Intronic
936987323 2:118323878-118323900 CAAGGAGCTTACACTCAGAGTGG + Intergenic
936989274 2:118345368-118345390 CAGGCTGCTTCCACTCATGGCGG - Intergenic
937282006 2:120724317-120724339 CAAGCTGCTTCCATTTATGGTGG + Intergenic
937302869 2:120853904-120853926 CAAGCTGCTCCATCTCATAGGGG - Intronic
937584320 2:123527406-123527428 GAAGCTGCTTCCACTTACTGTGG + Intergenic
937802833 2:126100463-126100485 CTGGCTGCTTCCACTCATGGTGG - Intergenic
938113532 2:128587830-128587852 CAAGCTGTTTCCACTCATGGTGG + Intergenic
938152127 2:128896203-128896225 CAGGCTGCTTCCACTCGTGGTGG - Intergenic
938283045 2:130080844-130080866 CAAGCTGCTCACACTGATATTGG - Intronic
938356141 2:130651273-130651295 CAAGCTGCTCACACTGATATTGG + Intronic
938432565 2:131258055-131258077 CAAGCTGCTCACACTGATATTGG + Intronic
938589039 2:132719727-132719749 CATGCTGCCTCCCCTCTTAGAGG - Intronic
938655095 2:133423064-133423086 AAAGCTGCTTCCATGCAGAGAGG - Intronic
939573979 2:143874128-143874150 CAGGCTGCTTGCACTCATGGTGG + Intergenic
939713169 2:145549019-145549041 CATGCTCCTTCCACTCAATGTGG - Intergenic
939888310 2:147705764-147705786 CCAACTGCTTCCACTCATGGTGG + Intergenic
940411992 2:153375915-153375937 CAGGTTGCTTCCACGCATGGAGG + Intergenic
940487490 2:154314581-154314603 CAGGCTGCTTCCACTCACGGTGG + Intronic
940787192 2:157994217-157994239 CATGGAGCTTCCACTCATGGTGG + Intronic
941197186 2:162467531-162467553 CAGGCTGCTTCCACTCATGGTGG - Intronic
941198902 2:162484870-162484892 CAGGCTGCTTCCACTCGTGATGG - Intronic
941289547 2:163658549-163658571 CAGGCTGCTTCCACTCATGGTGG + Intronic
941364100 2:164589471-164589493 CAGGCTGCTTCCACTAATGGTGG + Intronic
941589689 2:167404103-167404125 CAAGCTGCTTCCACTCATGGTGG + Intergenic
941694932 2:168541031-168541053 CAGGCTGCTTCCACTCATGATGG + Intronic
941760118 2:169233054-169233076 TAAGCTGCTTTCAATCAGAGTGG + Intronic
941810785 2:169754272-169754294 ACACCTGCTTCCACTCATGGTGG - Intronic
941953569 2:171181570-171181592 CAGGCTGCTTCCACCCATGGTGG + Intronic
942108580 2:172657927-172657949 CAGGCTGCTTCCACTCCTGGTGG + Intergenic
942518954 2:176782851-176782873 CAAGCTGTTCCCACTCATGGTGG - Intergenic
942720655 2:178948817-178948839 CAGGCTGCTTTCACCCATGGCGG - Intronic
942855892 2:180547115-180547137 CAGGCTGCTTCCACTCACGGTGG - Intergenic
942871180 2:180736163-180736185 CAAGAAGCTTCCACTTATGGTGG - Intergenic
942896108 2:181056425-181056447 CAGGCTGCTTCAACTCACAGTGG + Intronic
942903805 2:181156860-181156882 CAGGAAGCTTCCAATCATAGTGG + Intergenic
943152074 2:184126391-184126413 CAGGCTGCTTCCACTCATGGTGG + Intergenic
943203801 2:184864174-184864196 CAGGCTGCTTCCACTCATAATGG + Intronic
943986188 2:194622214-194622236 TAGGCTGCTTCCACTCTTGGTGG - Intergenic
944578283 2:201111083-201111105 CAGGTTGCTTCCACCCATGGTGG + Intergenic
944754332 2:202744257-202744279 CAGACTGCATCCACTCATGGCGG + Intronic
945145401 2:206733082-206733104 CAGGCAGCTTCTACTCATGGTGG + Intergenic
945507486 2:210659272-210659294 CAGGCTGCTTCCATTCATGGTGG + Intronic
945558283 2:211306127-211306149 CAGGCTGCTTCCAGTCTTGGTGG - Intergenic
946881943 2:224185328-224185350 CAGGCTGCTTCAACTCACAGTGG + Intergenic
946932510 2:224684518-224684540 CAGGAAGTTTCCACTCATAGCGG - Intergenic
947128569 2:226897573-226897595 CAGGCTACTTCCACTCATGGTGG + Intronic
947425797 2:229981909-229981931 CAAGAAGCTTCCAGTCATGGTGG + Intronic
947776691 2:232717675-232717697 CAGGCTGCTTACACTCATAGTGG + Intronic
948268758 2:236657737-236657759 CAAGCTTCTTCCACTCTCTGTGG + Intergenic
948543954 2:238712252-238712274 CAGGCTGCTTCCGCTCATGGTGG + Intergenic
948730820 2:239962743-239962765 CAGGAAGCTTCCAATCATAGTGG + Intronic
948761515 2:240194834-240194856 CATGCTGCTTCCTCTCATGATGG - Intergenic
948799715 2:240426855-240426877 CAGGAAGCTTCCACTCATGGTGG + Intergenic
1169334310 20:4742741-4742763 CCGGCTGCTTCTACTCATGGTGG - Intergenic
1169399029 20:5264182-5264204 TAGGCTGCTTCCCCTCATGGTGG + Intergenic
1169754296 20:9026807-9026829 CAGGCTGTTTCCACTCTTGGTGG + Intergenic
1169830030 20:9814984-9815006 CAGGCAGCTTCCACTTATGGTGG + Intronic
1169954640 20:11087726-11087748 CAAGCTGCTTGCACTCATGGTGG + Intergenic
1170062194 20:12271025-12271047 CAGGCTGCTTCCACTAATGGTGG + Intergenic
1170805111 20:19622840-19622862 CAAGGAACTTCCACTCATGGAGG + Intronic
1170869553 20:20192570-20192592 CAAGCTACTCCCACTCTAAGAGG - Intronic
1170994638 20:21340727-21340749 CAACCAGCTTTCACTCCTAGTGG + Exonic
1171470217 20:25364395-25364417 CAGGTTGCTTCCACTCAGGGTGG + Intronic
1171891196 20:30717765-30717787 CATGCTGATTCAACTTATAGAGG + Intergenic
1172299060 20:33835798-33835820 CAGGCTGCATCCACTCATGGTGG + Intronic
1172988784 20:39016119-39016141 CAGCCTGCTTCCACTCAAGGTGG + Intronic
1173048870 20:39539798-39539820 CAAGCTGCTTCCACTCAAGGTGG - Intergenic
1173139378 20:40468769-40468791 CAGGGAGCTTCCACTCATGGTGG - Intergenic
1173317547 20:41958665-41958687 CAGGCTGCTTCTACTCATGATGG - Intergenic
1173445041 20:43110128-43110150 CAGGCTGCTTCCACTCATGATGG + Intronic
1173965340 20:47108382-47108404 CAGGCTGCTTCCACTCATGGTGG - Intronic
1173969495 20:47140857-47140879 CAAGCTGCTTCCATTCATGGTGG + Intronic
1174077274 20:47946565-47946587 CGAGCTGCTTCCACTCATGGTGG - Intergenic
1174123248 20:48283303-48283325 CAGGAAGCTTCCAATCATAGGGG + Intergenic
1174123489 20:48285574-48285596 CAGGCAGCTTCCACTCACGGGGG + Intergenic
1174311229 20:49656229-49656251 CAGGCTGCTTCCACTCTTGGTGG - Intronic
1174333928 20:49844012-49844034 TAGGCTGCTTCCACTCATGGGGG - Intronic
1174553884 20:51380499-51380521 CAAGCTGCTTCCGCTCATGGTGG + Intergenic
1174681523 20:52413582-52413604 CTTACTGCTTCCACTCATGGTGG + Intergenic
1174829314 20:53798047-53798069 CAGGTTGCTTCCACTCATGGCGG - Intergenic
1174996714 20:55577909-55577931 CATGGTGCTTCCAGTCATGGTGG + Intergenic
1175287538 20:57847189-57847211 CAAGCTGCTTCCACTCATGATGG + Intergenic
1175813821 20:61873342-61873364 CAAGGTGCTTCCACTCCTGCAGG - Intronic
1177112705 21:17048118-17048140 CGAGCTGCTTCTAGTCATAATGG + Intergenic
1177948317 21:27501030-27501052 CAGGCTGCTTCAACTCATGGTGG + Intergenic
1178031575 21:28533068-28533090 CAGGGAGCTTCCACTCATGGTGG + Intergenic
1178098772 21:29243448-29243470 CAGGCTGCTTTCACTCATGGTGG + Intronic
1178110694 21:29367168-29367190 CAGGCTGCTTCCACTCATGGTGG - Intronic
1178310337 21:31524993-31525015 CAGGAAGCTTCCACTCATGGTGG + Intronic
1178349254 21:31860573-31860595 CAGGCTGCTTCCACTCAAGGTGG + Intergenic
1178361202 21:31949782-31949804 CAGGCCGCTTCCACTCATGGTGG + Intronic
1178387377 21:32163933-32163955 CAGGAAGCTTCCACTCATGGTGG + Intergenic
1178396729 21:32249686-32249708 CAGGAAGCTTCCACACATAGGGG + Intergenic
1178408600 21:32346197-32346219 CAGGCTGCTTCCACTCATGGTGG - Intronic
1178603132 21:34012282-34012304 CAGGCTGCCTCCACGCATGGTGG - Intergenic
1178802338 21:35807813-35807835 CAGGAAGCTTCCAATCATAGTGG + Intronic
1179345827 21:40556580-40556602 CAGACAGCTTCCACTCATGGTGG + Intronic
1179420080 21:41228493-41228515 CAGGCTGCTTCCAGTCATGGTGG + Intronic
1179535127 21:42046550-42046572 CAGGCTGCTTCCACTTATGGGGG + Intergenic
1181890491 22:26058765-26058787 CAAGCTGCTTCCACTCATGATGG - Intergenic
1182001213 22:26921349-26921371 CAGGCTGCTTCCACTCATGGTGG - Intergenic
1182097112 22:27633441-27633463 CAAGATGCAGCCACTCATCGAGG + Intergenic
1184709272 22:46238867-46238889 CAAGATGCTTCCAGTTACAGCGG + Exonic
949093639 3:60094-60116 CAGGCTTCTTCCACTCAGAGTGG - Intergenic
949184921 3:1179051-1179073 CAGGACACTTCCACTCATAGGGG + Intronic
949276415 3:2288285-2288307 CAGGCTGCTTCCACTCATTGTGG + Intronic
949705692 3:6814150-6814172 CAGGCTGCTTCCACCCATGGTGG + Intronic
950458958 3:13109696-13109718 CAGGGAGCTTCCACTCATGGTGG - Intergenic
950801974 3:15559977-15559999 CAGGCTGCCTCCACTCATGGGGG + Intergenic
950832673 3:15890696-15890718 CAAGCTCCTTCCACTCATGGTGG - Intergenic
950863426 3:16170450-16170472 CAAGCTGCTTCCATTCATGGTGG + Intergenic
951288825 3:20850125-20850147 CAGGCTGCTTCCACTCATGGCGG + Intergenic
951317337 3:21203639-21203661 CATGCTGCTTCCACTGAGACTGG - Intergenic
951998158 3:28754839-28754861 CAGGCTGCTTTCACTCATAGCGG + Intergenic
952122102 3:30257732-30257754 CATGCTGCTTCCACTCTTGGTGG + Intergenic
952835929 3:37601902-37601924 CAGGCTGATTCTACTCATGGTGG + Intronic
952892130 3:38050470-38050492 CAGTCTGCTTCCACTCATGGGGG + Intronic
953063539 3:39448557-39448579 CAGACTGCTTCCACTCATGGCGG + Intergenic
953230219 3:41058163-41058185 CAGTCTGTTTCCACTCATGGTGG + Intergenic
953296925 3:41728324-41728346 CAGGTTGCTTCCACTTATGGTGG + Intronic
953507554 3:43501167-43501189 CAGGCTGCTTCCACTCATGATGG + Intronic
954273219 3:49525465-49525487 CAGGAAGCTTCCAATCATAGTGG + Intronic
954577683 3:51685800-51685822 CAAGCTGCCACCACTCACAATGG - Intronic
955072913 3:55586410-55586432 TAAGATGCTTTCAGTCATAGTGG - Intronic
955118629 3:56032126-56032148 CAGGCTGCTTCCACTTTTTGTGG - Intronic
955141991 3:56278715-56278737 CATGCTGCTTCCACTCCTGGTGG + Intronic
955355914 3:58232630-58232652 CAGTATGCTTCCTCTCATAGTGG + Intergenic
955551307 3:60088038-60088060 CTGGCTGCTTACACTCATGGTGG + Intronic
956234249 3:67050195-67050217 CAGGCTGCTTCCGCTCATAATGG - Intergenic
956704918 3:71991474-71991496 CAGGAAGCTTCCACTCATGGTGG + Intergenic
956921517 3:73934851-73934873 CAGGCTGCTTCCACTCATGGTGG + Intergenic
958039224 3:88206496-88206518 CAGGCTGCTTCCACTCATGGTGG + Intergenic
958445481 3:94209803-94209825 CAGGCTTCTTCCACTCATGGTGG + Intergenic
958720141 3:97833895-97833917 CAAGCTGCTTCCACTCATGGTGG + Intronic
958967931 3:100579711-100579733 CAAGCTGCTTCCACTCACAGCGG - Intergenic
959321207 3:104877589-104877611 CAGGCTGCTTCCACTCCTGATGG - Intergenic
959517993 3:107291203-107291225 CAGGCTGCTTCCACTCATGATGG + Intergenic
959593684 3:108105910-108105932 CAAGCCACTTGCACTCATGGCGG + Intergenic
960123248 3:113968977-113968999 CAGGCTGCTTCCAGTCATGATGG + Intronic
960358077 3:116678101-116678123 CAAGCTGTTTCCACACGTACAGG - Intronic
960514449 3:118588295-118588317 CAGGCTGCTTCCACTCATGGTGG - Intergenic
960523365 3:118681266-118681288 CAGGCTGCTTCCACTCGTGGGGG - Intergenic
960541766 3:118869653-118869675 CAACTTCCTTCTACTCATAGAGG - Intergenic
960724891 3:120660124-120660146 CAGGATGCTTCCAATCATGGTGG - Intronic
961021584 3:123511993-123512015 CATGCTGCTTCCACTCATGGGGG - Intronic
961400845 3:126641379-126641401 CAAGCTGCTTCCAGTCTTAAAGG + Intronic
961498646 3:127314967-127314989 CAGGAAGCTTCCACTCATGGTGG + Intergenic
961870825 3:129986834-129986856 CAGGCTGCTTCCTCTCATGGTGG - Intergenic
961871223 3:129989745-129989767 CAGGCTGCTCCCTCTCATGGTGG - Intergenic
962047061 3:131771582-131771604 CAGGCTGCTTCCATTTATGGTGG - Intronic
962183398 3:133232418-133232440 CAAGCTGCTTCCACTGGTGGTGG - Intronic
962282131 3:134060013-134060035 GGAGCTGCCTCCACTGATAGAGG + Intergenic
962429381 3:135305589-135305611 CAGGCTGCTTCTACTTATAATGG - Intergenic
962433828 3:135346505-135346527 CAGGCTGCTTCCACTCATGGTGG - Intergenic
962558154 3:136577515-136577537 CAAGCTACTTCCACTGGTATGGG - Intronic
963170413 3:142244471-142244493 CAGGTTTCTTCAACTCATAGTGG - Intergenic
963427848 3:145155152-145155174 CAGGGAGCTTCCACTCATAGTGG + Intergenic
964445521 3:156753384-156753406 CAGGTTGCTTCTACTCATGGTGG - Intergenic
964608547 3:158585365-158585387 CAGGATGCTTCCACTTATGGAGG - Intronic
965756220 3:172029976-172029998 CAGGTTGCTTCCACTCATGCTGG - Intergenic
966004247 3:174988984-174989006 CAAGCTCTTTTCACTCACAGTGG + Intronic
966265115 3:178030975-178030997 CCTGCTTCTTCCACTGATAGTGG - Intergenic
967006427 3:185387409-185387431 TAGGCTGCTTCCACTCACGGTGG - Intronic
967071419 3:185965696-185965718 CAGGCTGCTTCCACTCACGGTGG + Intergenic
967146337 3:186609423-186609445 TAGGCTGCTTCCACTCATGGCGG - Intergenic
967398159 3:189029886-189029908 CAGGAAGCTTCCAATCATAGCGG - Intronic
967651941 3:191996418-191996440 CAGGCTGCTTCCACTCATGGTGG - Intergenic
967883784 3:194319709-194319731 CAGGAAGCTTCCACTCATGGTGG + Intergenic
967911302 3:194544699-194544721 CATGGTGTTTCCACTCATGGTGG - Intergenic
967919975 3:194607243-194607265 CAGGCTGCCTCCACTCATGGGGG - Intronic
967931347 3:194692773-194692795 CAGGCTGCTTGCACTCATGGCGG + Intergenic
967953528 3:194859391-194859413 CAGGCTGCTTCCACTTATGGGGG + Intergenic
969504739 4:7578216-7578238 CAGGCTACTTCAACTCATGGTGG - Intronic
969519948 4:7670932-7670954 GAAGCTGTTTCAACTCATGGTGG - Intronic
970040487 4:11791942-11791964 CAGGCTGCTTCAAATCATGGTGG + Intergenic
970235898 4:13957705-13957727 CAGGCTGCTTCCACTCGTGGTGG - Intergenic
970293179 4:14599290-14599312 CAGGCTGCTTCCACTCTTGGTGG - Intergenic
970403741 4:15742436-15742458 CAGGCTGCTTCGACTCATGGTGG - Intergenic
970612513 4:17738939-17738961 CAGGCTGCTTCTACTCATGGTGG - Intronic
970809223 4:20072020-20072042 CAGTCTGCTTCCACTCATGGTGG + Intergenic
970935421 4:21564748-21564770 CAGGATGCTTCCACTCATGGTGG + Intronic
971175790 4:24281351-24281373 CAGGCTGTTTCCACTCACAGTGG + Intergenic
971575134 4:28263261-28263283 CAGGCTGCTTCAACTCATAGTGG - Intergenic
971657156 4:29363538-29363560 CGAGCTGCTTTCACTTATGGTGG + Intergenic
972373829 4:38451643-38451665 CAAGAAGCTTCCAGTCATGGTGG + Intergenic
972741355 4:41889740-41889762 CAAGCTGCTTCAACTCATTGTGG - Intergenic
972878296 4:43393215-43393237 CAGGCTGCTTCTACTCATGGTGG + Intergenic
973660406 4:53099559-53099581 CATGCTGCTTCCATTCATGGTGG + Intronic
973826781 4:54715478-54715500 CAGGAAGCTTCCACTCATGGTGG + Intronic
974125192 4:57687621-57687643 CAGGCTGCTTCCAATCATGATGG + Intergenic
974156848 4:58084289-58084311 CAGTCTTCTTCCACTCACAGTGG - Intergenic
974372955 4:61041612-61041634 CAGGCTGTTTCCATTCACAGTGG + Intergenic
974601589 4:64089836-64089858 CAGGCTGTTTCTACTCATGGCGG + Intergenic
974665060 4:64951286-64951308 TGGGCTGCTTCCACTCATCGTGG + Intergenic
975447366 4:74481498-74481520 CAGGAAGCTTCCACTCATGGTGG + Intergenic
976198049 4:82552118-82552140 CAGGCTGTTTCCACTCATGGTGG - Intronic
976345516 4:83995096-83995118 CAAGCTACTGTCACTCATATTGG + Intergenic
976463823 4:85344566-85344588 CAGGCTGCTTCCACTCATTGTGG - Intergenic
976794375 4:88915929-88915951 CAGGCTGCTTCCACTCATGGTGG - Intronic
976821203 4:89209040-89209062 CAGGTTGCCTCCACTCATGGTGG + Intergenic
977055853 4:92189464-92189486 TCAGCTCCTTCCACTCATGGTGG + Intergenic
977169523 4:93743545-93743567 CAGGGTGCTTCCTCTCATGGTGG + Intronic
977304499 4:95305636-95305658 CATGCTGCTTCCTTTAATAGTGG + Intronic
977337338 4:95715732-95715754 CAGGCTGCTTCCACTCATGGTGG - Intergenic
978735893 4:112083770-112083792 CAATGTCCTTCCACTCAGAGAGG + Intergenic
978871151 4:113579625-113579647 CAGGAAGCTTCCAATCATAGTGG - Intronic
979253033 4:118585208-118585230 CAGGCTGATTCCACTCATAGTGG + Intergenic
979446871 4:120824023-120824045 CAGGCTCCTTCTACTCATGGTGG - Intronic
979497830 4:121404606-121404628 CAGGCTGCTTCCAGTCATGGTGG + Intergenic
979986620 4:127324074-127324096 CAGGAAGCTTCCACTCATGGAGG - Intergenic
979986886 4:127326109-127326131 CAAGAAGCTTCTACTCATGGTGG - Intergenic
980193657 4:129559398-129559420 CAAGCTACCTCCACACATTGAGG + Intergenic
980212937 4:129813726-129813748 CAGGCTGCTTCCCCTCATGGTGG + Intergenic
980771465 4:137378862-137378884 CAAGCTGCTGTGACTCATAGTGG + Intergenic
980904677 4:138936841-138936863 CAGGCTGCTTCCACTCATAGCGG + Intergenic
981659326 4:147147270-147147292 CAAGAAGCTTTCACTCATGGTGG - Intergenic
982162757 4:152586463-152586485 CAGGAAGCTTCCACTCATGGTGG - Intergenic
982686245 4:158493075-158493097 CAGGCTCCTTCCACTTATGGCGG + Intronic
982866489 4:160519084-160519106 CAGGCTGCTTCCACTCATGGTGG - Intergenic
982871878 4:160589974-160589996 CTGGCTGCTTCCACTCACAGTGG + Intergenic
983669689 4:170221718-170221740 CAGGCTGCCTCCACACATGGTGG - Intergenic
983921507 4:173350783-173350805 CAGGAAGCTTCCAATCATAGTGG + Intergenic
984276848 4:177621216-177621238 CAGCCTGCTTCCACTCATAGTGG - Intergenic
984608889 4:181816129-181816151 TAAGACGTTTCCACTCATAGTGG + Intergenic
984935003 4:184882248-184882270 CAGGAAGCTTCCACTCATGGCGG - Intergenic
985022076 4:185702261-185702283 CATGATGCTTCCACTCCTGGTGG + Intronic
985879691 5:2628830-2628852 CATGCTGCTTCCTCTCTCAGTGG + Intergenic
986137112 5:4990661-4990683 CCAGCTGCTCCCACACACAGTGG - Intergenic
986768592 5:10950655-10950677 TAGGTTGCTTCCACTCATGGTGG + Intergenic
987069773 5:14325370-14325392 CAGGCTGCTTCCACTCAGCATGG + Intronic
987228028 5:15863853-15863875 ACAGCTGCTTCCACTCATGGTGG - Intronic
987460400 5:18202129-18202151 CAAGAAGCTTCCAATCATGGTGG - Intergenic
987723289 5:21665051-21665073 CAGGCTGCTTTCACTCATGGGGG - Intergenic
988423312 5:31032968-31032990 CTGGCTGCTTCCACTCATGATGG - Intergenic
988548935 5:32182947-32182969 CAGGCTGCTTCCATTCATAGTGG - Intergenic
988593158 5:32566934-32566956 CAGGCTGCCTCCACTCATGGTGG + Intronic
988606560 5:32683609-32683631 CAACCTGCTTCCACTCATGGTGG - Intergenic
988862291 5:35295036-35295058 CAGGCTGCTTCTACTTATAGTGG + Intergenic
989619661 5:43371940-43371962 CAGGCTGCTTCCACTAATGGTGG + Intergenic
989644806 5:43619860-43619882 AAGGCTGCTTCAACTCATGGTGG + Intronic
990130376 5:52574860-52574882 CAGGCTGCTTCTACTAATGGTGG - Intergenic
990443066 5:55866065-55866087 GAAGCAGCTTCCATTCACAGAGG - Intronic
990513888 5:56514582-56514604 CAGGCTGCTTCCACTCATGGGGG - Intronic
990941020 5:61203251-61203273 CAAGAAGCTTCCACTCACGGAGG - Intergenic
990995702 5:61730323-61730345 CAGGAAGCTTCCACTCATGGTGG + Intronic
991019298 5:61963403-61963425 CAAGCTACTTCCACTGATAAGGG - Intergenic
991098990 5:62770910-62770932 CAGGGAGCTTCCACTCACAGTGG - Intergenic
991102239 5:62805393-62805415 CATGAAGCTTCCACTCATGGTGG - Intergenic
991568392 5:68029231-68029253 CAAGCTGCTCCCTCTTAAAGAGG - Intergenic
992000383 5:72430429-72430451 CAAGCTGCTTCCACTCATGGTGG - Intergenic
992208362 5:74452930-74452952 CAGGCTGCTTCCACTCATGGTGG + Intergenic
992768301 5:80023753-80023775 GAAGCTGCTTCAACTCTTGGTGG + Intronic
992799714 5:80284859-80284881 AAGGTTGCTTCCACTCATGGTGG + Intergenic
992956513 5:81915104-81915126 GAAACTCCTTCCACTCATGGTGG + Intergenic
993003314 5:82404713-82404735 CAGGAAGCTTCCACTCATGGTGG + Intergenic
993042986 5:82836513-82836535 CAAGAAGCTTCCAATCATGGTGG + Intergenic
993178811 5:84521630-84521652 CAGGCTGCTTCCATTCATGGTGG - Intergenic
993202770 5:84838561-84838583 CAGGCTTCTTCCACTCATGATGG - Intergenic
993346820 5:86794397-86794419 CGGGCTGCTTCCACTCATGGTGG - Intergenic
993437408 5:87915013-87915035 CAGGCTGCTTCCACTCATGGTGG + Intergenic
993653882 5:90554969-90554991 TCAGGTGCTTCCACTCATGGTGG - Intronic
994726555 5:103443226-103443248 CAGACTGCTTCCACTCATGGTGG - Intergenic
995407946 5:111823063-111823085 CAGGCTGCTTGAACTCATGGGGG + Intronic
995463719 5:112429342-112429364 CAGGCTCCTTCTACTCATGGTGG + Intergenic
995913168 5:117212351-117212373 CAGACTGCTTCCACTCATAGCGG + Intergenic
996112206 5:119579219-119579241 CAGGCTGCTTCCACTAGTGGTGG - Intronic
996363261 5:122673925-122673947 CAGACTGCTTCTACTCATGGTGG + Intergenic
996398131 5:123033501-123033523 CAGGCTGCTTCCAGTCACGGCGG - Intronic
996828482 5:127712484-127712506 CAGACTGCTTCCACTAATGGTGG - Intergenic
997905411 5:137811626-137811648 CAAGAAGCTTACAGTCATAGTGG - Intergenic
998072095 5:139205904-139205926 CAGGCAGCTTTCACTCATGGAGG - Intronic
999223998 5:150004789-150004811 GAAGCTGCTGCCCCTCTTAGGGG + Intronic
999227159 5:150035271-150035293 CAGACTGCCTCCACTCATGGTGG + Intronic
999566462 5:152867859-152867881 CAGGCTGCTTCTGCTCATGGTGG - Intergenic
999649243 5:153749460-153749482 CAGGCTGCTCCCACTCACGGAGG + Intronic
999845887 5:155479708-155479730 CAGGCTGCTTCTATTCATAGTGG - Intergenic
1000882752 5:166716395-166716417 TAGGCTGCTTTCACTCACAGAGG + Intergenic
1001326899 5:170734988-170735010 CAGGCTGCTTCCACTCACAGTGG - Intronic
1001327518 5:170739884-170739906 CAGGCTGCTTCCACTCATAGTGG - Intergenic
1001452170 5:171835322-171835344 AAAGCTGCCTTCACTCAAAGAGG - Intergenic
1001858005 5:175029469-175029491 CATGTTGCTTCCACTCATGATGG - Intergenic
1001890949 5:175337998-175338020 CAGGAAGCTTTCACTCATAGTGG - Intergenic
1002459497 5:179365978-179366000 CCGGCTGCTTCCACTCATGGAGG - Intergenic
1002845649 6:942188-942210 CAGGCTGCTTCTACTCATGGTGG + Intergenic
1003077351 6:2994292-2994314 CAGGCTGCCTCTACTCATGGAGG - Intronic
1003144454 6:3498205-3498227 CATGCTGCTTCCTCTGAAAGAGG - Intergenic
1003219436 6:4145586-4145608 CAGGCTGCTTCCATTCCTGGTGG + Intergenic
1003420013 6:5948856-5948878 CAGGCTGTTTCCACTCACGGTGG + Intergenic
1004060159 6:12187501-12187523 CAAGCTGCTTCCAGTAATGGTGG - Intergenic
1004088634 6:12476423-12476445 CAGGCTTCTTCCACTCATGGTGG + Intergenic
1004473575 6:15950464-15950486 CAGGCTGCTTTCACTCATCGTGG - Intergenic
1004624174 6:17359099-17359121 CAGGCTGGTTCCACTCATGGTGG - Intergenic
1005222417 6:23601841-23601863 CAGGCTGCTTCCACTCATGGTGG + Intergenic
1005358788 6:25010377-25010399 CAGACTGCTTCCACTCAAGGCGG - Intronic
1005489657 6:26335777-26335799 CAGGAAGCTTCCACTCATGGTGG + Intergenic
1005595086 6:27371179-27371201 CAAGTTGCTTCCATTCATGGTGG - Intergenic
1006610721 6:35292762-35292784 CAAGTTGCTGCTGCTCATAGAGG - Exonic
1006938779 6:37737700-37737722 CAGACTGCTTCCACTCATGGTGG + Intergenic
1007083847 6:39128724-39128746 TCAGCTGCTTCCACTCATGGTGG + Intergenic
1007488361 6:42198263-42198285 CACGCTGCTTCCACTGAGACCGG - Intergenic
1008180506 6:48322256-48322278 CAGGAAGCTTCCACCCATAGTGG + Intergenic
1008271541 6:49495703-49495725 CAGGCTGCTTCTACTCATGGTGG - Intergenic
1008423463 6:51329821-51329843 CAGGAAGCTTCCACTCATGGTGG - Intergenic
1008533357 6:52485740-52485762 CAGGCTGCTTCCCTTCATGGTGG - Intronic
1008671281 6:53771862-53771884 CAAGCTGCTTTCACTCATGGAGG + Intergenic
1008747228 6:54686811-54686833 CAAGGAGCTTCCACTCATTGTGG - Intergenic
1009058933 6:58374377-58374399 CAGGCTACTTCCACTCATGGTGG + Intergenic
1009059155 6:58376340-58376362 CAGGCTGCTTCCACTCATGTTGG + Intergenic
1009231690 6:61070789-61070811 CAGGCTGCTTCCACTCATGTTGG - Intergenic
1009231908 6:61072746-61072768 CAGGCTACTTCCACTCATGGTGG - Intergenic
1009314747 6:62204053-62204075 CAAGCTGCTTCCACTCATGGTGG - Intronic
1009521317 6:64685612-64685634 CAGGCTGTTTCCACTCGTGGAGG - Intronic
1010554996 6:77267815-77267837 CGGGCTGCTTCCACTCATTGCGG - Intergenic
1011435566 6:87333111-87333133 CAGGTTGCCTCCACTCATGGTGG + Intronic
1012087029 6:94840867-94840889 CAAGAAGCTTACAGTCATAGTGG - Intergenic
1012762872 6:103324238-103324260 CATGCTGCTTTCACTCGTGGTGG - Intergenic
1013019427 6:106197712-106197734 CAGGCTGCTTCTGCTCATGGTGG - Intronic
1013120546 6:107136973-107136995 CAGGCTGCTTCCACTCATGGTGG + Intergenic
1014641078 6:123911329-123911351 CAGGAAGCTTCCACTCATAGTGG + Intronic
1015285984 6:131487103-131487125 CAGGCTTCTTCCACTCATGGTGG + Intergenic
1015520898 6:134130275-134130297 CAAGTTGCTTCCACTCATGGTGG - Intergenic
1016193159 6:141295864-141295886 CAGACTGCTCCCACTCATGGTGG + Intergenic
1016460494 6:144276069-144276091 CAGGCTGCTTCTACTCATGACGG + Intergenic
1016836560 6:148483180-148483202 CAGGCTGCTTCCACTTATGGTGG + Intronic
1016861688 6:148726510-148726532 CAGGCTGCTTCCACTCATGGTGG + Intergenic
1017385698 6:153880265-153880287 CAGGCTGCTTCCACTCATGGTGG - Intergenic
1017646430 6:156543554-156543576 CAAGCTGCCTCCACTCCTGGTGG - Intergenic
1017959270 6:159207555-159207577 AAAGCTGCTTCCCCTCTCAGAGG - Intronic
1018565397 6:165146207-165146229 CAGGAAGCTTCCACTCATGGTGG - Intergenic
1018595044 6:165470131-165470153 CAGGCTGCTTCCACTCCTGGAGG + Intronic
1018754031 6:166832943-166832965 CAAGCTGCTTTCAAACATATTGG - Intronic
1019331019 7:460864-460886 CAAGCACCTCCCACTCAAAGGGG + Intergenic
1019602230 7:1890457-1890479 CAGGCTGCGTCCACTCATGGCGG - Intronic
1019882166 7:3871588-3871610 CAGGCTGCTTCCATTCATTGTGG + Intronic
1019885813 7:3903973-3903995 CAGGCTGCTTCCACTCATGGTGG - Intronic
1019996188 7:4725807-4725829 CAAGGTGCCTGCACTCAGAGGGG + Intronic
1020339524 7:7094785-7094807 CAGGAAGCTTCCATTCATAGTGG - Intergenic
1020754762 7:12188992-12189014 CAGGCTTCTTCTACTCATGGTGG - Intergenic
1021246888 7:18274306-18274328 CATGCTGCTTCAACTCATGGTGG + Intronic
1021761734 7:23908942-23908964 AAAGCTGCTTCCACACATGTAGG - Intergenic
1022409609 7:30128804-30128826 CAGGCTGCTTCCACTCAAGGTGG + Intronic
1022435951 7:30385334-30385356 CAAGCGGCTTCCGCTCGTGGTGG + Intronic
1022917148 7:34968892-34968914 CAAGCTACCTCCATTTATAGTGG + Intronic
1023706195 7:42944020-42944042 CAGGAAGCTTCCAGTCATAGTGG - Intronic
1023926132 7:44671183-44671205 CAGGCTGCTTCCACTCCTAGTGG + Intronic
1024316560 7:48024679-48024701 CCAGCTGCTTCCGCTCATGGTGG + Intronic
1024467767 7:49730747-49730769 CAGGTTGTTTCCACTCATGGTGG - Intergenic
1024677563 7:51650750-51650772 CAGGCTGCTTCCACTCATGATGG - Intergenic
1024977610 7:55128089-55128111 CAAGCAGCGTTCATTCATAGTGG + Intronic
1025987424 7:66465809-66465831 CAGGAAGCTTCCAATCATAGTGG - Intergenic
1026003708 7:66583418-66583440 CAGGAAGCTTCCAATCATAGTGG - Intergenic
1026043305 7:66886924-66886946 CAGGAGGCTTCCACTCATGGCGG + Intergenic
1026506573 7:70989582-70989604 CAGGCTGCTTGCCCTCATGGTGG - Intergenic
1026594389 7:71722217-71722239 TGGGCTGCTTCCACTCATGGGGG + Intergenic
1027290470 7:76703807-76703829 CAGGCTGCTTCCACTGATTGTGG - Intergenic
1027424896 7:78052409-78052431 CAGGCGGCTTCCACTCCTGGCGG - Intronic
1027580711 7:79991400-79991422 CAGGCTGCATACACTTATAGTGG - Intergenic
1027677649 7:81179937-81179959 CAGGAAGCTTCCAATCATAGCGG - Intronic
1027757584 7:82234171-82234193 CAAGATGCTTCCCCTAATGGAGG + Intronic
1028516047 7:91679320-91679342 CAGACTGCTTCCACTAATGGTGG - Intergenic
1030007896 7:105136484-105136506 CACTCTGCTTCCACTAAGAGGGG + Intronic
1030029843 7:105358883-105358905 CAGGCTGCTTCCACCCATGCTGG + Intronic
1030276651 7:107728304-107728326 CAAGCTGCTTCCACATATTTAGG + Intergenic
1030602225 7:111605514-111605536 CAAGCTGCCTCCACTCATGGTGG - Intergenic
1031009095 7:116505541-116505563 CAGGAAGCTTCCACTTATAGTGG + Intronic
1031382254 7:121101707-121101729 CAAGAAGCTTCCACTGATGGTGG + Intronic
1031466179 7:122115015-122115037 CCAGCTGCTTCCATTATTAGAGG - Intronic
1031506964 7:122596938-122596960 CAGGCTGCTTCCACACCTGGTGG + Intronic
1032311016 7:130787186-130787208 CATGCTGCTTCCACTCATGATGG - Intergenic
1032436220 7:131902399-131902421 CAGGCTACTTCCACTCATAGTGG - Intergenic
1033594380 7:142845786-142845808 CAAGAAGCTTCCAGTCATGGTGG - Intergenic
1033995376 7:147339436-147339458 TGTGCTGCTTCCACTCATGGTGG - Intronic
1034443779 7:151101457-151101479 CAAGCTGCTGGCACTCATCAGGG + Intronic
1034543970 7:151777580-151777602 CAGGCTGCTTCCACTCATGGAGG - Intronic
1034726440 7:153340550-153340572 CAGCCTGCTTCCACTCATGGAGG + Intergenic
1034973417 7:155433545-155433567 CAGGCAGCTTCCAGTCATGGTGG - Intergenic
1035030494 7:155854179-155854201 CAAGCTGCTTCCACTCATGGTGG + Intergenic
1035301572 7:157901037-157901059 CAGGCTGCTTCCACTTGCAGTGG + Intronic
1035724375 8:1815409-1815431 CAGGCTGCTTCCACTCACGGTGG + Intergenic
1036387913 8:8297771-8297793 CAGGTTGCTTCCACTCTTGGTGG - Intergenic
1036461652 8:8958856-8958878 CAAGCTGCTTCCTGAGATAGGGG + Intergenic
1036509103 8:9383933-9383955 CAGGCTGCTTCCACTCAAGTTGG - Intergenic
1036526713 8:9541696-9541718 CAGGCTGCTTCCATTTATGGTGG - Intergenic
1036666185 8:10742124-10742146 CAAGAAGCTTCCAATCATGGTGG + Intronic
1037393750 8:18420690-18420712 CAGGCTGCTTCCACACATGGTGG - Intergenic
1037503416 8:19506786-19506808 CAGGCTGCTTCCACTCATGGTGG - Intronic
1037557872 8:20043038-20043060 TAGGCTGCTTCAACTCATGGTGG - Intergenic
1037573223 8:20176315-20176337 CAGGGAGCTTCCACTCATGGTGG - Intronic
1037717937 8:21415438-21415460 CAGACTGCTTCCACTCAAGGTGG - Intergenic
1037970679 8:23169600-23169622 CAATCTACTTCCATTCATATAGG - Intergenic
1038270892 8:26074895-26074917 CAGGCTGCTTCCACTCATGGCGG + Intergenic
1038572921 8:28678564-28678586 CAGGCTGCTTTCACTCATGGGGG - Intronic
1038599680 8:28927457-28927479 CAGGCTACTTCCACTCATGGTGG + Intronic
1038701715 8:29855302-29855324 CAGCCTGCTTCCACTCATGGTGG - Intergenic
1039035169 8:33351581-33351603 TAGGCTGCTTCCACTCTTGGTGG - Intergenic
1039189412 8:34955791-34955813 CAGGCTGCTGCCACTCATGGTGG + Intergenic
1039236289 8:35506199-35506221 CAAGCTGGCTTCACTCATGGAGG + Intronic
1039407125 8:37322932-37322954 CAGGTTGCTTGCACTCATGGTGG + Intergenic
1039765358 8:40622681-40622703 CAGGAAGCTTCCACTCATGGCGG + Intronic
1039922179 8:41901114-41901136 CAGGCTGCTTCCAGTCATGGTGG - Intergenic
1040055481 8:43053867-43053889 CAGGCTGCTTCAACTCATGGGGG + Intronic
1040074325 8:43213752-43213774 CGTGCTGCCTCCACTCATGGTGG - Intergenic
1040525648 8:48222237-48222259 CAGGAAGCTTCCACTCATGGTGG + Intergenic
1040914889 8:52558929-52558951 CAGGCTGCTTCCACTCATGATGG + Intronic
1041335824 8:56781719-56781741 CAGGCTGCTTCCACTCATGGTGG - Intergenic
1041598276 8:59683146-59683168 CAGGAAGCTTCCACTCATGGTGG - Intergenic
1042490214 8:69389243-69389265 CAGGCCTCTTCCACTCATTGTGG + Intergenic
1042899049 8:73703330-73703352 CAGGATGCTTCCAATCATGGTGG - Intronic
1043104815 8:76094549-76094571 CAGGCTGCTTCCACTCATGGGGG - Intergenic
1043421301 8:80101626-80101648 CAGGAAGCTTCCACTCATAGTGG + Intronic
1043652551 8:82614539-82614561 CATGCTGCTTCTACTCATGAGGG - Intergenic
1043798834 8:84580402-84580424 CAGGCAGCTTTCACTCAAAGTGG + Intronic
1044024223 8:87148857-87148879 ACAGCTGCTACTACTCATAGGGG + Intronic
1044433566 8:92136163-92136185 CACACTGCTTCAACTCATGGTGG + Intergenic
1044801101 8:95957260-95957282 TAAGCTGCTTCCACTCATGGTGG - Intergenic
1044923920 8:97193657-97193679 CAGGCTGCTTCAACTCATGGTGG - Intergenic
1044984945 8:97748972-97748994 GAGGCTACTTCCACTCATGGGGG + Intergenic
1045014211 8:97985151-97985173 AAGGCTGCTTCCACTCACAGCGG + Intronic
1045371985 8:101533667-101533689 CAACCTGCTTCCACCCATGCTGG - Intronic
1045430768 8:102112901-102112923 CAGGCTGCTTCCATTCATGATGG - Intronic
1045464877 8:102460608-102460630 CAAGAAGCTTTCAATCATAGTGG - Intergenic
1045594851 8:103641815-103641837 CAAGTTGCTTCCACTCATGGTGG - Intronic
1046040468 8:108897279-108897301 CACACTGCTTCCACTCATAGTGG - Intergenic
1046201315 8:110931762-110931784 CAAGCTGCTTTTACTCATGGTGG + Intergenic
1046236495 8:111429910-111429932 CAGGCTGCTTCCTCTCCTGGAGG + Intergenic
1046770612 8:118112897-118112919 CAAGCTCCTGCCACTCCCAGTGG + Intergenic
1046839724 8:118842844-118842866 CAGGCTATTTCCACTCATGGTGG - Intergenic
1047533838 8:125701257-125701279 CAGGCTGCTTCCCCTTATGGTGG + Intergenic
1047877079 8:129150297-129150319 CAAGATCCTTCCCCTCATAGGGG + Intergenic
1048025594 8:130583922-130583944 CAGACTGCTTCCACTCATGTGGG + Intergenic
1048069411 8:131005800-131005822 GAAGCTGTTTCCACTCCTATGGG - Intronic
1048217393 8:132508984-132509006 CATACTGCTTCTACTCATGGTGG + Intergenic
1048355212 8:133648062-133648084 CCAGCTGCTTCCACTGATGGTGG - Intergenic
1048516431 8:135115869-135115891 CAGGCTGCTTCCACTCTTGGTGG + Intergenic
1048578877 8:135714688-135714710 CAGGCTGCTTCCACTCATGGTGG + Intergenic
1048653011 8:136501613-136501635 CAGGCTGCGTCCACCCATGGTGG - Intergenic
1049331880 8:142058976-142058998 CCAGCTGCCTCCACTCAGGGTGG + Intergenic
1049498573 8:142948546-142948568 CAGGCTGCCTCCACTCATGGTGG + Intergenic
1049830457 8:144698277-144698299 CAGGCTGCTTTCACTTATGGTGG - Intergenic
1050563971 9:6863440-6863462 CATGTTGCTTCCATTCATGGTGG + Intronic
1050582533 9:7075590-7075612 CAGGCTGCTTCAACTCACTGTGG - Intronic
1050868350 9:10533169-10533191 CAGGCTGCTTCCACTCCTGGAGG - Intronic
1052193724 9:25686821-25686843 CAGGCTGCTTCCACTCGTGGTGG - Intergenic
1052282937 9:26753811-26753833 CAGTCTGCTTCCACTCATGGTGG + Intergenic
1053537507 9:38939825-38939847 CAAGCTGCTTCCACTCATGCGGG - Intergenic
1053595034 9:39551876-39551898 CATGTTGCTTCCACACATGGCGG - Intergenic
1054571220 9:66813097-66813119 CATGTTGCTTCCACACATGGCGG + Intergenic
1054628628 9:67424105-67424127 CAAGCTGCTTCCACTCATGCGGG + Intergenic
1054834468 9:69661858-69661880 CATGCTGCTTCCACTCATAGTGG - Intronic
1055434070 9:76274884-76274906 CAGGCTGCTTCCACTCATGGTGG + Intronic
1055782512 9:79834667-79834689 TAGGCTGCTTCCATTCATGGTGG + Intergenic
1056113594 9:83420836-83420858 CAGGCTGCTTCCACTGACGGTGG - Intronic
1056237428 9:84608955-84608977 CTTGCTGCATCCTCTCATAGTGG + Intergenic
1056371253 9:85956883-85956905 TAGGCTGCTTCAACTCATGGTGG + Intronic
1056949548 9:91031077-91031099 CAGGCTGCTTCCATGCATGGTGG - Intergenic
1057005250 9:91551620-91551642 CAGGCTGCTTCCACTCATGGTGG - Intergenic
1057113505 9:92497967-92497989 CAGGCTGCTTCCACTCATGGTGG - Intronic
1058770129 9:108222886-108222908 CAGGCTTCTTCCACTTATGGTGG - Intergenic
1058808644 9:108617599-108617621 CAGGCTGCTTCCCCTCATGGTGG - Intergenic
1058918798 9:109593670-109593692 CAAGCTGCTTCCACTCATGGAGG + Intergenic
1060319962 9:122549284-122549306 CAAGAAGCTTCCAATCATGGTGG - Intergenic
1060789056 9:126473519-126473541 CAGGAAGCTTCCAATCATAGTGG + Intronic
1061708751 9:132473028-132473050 CAGGCTGCTTCCACTCACAGCGG + Intronic
1061830200 9:133287056-133287078 CAGACTGCTTCCACTCAAGGCGG + Intergenic
1203560809 Un_KI270744v1:55492-55514 CATGCTGATTCAACTTATAGAGG + Intergenic
1185663447 X:1745256-1745278 CAAGGAGCTTCCACTCATGACGG - Intergenic
1185715491 X:2338688-2338710 CAGGAGGCTTCCACTCATGGTGG - Intronic
1185742580 X:2545701-2545723 CAGGAAGCTTCCACTCATGGTGG - Intergenic
1185921424 X:4097139-4097161 CAGGAAGCTTCCACTCATGGTGG - Intergenic
1186093561 X:6075767-6075789 CAGGAAGCTTCCACTCATGGTGG - Intronic
1186149346 X:6657669-6657691 CAGGCTGCTTCCACTCAGGATGG - Intergenic
1186188341 X:7043432-7043454 CAGGGAGCTTCCACTCATGGTGG - Intergenic
1186270316 X:7879488-7879510 CAAACTGCTTTGACTCAGAGAGG - Intergenic
1186421005 X:9426427-9426449 CAGTCTGCTTCCACTCATGGTGG + Intergenic
1186920291 X:14271093-14271115 CAGGCTGCTTTCACTCATGGGGG - Intergenic
1186983097 X:14979427-14979449 CAAGATGTTTGCACTCATGGTGG + Intergenic
1187123450 X:16431207-16431229 CAGGATGCTTCCACTCATGGTGG - Intergenic
1187529986 X:20087445-20087467 CAGGCTACTTCCACTCATGGTGG - Intronic
1187686414 X:21819898-21819920 CAAGAAGCTTCCAATCATGGTGG - Intergenic
1187686837 X:21824245-21824267 CAGGAAGCTTCCACTCATGGTGG + Intergenic
1187747573 X:22426385-22426407 TAAGTTGCTTCCACTCATGATGG + Intergenic
1187995181 X:24918754-24918776 CGGGCTGCTTCCTCTCATGGGGG + Intronic
1188293854 X:28421285-28421307 CAGAATGCTTCCACTCATGGTGG + Intergenic
1188295350 X:28440762-28440784 CAGGCTGCTTCCACACATGGTGG - Intergenic
1188364635 X:29300039-29300061 CAGGCTGCTTCCACTTATAGTGG - Intronic
1189139412 X:38585877-38585899 CAGGCTACTTCCACACATGGTGG - Intronic
1189201091 X:39196250-39196272 CAAGCTGCCTCCACTCATGGTGG + Intergenic
1189295345 X:39913852-39913874 CAAGCTGCTTTGACTAATGGAGG - Intergenic
1189845473 X:45132454-45132476 CAGGAAGCTTCCACTCATGGTGG + Intergenic
1189851171 X:45177550-45177572 CAGGAAGCTTCCACTCATGGTGG - Intronic
1190032318 X:46986092-46986114 CAGGCTGCTTCTACTCATGGTGG - Intronic
1190138961 X:47824406-47824428 CAGGGTGCCTCTACTCATAGTGG + Intergenic
1190512999 X:51193114-51193136 CAAGAAGCTTCCAATCATGGTGG + Intergenic
1190537008 X:51439304-51439326 CAGATTGCTTCCACTCATGGTGG + Intergenic
1190690651 X:52910411-52910433 CGGGCTGCTTCAACTCATGGTGG - Intergenic
1190695332 X:52945381-52945403 CGGGCTGCTTCAACTCATGGTGG + Intronic
1190892457 X:54582283-54582305 CAAGCAGCTTCTACCCATGGTGG - Intergenic
1191097998 X:56694889-56694911 CAGTCTGCTTCCACTCATGATGG + Intergenic
1191658127 X:63621762-63621784 CAGGCTACTTCCGCTCATGGTGG - Intergenic
1192030567 X:67508311-67508333 CTGGATGCTTCCACTCATAGTGG - Intergenic
1192124870 X:68492688-68492710 CAGGCTGCTTCAACTCACTGTGG + Intergenic
1192611564 X:72572378-72572400 GACGCAGTTTCCACTCATAGGGG - Intronic
1193022348 X:76803696-76803718 CAGGCTGCTTCCAGTCATGGTGG - Intergenic
1193326525 X:80184205-80184227 CAGGCTGCTTCCACTCATGGTGG - Intergenic
1193393223 X:80954229-80954251 CAGGCTGCTTCCACTCTTGGTGG - Intergenic
1193547636 X:82849387-82849409 CAGGCTGTTTCCACTTATGGTGG - Intergenic
1193945613 X:87729458-87729480 CAAGCTGCATCAATACATAGTGG + Intergenic
1193949860 X:87784490-87784512 CAGGCTGCTTCCACTCATGGTGG + Intergenic
1195342174 X:103916989-103917011 AAAGCTGCTTCCACTCTTTCAGG + Intergenic
1195556009 X:106225119-106225141 CAGGCTGTTTCCACTCATAATGG - Intergenic
1195627412 X:107018628-107018650 CAGGCTGCTTCAACTCATGAAGG + Intergenic
1195989825 X:110671504-110671526 CCAGTAGCTTCCACTCATGGTGG + Intergenic
1196288087 X:113905782-113905804 CAGGCTTCCCCCACTCATAGTGG - Intergenic
1196343578 X:114625534-114625556 CGGGCTGCTTCCACTCATGGTGG - Intronic
1196500406 X:116374384-116374406 CAGGCTGCTTTCTCTCATGGCGG + Intergenic
1196776458 X:119342658-119342680 CAGGCTGCTTCCACTCATGGTGG + Intergenic
1196868819 X:120094010-120094032 CAGGAAGCTTCCACTCATGGAGG + Intergenic
1197367682 X:125584087-125584109 CAAGGTGCTTCCACTCAGGGCGG - Intergenic
1198002925 X:132458511-132458533 TGTGCTGCTTCAACTCATAGTGG + Intronic
1198070473 X:133143354-133143376 CAGGCTACTTCCACTTATGGTGG - Intergenic
1198843697 X:140886275-140886297 CAGACTGCTTTCACTCATGGTGG - Intergenic
1198986676 X:142462716-142462738 CAGGTAGCTTCCAATCATAGGGG - Intergenic
1198988742 X:142486237-142486259 CAGGCTGCTTCCACTGATGGTGG + Intergenic
1199296381 X:146163386-146163408 CAGGCAGCTTCCAATCATGGTGG - Intergenic
1199328511 X:146530699-146530721 CAGGCTGCTTCTACTCATGGCGG + Intergenic
1199355090 X:146853198-146853220 CAGGTTGCTTCCACTCGTGGGGG - Intergenic
1199741562 X:150740775-150740797 CAGGCTGCTTCCACTCATGGTGG + Intronic
1200048692 X:153416836-153416858 CAAGCTGCTTCCATTCAGGGTGG + Intergenic
1200257838 X:154594239-154594261 CGGGCTGCTTCCACTCATTGTGG - Intergenic
1200344911 X:155438449-155438471 GAGGCTGCTTCCATTCATTGTGG - Intergenic
1200363669 X:155637717-155637739 GAAGCAGCTACCACTCCTAGGGG - Intronic
1201224807 Y:11808377-11808399 CAAACTGCTTCTACTCATGGTGG - Intergenic
1201341948 Y:12943571-12943593 CAGTTTGCTTCCACTCATGGTGG - Intergenic