ID: 1115138804

View in Genome Browser
Species Human (GRCh38)
Location 14:30143683-30143705
Sequence TTGCACAGCTGGGAAAACAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 511
Summary {0: 1, 1: 0, 2: 6, 3: 47, 4: 457}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115138804 Original CRISPR TTGCACAGCTGGGAAAACAC AGG Intronic
900536306 1:3179405-3179427 CTGTACAGCTGGGGAAACAGAGG - Intronic
900878036 1:5359902-5359924 TGGCTCAGCTGGGAAATCCCAGG - Intergenic
901466228 1:9422970-9422992 TGGCACAGCTGGGAAACCCAGGG - Intergenic
902597767 1:17520835-17520857 TTTTACAGCTGGGAAAACTGAGG + Intergenic
902734308 1:18390227-18390249 TGTTACAGCTGGGAAAACAGAGG + Intergenic
902742613 1:18449376-18449398 TTGCACAGATGAGAAAACTGAGG - Intergenic
902782637 1:18714618-18714640 TTGCACAGATGGGGAAACTGAGG - Intronic
903136713 1:21314175-21314197 TTGCACAGCTGGTAAAAAGATGG + Intronic
903164780 1:21512540-21512562 CTACACAGCAGGGAAAACACTGG + Intronic
903295501 1:22340849-22340871 TTGCACAGCTGAGGAAACCGAGG - Intergenic
903306338 1:22415752-22415774 TTTCATAGCTGGGAAAACCCAGG - Intergenic
903333735 1:22611367-22611389 TTTCACAGCTGGGGAAACTGAGG + Intergenic
903335998 1:22625096-22625118 TTGCACAGATGAGAAAACTGAGG - Intergenic
903536404 1:24069407-24069429 TTGCACAGATGGAGAAACACAGG + Intronic
903602350 1:24551934-24551956 TTTCACAGATGAGAAAACAGAGG + Intergenic
903653741 1:24936324-24936346 TGGCACCACTGGGAAACCACAGG + Intronic
904041412 1:27587168-27587190 TTGCACAGATGGGGAAACTGAGG + Intronic
904299898 1:29547503-29547525 TTTCACAGGTGGGAAAACTGAGG + Intergenic
904405377 1:30284982-30285004 TTTCACAGGTGGGAAAACCGAGG - Intergenic
904806680 1:33137075-33137097 TGGCACAGCTGGGTGAACCCAGG - Intergenic
904852757 1:33471567-33471589 TTTTACAGCTGGGAAAATGCAGG + Intergenic
904891830 1:33784921-33784943 TTACACAGCTGGGACCACACTGG + Intronic
904979127 1:34482038-34482060 TTCCACAGCTGAGAAAGCCCAGG + Intergenic
905296007 1:36954894-36954916 GTGCACAGGTGGGTACACACAGG - Intronic
906106943 1:43300410-43300432 TTGTACAGATGGGAAAACTGAGG - Intergenic
906705229 1:47889780-47889802 CTGCCCAGCTGGGCAACCACAGG + Intronic
907041394 1:51263819-51263841 TTGCATAGCTCTGAACACACTGG + Intronic
907239838 1:53075319-53075341 TTGCAGAGCTGGGATGACAGAGG - Intronic
908096694 1:60746685-60746707 TTGAACAGCTGTGAAAACAATGG - Intergenic
908926358 1:69259782-69259804 TTGTAAAGATGGGAAAACAGAGG + Intergenic
909072517 1:71013742-71013764 TTGCATAGCTGGGAAACAGCAGG - Intronic
909156982 1:72090837-72090859 TTTCACATCTGGAAAAACAAGGG + Intronic
910293592 1:85622571-85622593 TTGAGCAGCTGGGCAAACAGTGG + Intergenic
910716401 1:90236032-90236054 CAGCACAGCTGGGAATGCACTGG + Intergenic
913961295 1:143339777-143339799 TTGCCCTGCTGGGAAAACTTAGG - Intergenic
914055648 1:144165350-144165372 TTGCCCTGCTGGGAAAACTTAGG - Intergenic
914123498 1:144801012-144801034 TTGCCCTGCTGGGAAAACTTAGG + Intergenic
916070789 1:161168514-161168536 TTGCTCAGCTTGGAAGAGACTGG - Exonic
916196366 1:162227177-162227199 ATGCACAGCGGGGGAAAGACTGG - Intronic
917503196 1:175604447-175604469 TTTCACAGTTGGGAAGACTCGGG + Intronic
917667101 1:177235754-177235776 ATGCACACCTTGGAAATCACTGG - Intronic
918110816 1:181453902-181453924 ATCCACAGCAGGGAGAACACAGG + Intronic
918182145 1:182093681-182093703 TTGCTGTGCTGGGAACACACTGG - Intergenic
918433637 1:184487800-184487822 CTACACAGATGGGAAAACCCAGG - Intronic
918450977 1:184658180-184658202 ATGGACAGGAGGGAAAACACAGG - Intergenic
919442065 1:197647905-197647927 TTGCCCAGGTTGGAAAACAATGG - Intronic
919807561 1:201389326-201389348 CAGCACAGCTGGGGAAACCCAGG + Intronic
919982279 1:202649764-202649786 TTTCACAGCTGGGAAAACTGAGG + Intronic
920154205 1:203934976-203934998 TTACATAGCTGAGAAAACAAAGG - Intergenic
920513104 1:206565309-206565331 ATACACAGAGGGGAAAACACAGG - Intronic
921192025 1:212718801-212718823 GCACACAGCTGGGAAACCACTGG + Intergenic
921338414 1:214110805-214110827 TTTCATAGCTGGGGAAACAGTGG - Intergenic
921807874 1:219476704-219476726 TTTCACAGCTGGGGCAACAGAGG + Intergenic
922356950 1:224785553-224785575 TTTCACAGATGAGAAAACAGGGG - Intergenic
922464082 1:225834813-225834835 CTGAAGAGCTGGGACAACACAGG - Intronic
922687952 1:227662232-227662254 TTGTAGAGATGAGAAAACACAGG + Exonic
923028559 1:230226771-230226793 TTCTACAGCTGGAGAAACACAGG - Intronic
924169264 1:241320140-241320162 CAGCATGGCTGGGAAAACACAGG - Intronic
1063005379 10:1965196-1965218 TTCCAAAGCTGCAAAAACACAGG + Intergenic
1063388888 10:5635731-5635753 TAGCACAGATGGGATACCACAGG + Intergenic
1063815281 10:9765031-9765053 ATGCTCAGATGGGAAAACAAGGG - Intergenic
1065206916 10:23365738-23365760 TTGCATAGCTGGTAAGTCACGGG - Intergenic
1066810772 10:39331655-39331677 TTGCACACCTAGAAAAACAGTGG + Intergenic
1068136742 10:52956377-52956399 CTGCATAGTTGGGAAAACAAAGG - Intergenic
1069563328 10:69446899-69446921 TTTCACAGGTGGGGAAACAGAGG + Intergenic
1070874016 10:79784385-79784407 TAGCACATCTGGGAAAACAAAGG + Intergenic
1071640948 10:87306524-87306546 TAGCACATCTGGGAAAACAAAGG + Intergenic
1071654288 10:87431412-87431434 TAGCACATCTGGGAAAACAAAGG - Intergenic
1072237270 10:93464200-93464222 TTCCACAGCTTAGAAAACTCAGG - Intronic
1072252484 10:93592622-93592644 TTGTACAGATGAGAAAACAGAGG - Intronic
1072921423 10:99580122-99580144 AGGCACAGATGGGGAAACACAGG + Intergenic
1073192274 10:101660121-101660143 TTGAAGAGCTGAGAAAGCACAGG + Intronic
1074281575 10:112056620-112056642 GGGCACAGCTGTGGAAACACAGG - Intergenic
1074851748 10:117444686-117444708 TTTCACAGGTGGGAAAACTGAGG + Intergenic
1074853283 10:117455673-117455695 ATGCACATTTGGGAAACCACAGG - Intergenic
1074877256 10:117623028-117623050 TTTCACAGATAGGAAAACAAGGG + Intergenic
1075294802 10:121265456-121265478 TTGAAGAGCTGAGAACACACAGG + Intergenic
1076196304 10:128520714-128520736 TTGCACAGCTGGGTCATCACTGG + Intergenic
1076524262 10:131101305-131101327 TAGAACAGCTGGGAACACAGGGG - Intronic
1076755938 10:132571782-132571804 TTGCACAGATGGAAAGACAGGGG + Intronic
1076820177 10:132934444-132934466 TTCCATGGGTGGGAAAACACAGG - Intronic
1076889567 10:133277020-133277042 TTGCACAGGTGAGGAAACTCAGG + Intergenic
1077525616 11:3062790-3062812 CTGAACATCTGGGAGAACACGGG + Intergenic
1077554200 11:3218107-3218129 GTGGCCAGCGGGGAAAACACGGG + Exonic
1077742259 11:4859500-4859522 TTGCACATCTGGGGAAATGCAGG - Intronic
1078772594 11:14364718-14364740 TTTCACAGATGGGGAAACAAAGG + Intergenic
1079065645 11:17288995-17289017 TTGCCCAGGTTGGAATACACTGG + Intronic
1079611171 11:22434310-22434332 ATGCAAAGTTGGGAAAAGACAGG + Intergenic
1081707013 11:45188301-45188323 TTGCACAGCTGAGAAAACTGAGG + Intronic
1081725884 11:45328801-45328823 TTTCACAGCTGAGAAAACTGAGG + Intergenic
1081745145 11:45467737-45467759 TTGCACAGATGGGAAAAGTGAGG - Intergenic
1082015254 11:47480961-47480983 TTGCCCAGGTTGGAAAACAGTGG - Intronic
1082071581 11:47943849-47943871 TTTCACAGCTGAAAAGACACAGG + Intergenic
1083343904 11:61976351-61976373 TTGCGCAGCTGGTAAGAGACAGG + Intergenic
1083367000 11:62147380-62147402 CTGCACAGCTGGAAAATCCCAGG - Intronic
1083544573 11:63538793-63538815 TTGCACAGATGGGGAAACTGAGG - Intronic
1084234953 11:67781643-67781665 TTACACAGCTGAGAAAACCCAGG - Intergenic
1084403346 11:68957198-68957220 TTGCACAGATGAGAAAACAGAGG + Intergenic
1084592904 11:70100680-70100702 TTTCACAGCTGGGGAAACTGAGG - Intronic
1084908011 11:72363661-72363683 TTGAACAGATGAGGAAACACAGG + Intronic
1084950346 11:72661709-72661731 CTGCACAGGTGGGGAACCACAGG + Intronic
1085030615 11:73268948-73268970 TTCCACAGCTGAGAAAACCAAGG + Intronic
1085051777 11:73383712-73383734 TTTCACAGCTGGGCAAACTGAGG - Intronic
1085237356 11:75025425-75025447 TCGTACAGCTGGGAAAACTGAGG - Intergenic
1085454524 11:76658234-76658256 TTGCACAGATGGGGAAACTGAGG - Exonic
1085456829 11:76670358-76670380 TTTGACAGCTGGGAAAACAATGG - Intronic
1085465951 11:76723468-76723490 CTGTACAGCTGGGAAAACTGAGG - Intergenic
1085959284 11:81440796-81440818 TTGCAGAGATTGGAAGACACTGG - Intergenic
1086007738 11:82059537-82059559 TTGAACAGATGGGAAAACTAGGG - Intergenic
1087860657 11:103150478-103150500 TTGAGCAGCTGGGAAAATATTGG + Intronic
1089076116 11:115740178-115740200 TTCCATAGCAGGGAAAACATAGG - Intergenic
1089426087 11:118376589-118376611 CTGCACAGCTGGGATCAAACAGG - Exonic
1089799928 11:121018917-121018939 GTGCACAGATGGGAACACAGGGG - Intergenic
1090197626 11:124830608-124830630 TTTACCAGCTGGGAAAACAGAGG - Intergenic
1090540331 11:127695533-127695555 TTGTACTGCTGGGGAAATACTGG + Intergenic
1090925221 11:131243723-131243745 TTGCACAGATGAGAAAACCAAGG + Intergenic
1094061915 12:26323303-26323325 TGGCACAGCAGTGAAAGCACAGG - Intergenic
1094369691 12:29724568-29724590 TTACACAGCTGGGAAATGACTGG + Intronic
1094742122 12:33301823-33301845 GTGCACAGGTGGAAAATCACAGG + Intergenic
1096945764 12:55408107-55408129 ATGGACAGCTGGGAAAAAAATGG - Intergenic
1097043804 12:56172486-56172508 TTGCTCTGCAGGGGAAACACAGG + Exonic
1097122034 12:56741159-56741181 TTGTACAGATGAGAAAACAGTGG - Intronic
1097983132 12:65754823-65754845 CTGCAGAGCTGGGAAAACACTGG - Intergenic
1098756307 12:74367540-74367562 TTGTTCAGTTGGTAAAACACAGG + Intergenic
1099424204 12:82502761-82502783 TTGCACAGCATGGTAACCACAGG - Intergenic
1100235228 12:92654069-92654091 TTTCACAGCTGAGAAAACAGAGG + Intergenic
1101621538 12:106393641-106393663 TTGGACAGCAAGGAAAACCCAGG + Intronic
1101791460 12:107931423-107931445 TTTCACAGATGAGAAAACAGAGG + Intergenic
1102013274 12:109631971-109631993 TTTCACAGATGAGAAAACAGAGG - Intergenic
1102223858 12:111214064-111214086 TTACAAAGCTGAGAAAAGACAGG - Intronic
1102550690 12:113689717-113689739 TTTCACAGATGAGAAAACAGAGG + Intergenic
1102758940 12:115368181-115368203 TTGCCAAGCTGGGTAAACAAAGG + Intergenic
1102789484 12:115632838-115632860 TTTCACAGCTGAGAAAACGGAGG + Intergenic
1103938925 12:124491430-124491452 TTTCACAGCTAGGACATCACTGG + Intronic
1104365731 12:128174926-128174948 TTTCACAGATGGGAAAACTGAGG + Intergenic
1104757269 12:131277058-131277080 CAGCAGAGCTGGGACAACACTGG - Intergenic
1104892410 12:132146934-132146956 GGGAACAGCTGTGAAAACACAGG - Intronic
1107505938 13:41033291-41033313 TTTCACAGATGTGAAAACAGAGG - Intronic
1107871744 13:44753005-44753027 TTGTACATTGGGGAAAACACTGG - Intergenic
1109991639 13:70066137-70066159 AAGCACAGCTGGTAAACCACAGG - Intronic
1111931612 13:94518448-94518470 TTCCACAGCTCAGAAAATACTGG + Intergenic
1112620968 13:101053158-101053180 TTACACAGATGGGAAAACTTGGG - Intergenic
1113358853 13:109609909-109609931 CTGGACTGCTGGGAAAATACTGG + Intergenic
1113716935 13:112516737-112516759 TTGTACAGATGGGGAAACAGAGG + Intronic
1115138804 14:30143683-30143705 TTGCACAGCTGGGAAAACACAGG + Intronic
1116191115 14:41667982-41668004 TTGCACAGCTGGGTCAAGACTGG + Intronic
1117251223 14:53940710-53940732 GTTCACAGATGGTAAAACACAGG - Intergenic
1118232189 14:63963092-63963114 CTTAACAGCTGGAAAAACACAGG - Intronic
1118919902 14:70140364-70140386 TTGAACAGATGGGGAAACAGAGG + Intronic
1119542896 14:75452260-75452282 CTGCCAAGCTGGGAAAAGACAGG - Intronic
1121217463 14:92259572-92259594 TTGCACAGATGGGAATACTGGGG + Intergenic
1121495729 14:94390363-94390385 TTGTGCAGATGGGAAAACAAAGG - Intronic
1121544096 14:94750999-94751021 TTGCACAGATGTGAAAACTGAGG + Intergenic
1121553078 14:94816944-94816966 TTTCACAGATGGGAAAACTGAGG + Intergenic
1121775851 14:96590368-96590390 TTTTACAGATGGGAAAACAGAGG + Intergenic
1122069250 14:99195023-99195045 GTGCACAGATGGGAAAACGAAGG + Intronic
1122391796 14:101394449-101394471 TTACACAGACGGGAAAACTCAGG + Intergenic
1122886476 14:104712657-104712679 ATGCACACCTGGGGAAACTCGGG - Intronic
1124354415 15:28984387-28984409 TTTCACAGCTGGGAGAACCTAGG + Intronic
1126389162 15:48127128-48127150 TTTCACAGCTGAGATAACAGAGG - Intronic
1126478084 15:49088383-49088405 CAGCACAGCTGAGATAACACTGG + Intergenic
1126548703 15:49903365-49903387 TTACGCAGCTTGGAAAAAACAGG - Intronic
1126804729 15:52336055-52336077 TTTAACAGATGGGAAAGCACAGG + Intronic
1126870013 15:52977550-52977572 TGGCACAGCCAGGAAAACACTGG + Intergenic
1127469962 15:59282055-59282077 TTCCACACCTGGGGACACACTGG + Intronic
1127579309 15:60322957-60322979 TTTCACAGATGGGTAAACAGAGG - Intergenic
1128095402 15:64950149-64950171 TTGCACAGATGGGGAAACCAGGG - Intronic
1128904699 15:71456531-71456553 TTTCACAGATGGGAAAACTGAGG + Intronic
1129271087 15:74419579-74419601 TTTCACAGATGGGAAAACAGAGG + Intronic
1129288606 15:74545886-74545908 TTTCACAGATGAGAAGACACAGG - Intronic
1129474779 15:75777631-75777653 TTGTACAGATGTGAAAAGACAGG - Intergenic
1129676900 15:77636653-77636675 TTGCATAGCTGGGGAAACTTTGG - Intronic
1129754055 15:78085363-78085385 CTTTACAGCTGGGAAAACAGAGG - Intronic
1129873639 15:78957873-78957895 TTGCACAGGTGGGAAAACTGAGG + Intergenic
1130088915 15:80802827-80802849 TTGTACAAATGAGAAAACACAGG - Intronic
1130867390 15:87944475-87944497 TTTCACAGGTGAGAAAACAGAGG + Intronic
1132222041 15:100112297-100112319 TTGGACAGCTGGGGACACTCAGG + Intronic
1132354023 15:101158195-101158217 TTTCACAGCTGGGGAAACTGAGG + Intergenic
1132400317 15:101501207-101501229 ATGCTCAGCTGGGAAAACTGAGG - Intronic
1133297285 16:4760783-4760805 CTGCAGAGCTGGGACACCACCGG + Intronic
1135257200 16:20950512-20950534 TTTTACAGCTGGGAAGACAGAGG - Intronic
1135266771 16:21033455-21033477 TTTTACAGCTGGGAAAACAGAGG + Intronic
1135940586 16:26818576-26818598 TTTCACAGATGGGAAAACTGAGG - Intergenic
1136068149 16:27772288-27772310 TTTCACAGCTAGGAAAACTGAGG + Intronic
1137729918 16:50681629-50681651 TTGAACAGATGGGAAAACCGAGG + Intergenic
1138146968 16:54621441-54621463 TTGCACAGATGGGGAAACTGAGG + Intergenic
1138188788 16:54997670-54997692 TTGCACAGATGGGGAAACTGAGG + Intergenic
1138680733 16:58682029-58682051 CTGCACAGCTGGGATTACAGGGG - Intronic
1139245532 16:65438571-65438593 TTTCACAGCTGAGGAAACAAAGG - Intergenic
1139355215 16:66363571-66363593 TTTTACAGATGGGAAAACAGAGG - Intergenic
1140339360 16:74141724-74141746 TTGCTCAGCTTGGAAAGCAGTGG - Intergenic
1140405800 16:74710601-74710623 TTGCCCTGCTGTGAAAACGCAGG + Intergenic
1140531359 16:75669398-75669420 TTTCACCACTAGGAAAACACTGG - Intronic
1140536920 16:75718300-75718322 TTACACAACTAGGAAAACACTGG - Intronic
1140953143 16:79838287-79838309 TTTCACAGATGAGAAAACAGAGG + Intergenic
1141602998 16:85137518-85137540 GTGCACATCTGGGAACACTCTGG + Intergenic
1141686536 16:85573553-85573575 CTTCACAGCTGGGAAAACTGAGG - Intergenic
1141710748 16:85697630-85697652 CAGCACAGCTGGGCAAACATCGG + Intronic
1142968690 17:3596817-3596839 TCGCACAGCTGGGAAGTGACAGG + Intronic
1143344919 17:6242378-6242400 TTGCACAGCTTGGATGACCCTGG - Intergenic
1146074953 17:29719656-29719678 TTTCACAGATGAGAAAACAAAGG + Intronic
1146638241 17:34521678-34521700 TTGCACAGATGGGAAAATCTAGG + Intergenic
1147886686 17:43688957-43688979 TTGCACAGGTGGAGAAACAAAGG - Intergenic
1148232468 17:45945010-45945032 TTTTACAGCTGGGAAAACCAAGG - Intronic
1148337030 17:46848827-46848849 TTGCACAGATGAAAAAACAGAGG - Intronic
1148738274 17:49877231-49877253 TTTCACAGATGAGAAAACAGAGG - Intergenic
1148875619 17:50685139-50685161 TTGCACAGCTGGGAGAAGGCAGG + Intronic
1149239077 17:54627505-54627527 TTCTACAGCTGGTAAAATACAGG - Intergenic
1151242842 17:72771597-72771619 TTACACAGCAGGGACAAGACAGG + Intronic
1152064338 17:78102204-78102226 TGGCACAGATGGGAAAACACAGG + Intronic
1152555961 17:81053447-81053469 TTGCACAGGTGTGAAAACCGAGG + Intronic
1152709868 17:81866034-81866056 TAGCAAAGCTGGGAAAATCCAGG + Intergenic
1152776077 17:82202879-82202901 TTTCACAGCTGAGAAAACTAAGG + Intronic
1153183333 18:2459998-2460020 GACCACAGCTGGGAATACACTGG + Intergenic
1153229659 18:2923816-2923838 TCCCACAGCTGGGCAAAGACTGG - Exonic
1156090193 18:33458382-33458404 CTGCAAATATGGGAAAACACAGG + Intergenic
1156570996 18:38252987-38253009 TTGCACAGATAAGAAAACATAGG - Intergenic
1157509713 18:48262148-48262170 TTGTACAGCTGGGGAAACTGAGG + Intronic
1157880593 18:51317768-51317790 TTGTACAGATGGGAAAACCAAGG + Intergenic
1157981432 18:52386126-52386148 TTTCACAGGTGAGAAAACAGAGG + Intronic
1158237960 18:55340377-55340399 TTGCAGAGCCTGGGAAACACAGG + Intronic
1160772944 19:841159-841181 TGGCACAGCTGGGGAAACTGAGG + Intronic
1161115633 19:2495171-2495193 TTGCACAGATGGGGAAACTGAGG + Intergenic
1161398234 19:4056026-4056048 ATGCACAGCTGGGGAAACTGAGG - Intronic
1161450885 19:4344606-4344628 TTTCACGGCTGGGAAACCACAGG - Intronic
1161493608 19:4575849-4575871 TTCCATAGGTGGGAAAACTCGGG + Intergenic
1161688915 19:5719659-5719681 TTGCACAGGTGGGAAACCTGAGG + Intronic
1161834772 19:6638412-6638434 TTGTACAGCTGGGGAAACTGAGG + Intergenic
1162615810 19:11799315-11799337 TGGCCCATTTGGGAAAACACAGG + Intronic
1162804913 19:13132544-13132566 TTGCAAAGCTGGAAAAACTGAGG - Intronic
1163882512 19:19938659-19938681 TAGAAAAACTGGGAAAACACAGG - Intergenic
1164156479 19:22600550-22600572 TTTGACAGGTGGGAAAACAAAGG - Intergenic
1164270166 19:23665617-23665639 TTGAGTAGCTGGGATAACACAGG + Intronic
1164478906 19:28596623-28596645 TTTAATAGCAGGGAAAACACGGG + Intergenic
1164501526 19:28824128-28824150 ATGAAATGCTGGGAAAACACCGG - Intergenic
1164874602 19:31674953-31674975 TTTCACTGCTGGAAAATCACAGG + Intergenic
1165086224 19:33349679-33349701 TCCCACAGCTGGGAAAAGCCAGG + Intergenic
1166064258 19:40347912-40347934 TTGTACAGATGAGAAAAAACGGG + Intronic
1166408341 19:42539732-42539754 TACCACAGCTGGGAATGCACTGG + Intronic
1166548412 19:43648750-43648772 TTTCATAGCTGGGAAAACTGAGG + Exonic
1166664593 19:44671499-44671521 TTGCACAGATGTGGAAACAGAGG - Intronic
1166673565 19:44725693-44725715 TTGCACAGCTGGGGAAACTGAGG - Intergenic
1167026642 19:46924409-46924431 CTGCACAGATGAGAAAACTCTGG - Intronic
1167214736 19:48156999-48157021 TCGCACAGGTGAGAACACACGGG - Exonic
1167325935 19:48825673-48825695 TTTCACAGGTGAGAAAACAGAGG + Intronic
1168683587 19:58334675-58334697 CTACAGAGCAGGGAAAACACAGG - Intronic
1202695131 1_KI270712v1_random:118027-118049 TTGCCCTGCTGGGAAAACTTAGG - Intergenic
925025774 2:606072-606094 TTGCACAGCAGGAGAAACACAGG - Intergenic
925573205 2:5333217-5333239 TTACACAGTTTGCAAAACACTGG - Intergenic
927701852 2:25274131-25274153 TTGCTCAGATGGGAAGACCCAGG - Intronic
929587609 2:43126271-43126293 TTGCACCCCTGGGAAGACCCAGG - Intergenic
930786629 2:55277693-55277715 TTGCTTGCCTGGGAAAACACTGG - Intergenic
931177797 2:59870917-59870939 TTGCACAGCTGGGGTAGGACAGG + Intergenic
931977334 2:67657103-67657125 CTGCACAGCTGGAAACACATGGG + Intergenic
932045543 2:68345448-68345470 TTGCATGGCTGGGGACACACTGG - Intergenic
932315241 2:70776463-70776485 TTTCACAGATGGGAAAACCAAGG - Intergenic
933937058 2:87215040-87215062 TTACACAATTGGGAAAAAACAGG - Intergenic
934276301 2:91575076-91575098 TTGCCCTGCTGGGAAAACTTAGG - Intergenic
934476570 2:94597506-94597528 TTTCACAGATGGGAAAACTGAGG + Intronic
935223712 2:101035876-101035898 GTCCTCAGCTGGGAAATCACAGG + Intronic
936356083 2:111750784-111750806 TTACACAATTGGGAAAAAACAGG + Intergenic
937097246 2:119243315-119243337 CTGCATAGCTGGGACCACACTGG - Intronic
938684882 2:133728611-133728633 TTCCACAGCTGGGAGCACGCTGG - Intergenic
939714297 2:145563959-145563981 TCTCACAGCTGTGAAAACACAGG - Intergenic
939754762 2:146095532-146095554 TTGCCCACCTGGTATAACACTGG - Intergenic
939777066 2:146401490-146401512 TTCCACAGCTGGGGAGACAAGGG + Intergenic
939846748 2:147255861-147255883 TGGCACAGTTGGGAAAACCTTGG - Intergenic
940337331 2:152543205-152543227 GTGCACAGCTGGGATGACAAAGG - Intronic
942385874 2:175442202-175442224 TTACACAGCTGGGCATAAACGGG + Intergenic
942446325 2:176080974-176080996 TTTCCCAGCTGGGAGACCACAGG - Intronic
942717579 2:178910861-178910883 CTGGAAAGCTGAGAAAACACTGG + Intronic
943082232 2:183269106-183269128 TGGAACAGCAGGGAAAACCCAGG - Intergenic
943799445 2:192039491-192039513 TTGCACAGATTGGAAAACATTGG - Intronic
944514070 2:200493643-200493665 TTTCACAGCTGAGAAAATTCAGG - Intronic
945135844 2:206626833-206626855 TTGAACAACTGGTAAAACACAGG + Intergenic
947004614 2:225496495-225496517 TTGCAAACCTTGGAAAATACAGG - Intronic
947749659 2:232525645-232525667 TTGTAAACCTGGGAAGACACGGG - Exonic
949014904 2:241703242-241703264 TAGGGGAGCTGGGAAAACACTGG + Intronic
1168821185 20:774787-774809 TTGCACAGGTGGGGAAACCAAGG + Intergenic
1168840032 20:903934-903956 TTTCACAGATGGGAAAACTGAGG + Intronic
1168844541 20:934896-934918 TTTCACAGGTGAGAAAACTCAGG - Intergenic
1169023549 20:2348520-2348542 TTGCTCAGGTGGAAAAGCACTGG - Intergenic
1169413076 20:5391307-5391329 ACGCACAGCAGGGAAATCACTGG - Intergenic
1169496647 20:6122487-6122509 CTGCAGAGCTGGCAAAAGACAGG - Intronic
1170555260 20:17509613-17509635 TTTCACAGAAGGGAAAACAGAGG - Intronic
1172207004 20:33170105-33170127 TTTCACAGCTGAGAAAACTGAGG + Intronic
1172293787 20:33793705-33793727 TTTTACAGCTGAGAAAACCCAGG + Intergenic
1172319030 20:33981969-33981991 GTTCACAGCTGGGACAAGACTGG - Intergenic
1172364061 20:34335247-34335269 TTGTACAGATGGGAAAACAAAGG + Intergenic
1172485793 20:35297238-35297260 TTTCACAACTGGGAAAGCTCTGG - Intergenic
1172607229 20:36222176-36222198 GTGCACAGCTGGAAAAACTGAGG - Intronic
1172667162 20:36608282-36608304 TTGCCCAGGTGGGAGCACACTGG + Intronic
1172702087 20:36859941-36859963 TTCCACAGATGGGAAAACTGTGG - Intronic
1172884240 20:38220794-38220816 TTTCACAGATGGGAAAACTGAGG + Intronic
1174410379 20:50331157-50331179 TTGCACAGAGGGGAAAACTGAGG + Intergenic
1174552738 20:51373490-51373512 TTGCACAGCTGGGGAAACTGAGG - Intergenic
1174698034 20:52579991-52580013 CAGCACAGCTGGGAAAAAGCAGG - Intergenic
1174815494 20:53683682-53683704 TTTCACAGATGAGAAAACAGAGG + Intergenic
1175040246 20:56042653-56042675 TTGCACAGATGAGGAAACAGAGG - Intergenic
1175246154 20:57583386-57583408 TTGCATAGCTGAGAAAACTGTGG + Intergenic
1176121616 20:63456680-63456702 TTTCACAGTCGGGAAAACAGAGG + Intronic
1176986810 21:15446531-15446553 ATACACAGCAGGGAAAACATGGG + Intergenic
1177038655 21:16077747-16077769 TTGCACAGATGAGAAAACTGGGG - Intergenic
1177422294 21:20875663-20875685 TGGTACACATGGGAAAACACTGG + Intergenic
1178419370 21:32431207-32431229 TTCCACAGCTGAGAAAACCCAGG + Intronic
1179162855 21:38912238-38912260 TTGCCCAGCAAGGAAACCACTGG + Intergenic
1180224318 21:46380737-46380759 TTCCACAGCTCTGAAAACACTGG + Intronic
1180724709 22:17938154-17938176 CTGCACAGATGAGAAAACTCAGG + Intronic
1180843230 22:18968950-18968972 TTGCACAGATGGGGAACCTCAGG - Intergenic
1181751291 22:24990862-24990884 TTGCCCAGCTGGGGAAACCGAGG + Intronic
1181767239 22:25100610-25100632 TTGTACAGATGGGACAACAGAGG - Intronic
1182043503 22:27256930-27256952 TTTCTCAGCTGGGAAAACTGAGG + Intergenic
1182090748 22:27592986-27593008 TTGGACAGGTGGGAAAACCAAGG + Intergenic
1182321099 22:29479115-29479137 TTGTACAGATGGAAAAACAAGGG + Intergenic
1182857365 22:33529614-33529636 TTTCACAGATGGGAAAATAATGG - Intronic
1183099765 22:35576705-35576727 TTGCACAGATGAGAAAACCAAGG + Intergenic
1183300308 22:37055850-37055872 TTGAACAACTGGGAAAACTGAGG - Intronic
1183341877 22:37286065-37286087 TTGCAGAGCTGGGGAAACTGAGG - Intronic
1183549071 22:38470663-38470685 TTTGACAAATGGGAAAACACAGG - Intronic
1183653523 22:39172146-39172168 GTCCACAGCTGGGAAAACTGAGG + Intergenic
1184268907 22:43366382-43366404 TTTCACAGATGGGAAAACTGAGG + Intergenic
1203239196 22_KI270732v1_random:39287-39309 TAGCACAGCAGGGAAAACCATGG + Intergenic
950304642 3:11908462-11908484 CTGCCCAGCTTGGAAGACACTGG - Intergenic
950399565 3:12759794-12759816 TTGTGCAAGTGGGAAAACACAGG + Intronic
950667691 3:14507127-14507149 TTTCACAGATGGGAAAACTGAGG + Intronic
950672746 3:14536998-14537020 TTTTACAGCTGGGAAAACTGAGG + Intronic
952428147 3:33196346-33196368 TAGCAGAGCTGGGAACACAGAGG + Intronic
953390024 3:42528464-42528486 TTGCACAGATGGGGAAACTGAGG - Intronic
953662990 3:44904519-44904541 TTGTACAGCTGGGGAAGCAGAGG + Intronic
956040905 3:65143896-65143918 TTTCACAGATGGGAAAACCAAGG + Intergenic
956819692 3:72942724-72942746 CTGGACAGCTTTGAAAACACTGG - Intronic
956994945 3:74815411-74815433 TTTCACAGATGGAAAAACAATGG - Intergenic
959230988 3:103651273-103651295 TTGCTTAGATTGGAAAACACTGG + Intergenic
960630145 3:119722135-119722157 TTGCCCAGGTGGGAATACAGTGG - Intronic
961017089 3:123476611-123476633 TTGCCCAGCTGTGAAAGCAGAGG + Intergenic
961485150 3:127210919-127210941 TTCCACAGAGGGGGAAACACCGG + Intergenic
961865334 3:129949680-129949702 TTTCACAGATGGGAAAACTGAGG + Intergenic
961884590 3:130088172-130088194 TTCCACAGCTAAGAAAACCCAGG - Intronic
961960402 3:130848553-130848575 TCGCACAGCTGCAAAAACAGAGG - Intergenic
963041476 3:141073143-141073165 CTGCACAGATGGGAAAACTGAGG - Intronic
963102108 3:141617728-141617750 TTTTAAAGCTTGGAAAACACAGG + Intergenic
963308345 3:143679227-143679249 ATGCACAACTGGCTAAACACTGG + Intronic
964511774 3:157460454-157460476 GAGTACAGCTGTGAAAACACAGG + Intronic
964949640 3:162274041-162274063 TAGCACAGCTGTGAACATACAGG + Intergenic
965176419 3:165340273-165340295 TTGAACAAATGTGAAAACACAGG + Intergenic
965540471 3:169866389-169866411 TTGCACAGCAGGGATGACCCCGG + Intronic
965919154 3:173891562-173891584 TGGCTCAGCTAGGAAAACATGGG - Intronic
969210286 4:5682020-5682042 TTTCACAGATGAGAAAACAGAGG - Intronic
969333013 4:6490883-6490905 TTTCACAGATGGGAAAACTGAGG + Intronic
969429918 4:7148108-7148130 TTTCACAGGTGGGAAAACTGAGG + Intergenic
969820191 4:9714110-9714132 TTCCACAGCTGAGAAAACCCAGG + Intergenic
970439348 4:16066880-16066902 ATGCACAGCTGGGAAATATCTGG - Intronic
972615149 4:40690974-40690996 TTTCTCATCTGGTAAAACACAGG + Intergenic
972710295 4:41588725-41588747 TGGCACAGCTGGGCAACCACAGG + Intronic
973570541 4:52234408-52234430 TTTCACAGAGGGGAAAACAGAGG - Intergenic
973792294 4:54389669-54389691 TTTTACAGCTGAGAAAACAGAGG + Intergenic
976165421 4:82249251-82249273 TTGCACAGGTAGGAAAAGAGAGG + Intergenic
978091406 4:104721131-104721153 TTTCAAAGCTGGAAAAATACAGG + Intergenic
978642018 4:110881986-110882008 TGACACAGCTGGGAGACCACAGG - Intergenic
979392372 4:120141981-120142003 CTGCACAGATGGGAAAACCAAGG - Intergenic
980202587 4:129675618-129675640 ATGCCCAGCTGGGAAATGACTGG + Intergenic
984497788 4:180520091-180520113 TCACACAGCTAGTAAAACACTGG + Intergenic
984599668 4:181711823-181711845 CTGCACAGCTGGTCAAACAAAGG - Intergenic
984958493 4:185070321-185070343 TGAGACAGCTGGGAAAACTCAGG - Intergenic
988101460 5:26684699-26684721 TTGCAAAGCTAGTAAAACCCAGG + Intergenic
988157032 5:27467282-27467304 TTGCATAGTTTGAAAAACACTGG - Intergenic
990141575 5:52710571-52710593 TTTCATAGGTGAGAAAACACAGG - Intergenic
992252837 5:74892831-74892853 TTGCAATGCTGGGAAAAAATGGG - Intergenic
992491430 5:77248052-77248074 TGGGACAGCTGAGAAAACAAAGG + Intronic
992618466 5:78569033-78569055 TTGCCTAGCTGGAAATACACTGG - Intronic
993157879 5:84250117-84250139 GTGCACATCTGTGCAAACACTGG + Intronic
994229561 5:97298017-97298039 TGCCACAGCTGGTATAACACTGG + Intergenic
995186378 5:109276100-109276122 TTCCACAGATGGGAAAACTGAGG + Intergenic
995618898 5:114000855-114000877 TTGCACAGATGATAAAACTCTGG - Intergenic
996706878 5:126506797-126506819 TGGGACAGCTGGGGAAGCACAGG - Intergenic
997527259 5:134561368-134561390 ATGCATAACTGAGAAAACACAGG - Intronic
997697350 5:135872090-135872112 TTTCACAGATGAGAAAACTCAGG + Intronic
999188385 5:149729920-149729942 CTGCACAGCTGGGGAAACTGAGG - Intergenic
999460036 5:151749741-151749763 TACCACAGCTGGGGAAACCCAGG + Intronic
1000044652 5:157512068-157512090 TTTGACATCTGGGAAAACAAGGG - Intronic
1000339798 5:160268375-160268397 TTTCACAGATGAGGAAACACAGG - Intronic
1000988408 5:167886158-167886180 TTGTACAGGTGGGAAAACTGTGG + Intronic
1001112378 5:168907661-168907683 TAGCACATTTTGGAAAACACAGG + Intronic
1001271328 5:170314376-170314398 TTTCACAGCTGAGAAAACTGAGG - Intergenic
1001338967 5:170826116-170826138 TTTCACAACTGGGGAAACACAGG + Intergenic
1001699481 5:173696435-173696457 TTGCACAGCTAGGAAATGGCAGG + Intergenic
1002313463 5:178328513-178328535 TTTCACAGGTGGGAAAACTAAGG - Intronic
1002854686 6:1026476-1026498 TTGCACAGCTGAGAAAGCTTGGG + Intergenic
1003119251 6:3306481-3306503 TTTTACAGATGGGAAAACTCAGG + Intronic
1003258832 6:4497647-4497669 TGGTACAGCTGGGGAAACAGAGG + Intergenic
1003453999 6:6263722-6263744 TTTCAGAGCTGGGAAAACTGTGG - Intronic
1005564448 6:27076420-27076442 TAGCACAGATGTGAAAACAATGG - Intergenic
1005617831 6:27592376-27592398 TTAAAGAGCTAGGAAAACACCGG - Intergenic
1005637474 6:27765746-27765768 TTGCACTGCTGGGTAAAGACGGG - Intergenic
1005765975 6:29012471-29012493 TGGCAAAGCTGGGGAAAAACAGG - Intergenic
1006375515 6:33669743-33669765 TTGTAAAGCTGGGGAAACAGTGG + Intronic
1006521304 6:34572752-34572774 TTGCACAGATGGGAAAACTGAGG + Intergenic
1007408392 6:41647703-41647725 TTTCACAGATGAGAAAACAGAGG - Intronic
1008013646 6:46493114-46493136 TTGAAAAGTTGGAAAAACACAGG + Intergenic
1008957392 6:57230702-57230724 TTGCACAGTTTGGAAAACTTAGG + Intergenic
1011939455 6:92825151-92825173 TTTTACAAATGGGAAAACACAGG + Intergenic
1012232874 6:96781314-96781336 TTTCACAGATGAGAAAACAAAGG + Intergenic
1012573587 6:100762348-100762370 TTGAACATCAGTGAAAACACTGG - Intronic
1012579289 6:100845860-100845882 ATTCAGAGCTGGGAAACCACAGG + Intronic
1013168989 6:107619346-107619368 TTGAAAAGCTGGGGAAACTCTGG + Intronic
1013971121 6:116019695-116019717 TTGCACATCTGCCAACACACTGG - Intronic
1014310982 6:119801184-119801206 TTTCACAGCTGAGAAAACACAGG - Intergenic
1015497174 6:133893913-133893935 TTGCAGAGATGGGAAAACTGAGG - Exonic
1017204006 6:151785733-151785755 TTGTACAGATGGGAAAACTGAGG - Intronic
1017321068 6:153093891-153093913 TTTCACAGTTGGGAAAACTAAGG - Intronic
1017545587 6:155448135-155448157 TTTCACAGATGGGAAAAAAAGGG - Intronic
1017881295 6:158564368-158564390 TTTCACAGGTGGGAAAACACAGG - Intronic
1018091547 6:160349915-160349937 TTGAAGAGTGGGGAAAACACTGG + Intronic
1018762018 6:166901208-166901230 TCACACAGCGGGGAGAACACCGG + Intronic
1019082602 6:169445453-169445475 TTTTACAGCTGGGGAAACAGGGG - Intergenic
1019171251 6:170134495-170134517 TTTCACTGCTGAGAAAACACAGG + Intergenic
1019510370 7:1414628-1414650 TTGCAAAGCTGGGGAAACTGAGG + Intergenic
1019557938 7:1641871-1641893 TTTCACAGATGAGAAAACAGAGG - Intergenic
1019575346 7:1735097-1735119 TTGGACAGATGGGGAAACAGAGG - Intronic
1019761595 7:2816828-2816850 TTTCACAGATGAGAAAACTCAGG + Intronic
1019879234 7:3843765-3843787 TTTCACAGATGGGAAAACTGAGG - Intronic
1020187617 7:5970830-5970852 TAGCAGAGCTGGGAAAACCCTGG - Intergenic
1020295300 7:6753940-6753962 TAGCAGAGCTGGGAAAACCCTGG + Intergenic
1020317973 7:6920183-6920205 TTCTACAGCTGAGAAAACCCAGG - Intergenic
1021543715 7:21789710-21789732 TTTCACAGATGAGAAAACAGAGG - Intronic
1022180330 7:27912838-27912860 TATGACAGCTGGGAAAAGACTGG + Intronic
1022399412 7:30023177-30023199 TTGCACAGATGAGGAAACACAGG + Intronic
1022446716 7:30477050-30477072 TTTTACAGGTGGGAAAACAGGGG + Intronic
1022526291 7:31039676-31039698 TTTTACAGCTGGGAAAACTGAGG + Intergenic
1022573621 7:31476645-31476667 TTTTACAGCTGAGAAAACAGAGG + Intergenic
1022945504 7:35279846-35279868 CTGCACAGCTGGTACAACAGAGG + Intergenic
1023133575 7:37028116-37028138 TTGTACAGATGAGAAAACAGAGG + Intronic
1023230364 7:38021578-38021600 TTTCACAAATGAGAAAACACAGG + Intronic
1023829578 7:44030966-44030988 TTGCACAGATGGAGAAACAGAGG + Intergenic
1024654053 7:51434250-51434272 CTTCACAGATGGGAAAACTCAGG + Intergenic
1025141434 7:56469987-56470009 TTGTAAAGTTGGGAAAACACAGG + Intergenic
1025612037 7:63083129-63083151 TTGTAGAGTTGGGAAAACACAGG - Intergenic
1025707491 7:63880874-63880896 TTGTAGAGTTGGGAAAGCACAGG + Intergenic
1026147703 7:67761682-67761704 TTGCCCAGCTCGGAATACAGTGG - Intergenic
1027170336 7:75867088-75867110 TTGCACAGCTGAGACAGCTCTGG - Intronic
1028223829 7:88226726-88226748 TTCCATAGCTGGGAAATCAGTGG + Intronic
1028930126 7:96403916-96403938 TTGCACAACTAGGAAAATAACGG - Intergenic
1029739887 7:102485224-102485246 TTGCACAGATGGAGAAACAGAGG + Intronic
1029757886 7:102584403-102584425 TTGCACAGATGGAGAAACAGAGG + Intronic
1029775822 7:102683464-102683486 TTGCACAGATGGAGAAACAGAGG + Intergenic
1030528405 7:110681168-110681190 TTCCACAGGTGGGAAAACTGAGG + Intronic
1031350912 7:120729756-120729778 CTTCACAACTGAGAAAACACAGG - Intronic
1033857951 7:145588139-145588161 TAGCACAGCAGGGAAAACAGAGG - Intergenic
1035078573 7:156197911-156197933 TTCTACAGATGGGGAAACACAGG - Intergenic
1035196512 7:157225823-157225845 TTGCAGAGCAGGGACAACAGGGG - Intronic
1035613533 8:985776-985798 TCTCACATCTGGGGAAACACTGG - Intergenic
1036113016 8:5926522-5926544 TTGCACATCTGAGAAACCAGCGG + Intergenic
1036280233 8:7394016-7394038 TTGCACAGCTCTGAAAACACAGG - Intergenic
1036341292 8:7917867-7917889 TTGCACAGCTCTGAAAACACAGG + Intergenic
1036479405 8:9124950-9124972 TTCAACAGCGGGCAAAACACAGG - Intergenic
1037176354 8:15951023-15951045 TTGCACAGCGGGGATGAAACCGG - Intergenic
1038469625 8:27803127-27803149 TTTCACAGATGGGAAAACTAAGG - Intronic
1041681767 8:60600828-60600850 TTACACAGATGGGATAATACAGG - Intronic
1042105553 8:65322797-65322819 CTGCACAGCTAAGACAACACTGG - Intergenic
1042879100 8:73467619-73467641 TTTTACAGCTAGGAAAACAAAGG + Intronic
1047616807 8:126569451-126569473 TTTCACAGATGAGAAAACAGAGG + Intergenic
1047680064 8:127245533-127245555 TTGCCCTGATGGGAGAACACAGG + Intergenic
1048304962 8:133277865-133277887 TTTCACAGGTGGGGAAACAGAGG + Intronic
1048351587 8:133620905-133620927 TTTCACAGCTGGGGAAGCAGAGG + Intergenic
1048831198 8:138479029-138479051 TAGAACAGCTGGCAAAACTCAGG + Intronic
1049093854 8:140536304-140536326 TTGCAAAGAAGGGAACACACTGG - Intronic
1049550398 8:143255257-143255279 TTTCACACCTGGGAAAACTGAGG - Intronic
1050628928 9:7538338-7538360 TGACAGAGCTGGGAAAACCCAGG - Intergenic
1052853462 9:33392392-33392414 TTTCACAGATGGGAAAACTGAGG - Intronic
1052984813 9:34479124-34479146 GTGGAGAGGTGGGAAAACACAGG + Intronic
1053681486 9:40488572-40488594 TTTCACAGATGGGAAAACTGAGG - Intergenic
1053931479 9:43116902-43116924 TTTCACAGATGGGAAAACTGAGG - Intergenic
1054282227 9:63136362-63136384 TTTCACAGATGGGAAAACTGAGG + Intergenic
1054294577 9:63324089-63324111 TTTCACAGATGGGAAAACTGAGG - Intergenic
1054392598 9:64628576-64628598 TTTCACAGATGGGAAAACTGAGG - Intergenic
1054427246 9:65133785-65133807 TTTCACAGATGGGAAAACTGAGG - Intergenic
1054503130 9:65887755-65887777 TTTCACAGATGGGAAAACTGAGG + Intronic
1056543962 9:87597641-87597663 TTGCACAGATGGGGAAACTGAGG + Intronic
1056622785 9:88228256-88228278 TTGCACAGCTGGAAAGAGTCAGG + Intergenic
1056804167 9:89715113-89715135 AAGTACAGCTGGGAAAACATTGG + Intergenic
1057078528 9:92154370-92154392 TAGAACAGCTGGGAACACAGGGG - Intergenic
1057274213 9:93667676-93667698 TTGCACAGATGGGGAAACCGAGG + Intronic
1057396381 9:94684090-94684112 TTGCCCAGCTGGGAATGCAGTGG + Intergenic
1058654730 9:107209739-107209761 TAAAACACCTGGGAAAACACAGG - Intergenic
1059454520 9:114391119-114391141 TTTCACAGTTGGGTAAACAGAGG + Intronic
1059682025 9:116595114-116595136 TTTCACATGTGGGAAAACTCAGG - Intronic
1060001347 9:119961829-119961851 TTGTACAGATGGCAAAACAGAGG + Intergenic
1061441141 9:130604515-130604537 TTGTACAGATGAGGAAACACAGG - Intronic
1061702703 9:132428121-132428143 TTGCATAGCTGGGACCACAGGGG + Intronic
1061871727 9:133524502-133524524 TGGCACAGATGGGAAAACTGAGG + Intronic
1186219414 X:7333743-7333765 CTGCACAGATGAGAAAACAGAGG - Intronic
1186264472 X:7817413-7817435 TTGCACAGCTCTTAATACACTGG + Intergenic
1186285367 X:8038082-8038104 GTTCACAGCTTGGAGAACACAGG - Intergenic
1186438756 X:9566911-9566933 TTTCACAGCTGAGGAAACTCTGG + Intronic
1188361222 X:29256553-29256575 TTGCACAGTTGAAAAAACAGAGG - Intronic
1189294128 X:39907061-39907083 TTGCCCAGCTGGCAGAGCACTGG + Intergenic
1189488984 X:41454993-41455015 TGACACAGCTGTGAAAACACTGG - Intronic
1189919637 X:45890723-45890745 TTGCACAGTTGGCAATACAAGGG + Intergenic
1190637742 X:52452788-52452810 TTGGACAGATGGGAACTCACAGG - Intergenic
1190639716 X:52472070-52472092 TTGGACAGATGGGAACTCACAGG - Intergenic
1190647900 X:52540225-52540247 TTGGACAGATGGGAACTCACAGG + Intergenic
1190774557 X:53542329-53542351 TGGAACAAATGGGAAAACACTGG + Intronic
1190816362 X:53933495-53933517 TTTCACAGATGGCAAAACTCAGG + Intergenic
1192189421 X:68981793-68981815 TTTCACAGGTGGGGAAACACTGG + Intergenic
1196004737 X:110823440-110823462 TTTTACAGATGGAAAAACACAGG + Intergenic
1198551927 X:137754158-137754180 TTCCTCACCTGGGAAAACAGAGG - Intergenic
1198681004 X:139182181-139182203 TTTTACAGATGGGAAAACAAAGG + Intronic
1199843630 X:151675194-151675216 TTGCTCAGCTGGGAGAAAGCAGG + Intronic
1199975882 X:152894667-152894689 TTGTACAAATGGGAAAACAGAGG - Intergenic
1200352532 X:155513565-155513587 TTGAACAGATGGGAAAATAGAGG + Intronic
1201385677 Y:13437223-13437245 TTGCAGAGCTCGGGAACCACTGG - Intronic