ID: 1115141878

View in Genome Browser
Species Human (GRCh38)
Location 14:30181314-30181336
Sequence ACTTATAAGAAGAGACATGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 518
Summary {0: 1, 1: 1, 2: 11, 3: 69, 4: 436}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115141876_1115141878 12 Left 1115141876 14:30181279-30181301 CCTGTATCGGCTAGATTTTAAAG 0: 1
1: 0
2: 0
3: 4
4: 53
Right 1115141878 14:30181314-30181336 ACTTATAAGAAGAGACATGATGG 0: 1
1: 1
2: 11
3: 69
4: 436

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115141878 Original CRISPR ACTTATAAGAAGAGACATGA TGG Intronic
900011678 1:116755-116777 ACATTTAAGAATAGACTTGAAGG - Intergenic
900027782 1:293321-293343 ACATTTAAGAATAGACTTGAAGG - Intergenic
900041737 1:472762-472784 ACATTTAAGAATAGACTTGAAGG - Intergenic
900063172 1:707740-707762 ACATTTAAGAATAGACTTGAAGG - Intergenic
900893072 1:5463604-5463626 CCTTGTAAGAAGAGCCAGGAGGG + Intergenic
901311741 1:8274868-8274890 ACTTATCAGAAGAGAGAAAATGG - Intergenic
901332036 1:8417674-8417696 GCTTTTAAGAAGAGAAGTGAGGG - Intronic
902565765 1:17310359-17310381 ACAGATAAGAAGTGACAGGAAGG - Intronic
903690918 1:25172990-25173012 ATTTATAAGAAGAAAGGTGAAGG + Intergenic
903961806 1:27062690-27062712 ATTTATAAAAAGAAAGATGAGGG + Intergenic
904213909 1:28904595-28904617 CCTTATAAGAAGAGACACCAAGG + Intronic
904273987 1:29368503-29368525 CCTTATAAGAAGAGACTCCAGGG - Intergenic
905292839 1:36934597-36934619 ATTTGTAATAAGAGTCATGAAGG - Intronic
906922035 1:50075066-50075088 ACATTTAAGCAGAGACATAATGG + Intronic
906923011 1:50084842-50084864 AGTTATAAGAAGTGCTATGAAGG - Intronic
907710519 1:56876394-56876416 ACTCTCAAGCAGAGACATGAGGG - Intronic
909408557 1:75321486-75321508 CCTTGTAAGAAGAGACAATAGGG - Intronic
910293532 1:85621971-85621993 AATTATAAGAAGTGCTATGAAGG + Intergenic
910422201 1:87078381-87078403 AGTAATAAGAAGAGACCTTAAGG - Intronic
910682981 1:89886357-89886379 ACTTCTAAGAAGAAACTTGGAGG - Intronic
910924143 1:92381162-92381184 ACTTATCAGATGGGACATGTGGG - Intronic
911310076 1:96281448-96281470 ACTGATGAGATGAGACAAGAAGG + Intergenic
912167022 1:107054142-107054164 ACATTTAAGTTGAGACATGAAGG + Intergenic
913069975 1:115289981-115290003 AATTGGAAGAAGAGAGATGAGGG - Intronic
913092408 1:115486511-115486533 CCTTAGAAGAAGAGACACTAGGG - Intergenic
914892205 1:151635874-151635896 ACTTATACCAAGAGCCATCAGGG - Intronic
916519338 1:165549678-165549700 TCTTAAAAGAAAAGACATGAGGG + Intronic
916822809 1:168416245-168416267 CCTTATAAGAAGAGGCTTGAAGG + Intergenic
916848630 1:168679977-168679999 ACATCTAACAAGGGACATGAAGG - Intergenic
917187177 1:172371625-172371647 ACTTATAAGCACAGAAATTAAGG + Intronic
917468272 1:175303929-175303951 CCTTATAAGAAGAGAGATCAGGG - Intergenic
917527322 1:175800454-175800476 ACTGCTAAGAAGAAACATTAAGG + Intergenic
917742343 1:177972857-177972879 CCTTATAAAAAGACACAAGAGGG + Intronic
918132986 1:181645427-181645449 ACCTATAAGAAGAAAAAAGAGGG - Intronic
918200987 1:182266678-182266700 CCGTATAAGAAGAGACATGAGGG + Intergenic
918484549 1:185015515-185015537 CCTTATAAAAAGAGATAAGAGGG + Intergenic
918574582 1:186041971-186041993 ACTTATAAGAGAAGACAACATGG - Intronic
918603893 1:186398141-186398163 ACTTATAAAAACAAATATGAAGG + Intronic
920255134 1:204649603-204649625 AGCAATAAGAAGAAACATGAAGG + Intronic
920989591 1:210923978-210924000 CCTTATAAGAAGAGAAGAGATGG + Intronic
922260113 1:223932765-223932787 ACATTTAAGAATAGACTTGAAGG - Intergenic
922380165 1:225015051-225015073 ACCTATAATAATAGACATGGAGG - Intronic
923463058 1:234223970-234223992 TCTTATAAGAAGAGACATCAGGG - Intronic
923738351 1:236633311-236633333 CCTTATAAGAAAAGACATCAGGG - Intergenic
924079492 1:240379232-240379254 ACTGATCACAAGAGACAGGATGG - Intronic
924341280 1:243035324-243035346 ACATTTAAGAATAGACTTGAAGG - Intergenic
924372117 1:243361812-243361834 ACTTATAATAAGCTCCATGAAGG - Intronic
1063056726 10:2513135-2513157 ACAAGTAAGAAGGGACATGAGGG + Intergenic
1063290876 10:4746203-4746225 ACTGATAACAAGAGACAGGGAGG - Intergenic
1063333715 10:5188417-5188439 ACATTTAAGAAAAGACCTGAAGG + Intergenic
1064443340 10:15371987-15372009 AATTATAAGAGGAAACATCAGGG + Intergenic
1064583788 10:16819307-16819329 CCTTAGAAGAAGAGACACCAAGG - Intergenic
1064837086 10:19545160-19545182 AGACATAAGAAGAAACATGAGGG - Intronic
1065478734 10:26170936-26170958 ACTTGGAAGTACAGACATGAGGG - Intronic
1065482609 10:26210903-26210925 ATATATAAGGAGAGACCTGAAGG - Intronic
1066117089 10:32250116-32250138 CCTTATAAGAAGAGACACAGAGG + Intergenic
1066224340 10:33367706-33367728 GGTTATAAGAAGAGGCATAAAGG - Intergenic
1066400648 10:35072832-35072854 GCTAATAAGGGGAGACATGAGGG - Intronic
1066408927 10:35146625-35146647 AGTTATAAGAAAAGAGATAAAGG + Intronic
1066735192 10:38470110-38470132 ACATTTAAGAATAGACTTGAAGG + Intergenic
1067128414 10:43540085-43540107 CCTTATAGGGAGAGACATCAGGG - Intergenic
1067494488 10:46749588-46749610 AGGGATAAGATGAGACATGATGG + Intergenic
1067600170 10:47590809-47590831 AGGGATAAGATGAGACATGATGG - Intergenic
1067674402 10:48358708-48358730 ACTTAGAAGAAAAGATAGGAGGG - Intronic
1067724673 10:48761110-48761132 ACATGTAAGCAGAGACCTGAAGG + Intronic
1068099728 10:52537081-52537103 AATTACAAGAAGATACATGCAGG - Intergenic
1069577020 10:69538048-69538070 CCTTATAAGAAGAGACTCCAGGG - Intergenic
1071651709 10:87398688-87398710 AGGGATAAGATGAGACATGATGG - Intergenic
1072233475 10:93432752-93432774 CCTCATGAGCAGAGACATGAGGG - Intronic
1072855817 10:98944931-98944953 ACTCATAAAAAGAGGCATAATGG - Intronic
1073797215 10:107001448-107001470 ACTTATAAGCAAAGACATGGGGG + Intronic
1075851951 10:125596284-125596306 CCTTATAAGAGGAGAGAAGAAGG + Intronic
1076191786 10:128488308-128488330 CCTTAAAAGAAGAGACACCAGGG - Intergenic
1076968010 11:108991-109013 ACATTTAAGAATAGACTTGAAGG - Intergenic
1077062172 11:622289-622311 ACTTATAACAACAGACAAAAAGG + Intronic
1077706389 11:4490271-4490293 ACTTGTCAGAAAAGACATGGGGG - Intergenic
1078129552 11:8601993-8602015 TCCTATCAGAAGAGAAATGATGG + Intergenic
1078251009 11:9616556-9616578 ACATTTGAGCAGAGACATGAAGG + Intergenic
1079162884 11:18011339-18011361 CCTTAAAAGAAGAGACACCACGG + Intronic
1079615582 11:22488626-22488648 CCTCATAAGAAGAGACATGAGGG + Intergenic
1079963612 11:26953540-26953562 AGGTATAAGAAGAGCTATGATGG - Intergenic
1080236741 11:30078587-30078609 TCTTAATAGAAAAGACATGATGG - Intergenic
1080979355 11:37381489-37381511 TCTTATAAAAAGAGACATAAAGG + Intergenic
1081010818 11:37810901-37810923 CCTTATAAAAAGAGACACCAGGG - Intergenic
1081019513 11:37927529-37927551 GAATATAAGAAGATACATGAAGG + Intergenic
1081196638 11:40168919-40168941 CCTTATAAGAGGAAACATGAAGG - Intronic
1081362696 11:42199926-42199948 ACTTATAAGAAGGAACTTAATGG + Intergenic
1081432682 11:42993640-42993662 ACACATAAGAAAAGACAAGAGGG - Intergenic
1081578096 11:44332265-44332287 CCTGAACAGAAGAGACATGAAGG - Intergenic
1081584941 11:44377718-44377740 CCTTATAAGAAGAGACACCAGGG + Intergenic
1081786018 11:45748082-45748104 AATTTTAAGTAAAGACATGATGG - Intergenic
1083058563 11:59846586-59846608 ACCTCTGAGCAGAGACATGAAGG - Intergenic
1085331127 11:75652291-75652313 AAGTATAAGAAGTGACATGGTGG - Intronic
1085409972 11:76285047-76285069 ACTTATAAAAAGAGACTCCAGGG + Intergenic
1085776962 11:79375752-79375774 ACCTTTAAGAGGAGACCTGAAGG + Intronic
1086215727 11:84378205-84378227 CCCTAAAAGAAGAGACATCAGGG + Intronic
1086284901 11:85236463-85236485 CCTTATAAGAAGATACACCAGGG - Intronic
1087942700 11:104118274-104118296 CCTTATAAGAAGAGACACAAGGG + Intronic
1088832749 11:113551326-113551348 ACATTTGAGAAGAGACCTGAAGG - Intergenic
1091576401 12:1740451-1740473 CCTTGTAAGAAGAGACACCAGGG - Intronic
1091914290 12:4257243-4257265 ACTTATATGAAGAGGCATATAGG + Intergenic
1092758583 12:11788513-11788535 AGTTATCAGAAGAGAAATGATGG - Intronic
1093558235 12:20504783-20504805 ACTTATAAGAAGAGGCAGGAGGG - Intronic
1094122203 12:26986379-26986401 ATTTCTAAGAGGAAACATGAGGG - Intronic
1094230855 12:28101613-28101635 ACTTTTAAAAAGAGACATACTGG + Intergenic
1094457214 12:30649399-30649421 CCTTATAAGAAATGAGATGATGG - Intronic
1095260159 12:40088744-40088766 ACACAAAAGAAGAGACAGGAAGG + Intronic
1095475142 12:42579282-42579304 ACTTTTGAGCAGAGACCTGAAGG + Intronic
1095656901 12:44681199-44681221 AAATATAAGAAAAGACATAAAGG - Intronic
1095695900 12:45143826-45143848 ACTTATAAGAAGAGACTCCAGGG - Intergenic
1097008956 12:55939004-55939026 AGGTACAAGAAGGGACATGAAGG - Intronic
1097201040 12:57278974-57278996 ACTAATAAGCAGAGGGATGAGGG + Intronic
1097739585 12:63225022-63225044 AAATATAAGAAAAGACATAAAGG + Intergenic
1099300182 12:80883527-80883549 ACAGATAGGAAGAGACATGGTGG - Intronic
1099657439 12:85511142-85511164 AATAACAAGAAGAGATATGAAGG + Intergenic
1099900315 12:88699910-88699932 AATTAGAGGAAGAGACATTATGG - Intergenic
1100408707 12:94293918-94293940 CCTTATAAGAAGAGACACCAGGG - Intronic
1101200981 12:102436039-102436061 AATTATCACAAGAGATATGAAGG - Intronic
1101579044 12:106025285-106025307 TCTTATATGAAGAGACACCAGGG + Intergenic
1102159836 12:110759731-110759753 TCTTATAAGAAGAGAGATTAGGG + Intergenic
1103371867 12:120425295-120425317 CCTTTTAAGATGAGACCTGAGGG + Intergenic
1104705292 12:130940830-130940852 CCTTACAAGAAGAGACATGAGGG - Intergenic
1104999660 12:132681767-132681789 ACTAACAAAAAGAGTCATGATGG + Intronic
1105985758 13:25565068-25565090 ACATATAAAGAGAGAGATGATGG - Intronic
1106396562 13:29386345-29386367 ATTTCTAAGAGGAGACATCAAGG + Intronic
1109381923 13:61573688-61573710 ATTTATAAGAAGAGAAATTAGGG + Intergenic
1109401813 13:61841084-61841106 ACTGTTAAGAAGAGAAATAAGGG + Intergenic
1109445528 13:62434341-62434363 AGTTAGAATAAGAGACCTGAAGG - Intergenic
1110164987 13:72431053-72431075 ACTTGTAAGCAGAGGCTTGAAGG + Intergenic
1111049959 13:82869361-82869383 ATTACTAAGAAGAGACATCAAGG - Intergenic
1111093392 13:83476509-83476531 ACTTTTAAGATGATAAATGAAGG + Intergenic
1111151989 13:84264783-84264805 CTTTATAAGAAGAGACATCTGGG + Intergenic
1111364999 13:87231856-87231878 AACTATAAGAAGAGACAAGAAGG - Intergenic
1111447985 13:88374816-88374838 ACTTATAGCAAATGACATGATGG + Intergenic
1111658362 13:91179216-91179238 TCTTATAAGAAGAGACCTAGAGG - Intergenic
1112054769 13:95679822-95679844 ACTTTTAAAAAAAGAAATGAAGG + Intronic
1112240472 13:97676660-97676682 CCTTATAAGAAGAGGCCAGAGGG - Intergenic
1113241244 13:108340044-108340066 ACTTATCAGATGAGCCAAGAGGG + Intergenic
1113340360 13:109416863-109416885 AGTGATAAAAAGAGACATGATGG - Intergenic
1114232225 14:20793474-20793496 CCTGATAAAAAGAGACATGAGGG - Intergenic
1114704162 14:24708643-24708665 ACTTAGAAGGAGAGGCCTGAGGG + Intergenic
1115141878 14:30181314-30181336 ACTTATAAGAAGAGACATGATGG + Intronic
1115901818 14:38159576-38159598 ACTTAAATGAAGGGACCTGAGGG + Intergenic
1116132855 14:40881010-40881032 ATTTCTAAGAGGAAACATGAGGG + Intergenic
1116179271 14:41515733-41515755 ATCTACTAGAAGAGACATGAAGG - Intergenic
1116289265 14:43011305-43011327 CCTTACAAGAAGAGACAGCAGGG - Intergenic
1116318551 14:43429684-43429706 ACTTAAAAGAACAGAGATAATGG - Intergenic
1116971293 14:51068817-51068839 GCTTATCAGAAGAGACATCATGG - Intronic
1117317692 14:54589852-54589874 ACATATAAGCAGAGACCTGAAGG - Intronic
1118240155 14:64048427-64048449 ACTTGTAAGAAAAGGAATGATGG - Intronic
1118680288 14:68234302-68234324 ACTAATGAGAAGAGACATTCAGG + Intronic
1119535015 14:75395903-75395925 ACATTTAAGCTGAGACATGAAGG + Intergenic
1119960983 14:78856547-78856569 ACGTATAAGAAGAGACAACAAGG - Intronic
1120520183 14:85518468-85518490 AGGTAGAAGAAGAGACATTAGGG + Intergenic
1121138250 14:91518116-91518138 ATTGCTAAGAAGAAACATGAAGG + Intergenic
1121280013 14:92691360-92691382 CCTTATAAGAAGAGACACCAGGG - Intergenic
1122304065 14:100750347-100750369 AATTTCAAGAAGAGACTTGATGG + Intergenic
1122665257 14:103325401-103325423 CCTTATAAGAAGAGACACAGAGG + Intergenic
1124722740 15:32124822-32124844 CCTTATAAGAAGAGACACAAGGG + Intronic
1126980644 15:54238805-54238827 ACTGATAAGAAGATACAAGTAGG + Intronic
1127025122 15:54796430-54796452 ATTTACAAGTACAGACATGATGG + Intergenic
1127200809 15:56647836-56647858 AGTTATATGAAGAGAAGTGATGG - Intronic
1129970079 15:79770387-79770409 GTTTATAAGAAGACACATAATGG - Intergenic
1130159748 15:81386644-81386666 ACATTTGAGAAGAGACTTGAAGG - Intergenic
1130832148 15:87611888-87611910 TCTTATAAGAAGAGGCATGTTGG - Intergenic
1131509104 15:93039380-93039402 AATTTTAAGAAAAGAAATGATGG - Intronic
1131742562 15:95410351-95410373 ACTTACAAGTAAAGACATGTAGG + Intergenic
1131751371 15:95511361-95511383 CCTTATAAGAAAAGACCAGAGGG + Intergenic
1131942894 15:97586076-97586098 ACTTAAAAGTGGACACATGAGGG + Intergenic
1132034995 15:98475111-98475133 ACTTATAGGAAGAGAGGGGAAGG + Intronic
1132345840 15:101108265-101108287 CCTTATCAGAAGAGACACCAGGG + Intergenic
1133426366 16:5693775-5693797 ACTTATAAGAAGGGAGAGGAAGG - Intergenic
1135103020 16:19623383-19623405 CCTTATAGGAAGAGACAGCAAGG - Intronic
1135519052 16:23159468-23159490 CCTTATAAGAAGAGAGATTGGGG - Intergenic
1136014431 16:27386303-27386325 CCTTATAAGAAGAGACACCAGGG - Intergenic
1139108049 16:63852156-63852178 ACTTAATAGAAAAGATATGATGG + Intergenic
1141065601 16:80911284-80911306 CCTTATAAGAAGAGACAGCCGGG + Intergenic
1141892777 16:86938195-86938217 ACTTACAAGAAGAGCCATCAGGG - Intergenic
1142452668 16:90190154-90190176 ACATTTAAGAATAGACTTGAAGG + Intergenic
1143814446 17:9500700-9500722 ACTTAGAATAAAAGATATGAAGG + Intronic
1143850441 17:9807627-9807649 ACAGCTAAGAAGACACATGATGG + Intronic
1144786640 17:17835981-17836003 ACTTCTAAGCTGAGACCTGAGGG - Intronic
1146358146 17:32152461-32152483 AGTTTTAAGAAGAGAGATGAAGG + Intronic
1148650694 17:49248207-49248229 ACTTATAAGCTGAGACCTGCAGG + Intergenic
1149365860 17:55943384-55943406 ACATCTTACAAGAGACATGAAGG + Intergenic
1149727616 17:58912359-58912381 ACATTTAAGCAGAGACTTGAAGG + Intronic
1150181221 17:63123157-63123179 AATTTTAAGAAGAAAAATGATGG + Intronic
1150453424 17:65288186-65288208 CCTTATAAGAAGAGACACATGGG + Intergenic
1151527088 17:74677941-74677963 GCTTATAAGAGGAAACATTAGGG - Intronic
1152675378 17:81637444-81637466 ACTTAAAAAAAAAAACATGAAGG - Intronic
1153074472 18:1147287-1147309 ACATCTAAGATGAGACCTGAAGG - Intergenic
1153415460 18:4841128-4841150 CATTATAAAAAGAGACAAGAAGG - Intergenic
1155178215 18:23320166-23320188 ACTGAGCATAAGAGACATGAGGG - Intronic
1156526076 18:37768532-37768554 ATTACTAAGAAGAGACATCAAGG - Intergenic
1156831655 18:41499256-41499278 ACTTCTAAGAAAAGGAATGAGGG + Intergenic
1157394210 18:47328152-47328174 ACTTCTAGGAAGAGAAAGGAAGG + Intergenic
1157689614 18:49670428-49670450 ATTAATAAGAATAGAAATGATGG + Intergenic
1159223067 18:65490909-65490931 CCTTATAAGAAGAGACACTGAGG - Intergenic
1159666888 18:71172565-71172587 ACTAATGAGATGAGACATCATGG + Intergenic
1160220039 18:76968718-76968740 TCTTATAACCAGAAACATGAAGG - Exonic
1160222936 18:76990375-76990397 ATTACTAAGAAGAGACATAAAGG + Intronic
1160416096 18:78712086-78712108 CCTTATGAGAACAGACAGGAGGG + Intergenic
1160644819 19:178604-178626 ACATTTAAGAATAGACTTGAAGG - Intergenic
1161157877 19:2742975-2742997 ATTTCTAAGAAAAGACTTGACGG + Intergenic
1161321259 19:3642635-3642657 ACTTAAAACAAGATACAAGAGGG - Intronic
1162706866 19:12561597-12561619 CCTTATAAGAAGAGACACCAGGG + Intronic
1163224962 19:15953376-15953398 AACTATAAAAAGAGACAAGAAGG - Intergenic
1163411369 19:17156952-17156974 ACTTATAAGAAGAGAGCTACAGG + Exonic
1165307968 19:35013722-35013744 ACTGATAGGAAGAGAGAGGAGGG + Intronic
1165940274 19:39411472-39411494 ACTTTTGAGCAGAGACATGAAGG - Intergenic
1166563702 19:43750374-43750396 ACTTTTTAGCAGAGACTTGAAGG - Intronic
1167030229 19:46954031-46954053 CCTTAGAAGAAGAGACAGGAGGG + Intronic
1168474597 19:56666767-56666789 CCTTATAAGAGGAGACACCAGGG + Intronic
925352936 2:3214923-3214945 CTTTATAAGAAGAGACCTGGAGG + Intronic
926614127 2:14978121-14978143 TTTTATAAGAAGAGAAAAGAAGG - Intergenic
927260357 2:21082008-21082030 CCCTGTAAGAAGAGACATCAGGG + Intergenic
927316714 2:21691588-21691610 TCTTATGAAAAGAGAGATGAGGG + Intergenic
927369258 2:22335771-22335793 CCTTTTAAGAAGAGACACAAAGG + Intergenic
928159801 2:28911923-28911945 ACTTATAAGAAGTAACAGCAGGG - Intronic
928932741 2:36641030-36641052 AACTATAAGAAGAGACAAAAAGG + Intronic
929195650 2:39181679-39181701 CCTTATAAGAAGAGGGAAGATGG + Intronic
930651144 2:53966174-53966196 ACTTGGAGGCAGAGACATGAGGG + Intronic
930873590 2:56190592-56190614 ACTTATAAAATGAGACCTGATGG + Intronic
932048455 2:68374546-68374568 ACTTACAATAAGGTACATGAAGG + Intronic
932997549 2:76874202-76874224 TTTTCTAAGATGAGACATGAAGG - Intronic
934019996 2:87938824-87938846 AATTTTAAGAAGAGAGATGGTGG - Intergenic
934697775 2:96412481-96412503 CCTTGTAAGAAGAGACACCACGG + Intergenic
934716316 2:96546677-96546699 ACTTGTCAGCAGAGACCTGAGGG + Intronic
935227322 2:101064222-101064244 CCTTATAAGAAGAGACACCGGGG + Intronic
936578941 2:113679029-113679051 ATTTATAAAAAGAGACATCTTGG + Intergenic
936851710 2:116907037-116907059 AAGTATAAGAATAAACATGATGG - Intergenic
937591461 2:123618102-123618124 ATCTATAAGAAGAGACAAAAAGG + Intergenic
937799652 2:126067695-126067717 AATTATAAAAAAAGAGATGAAGG - Intergenic
938182902 2:129199732-129199754 ATTACTAAGAAGAAACATGAGGG - Intergenic
939532719 2:143384747-143384769 ACTCACAATCAGAGACATGAAGG + Intronic
939993968 2:148902654-148902676 ATTTGAAAGAAGAGATATGAAGG - Intronic
940251192 2:151678761-151678783 ACTGAGAAGCAGAGACATGAGGG + Intronic
940411147 2:153364667-153364689 ACAGCTAAAAAGAGACATGAAGG + Intergenic
940432466 2:153609469-153609491 ACTTTTAAGCAGAGAAATGATGG - Intergenic
940792371 2:158042693-158042715 CCTTATAGGAAGAGAGAGGAAGG + Intronic
941279169 2:163528906-163528928 ACATATAAAAAGAAACCTGATGG - Intergenic
942087165 2:172454341-172454363 GTTTTTAAGCAGAGACATGAAGG + Intronic
942803145 2:179899080-179899102 CCTTATAAGAAGTGACACCAGGG - Intergenic
943339063 2:186655373-186655395 ACTTTTCAGTAGAGACCTGAAGG + Intronic
944057970 2:195543460-195543482 CCTTATAAGAAGAAACATGAGGG - Intergenic
945563138 2:211362997-211363019 ACAGCTAAGAAGGGACATGAAGG + Intergenic
947027234 2:225750099-225750121 TCTTATAAGAAGAGATACAAGGG + Intergenic
947496689 2:230642954-230642976 AAATACAGGAAGAGACATGACGG + Intergenic
949084109 2:242134809-242134831 ACATTTAAGAATAGACTTGAAGG + Intergenic
1169785602 20:9356335-9356357 ACTCATAAGAGGAAACATGTTGG + Intronic
1169934773 20:10871587-10871609 ACTTAAAAGAACAGGCATGTAGG + Intergenic
1170102713 20:12720079-12720101 CCTTATAAGAAGTGACACCAGGG + Intergenic
1172310497 20:33914315-33914337 TTTGAGAAGAAGAGACATGAGGG - Intergenic
1172911948 20:38416099-38416121 CCTTATAAGAAGAGACACCAGGG + Intergenic
1173290806 20:41713397-41713419 ACTGATGAGCAAAGACATGAAGG - Intergenic
1173334846 20:42104165-42104187 TCTTATAAGAAGAAACATGTAGG + Intronic
1173544815 20:43887389-43887411 ATCTATAAGAAGAGGCATGAGGG - Intergenic
1173633337 20:44532734-44532756 ACTTCCAAAATGAGACATGAAGG + Intronic
1173861531 20:46286882-46286904 ACAGAAAGGAAGAGACATGAAGG - Intronic
1176280694 20:64307297-64307319 ACATTTAAGAATAGACTTGAAGG + Intergenic
1176343287 21:5717691-5717713 CCTTATTAGAAGAGGCAGGAAGG - Intergenic
1176501540 21:7606765-7606787 CCTTATTAGAAGAGGCAGGAAGG + Intergenic
1176537608 21:8115760-8115782 CCTTATTAGAAGAGGCAGGAAGG - Intergenic
1177115271 21:17078014-17078036 TCTTCTAAGAAGTAACATGAAGG + Intergenic
1177565112 21:22810612-22810634 AGATAGAAGAAGAGAAATGAAGG + Intergenic
1177857739 21:26418797-26418819 TCTTATAAGAAGAAACATAAGGG + Intergenic
1178596142 21:33954621-33954643 CCTTATAAGAAGAGACACCAGGG - Intergenic
1179085002 21:38208051-38208073 ACATATAAGAAAAGACAACATGG - Intronic
1180057916 21:45368539-45368561 ACTTAGAAGAGGAGAGAAGAGGG + Intergenic
1180387977 22:12197371-12197393 ATTAAAAAGCAGAGACATGAAGG + Intergenic
1181779142 22:25180242-25180264 ACTTTTAAGAAGAAACAGGCAGG + Intronic
1182150228 22:28022362-28022384 TCTGATCAGAAGAGAAATGACGG - Intronic
1182184109 22:28384130-28384152 ATGTATAAGCAGAGACCTGAAGG - Intronic
1182817530 22:33179051-33179073 CTTTATAAGAAGAAACATCAAGG - Intronic
1182854168 22:33502402-33502424 TCTGAAAAGAAGGGACATGAGGG + Intronic
1183011433 22:34950039-34950061 CCTTATAAGAAGAGACACCTGGG + Intergenic
1184509412 22:44924522-44924544 TCTTATAAGAAGAGACACGAGGG + Intronic
1203242554 22_KI270733v1_random:32115-32137 CCTTATTAGAAGAGGCAGGAAGG - Intergenic
949144786 3:685619-685641 TCTTATAAGAAATGAAATGATGG - Intergenic
949297120 3:2537904-2537926 ACTTATGTAAAGAGACTTGACGG - Intronic
949598446 3:5573011-5573033 AATTTTAAAAAGAGACAGGATGG - Intergenic
950458887 3:13109302-13109324 TCTTAAAAGAAGAGAGATGAAGG + Intergenic
950720364 3:14878065-14878087 ACTTTTGAGCAGAGACCTGAAGG + Intronic
951969300 3:28425807-28425829 ACTTATAAAAATATACATGTAGG + Intronic
952083505 3:29789670-29789692 ATTTAAAAGAAGAGGAATGATGG - Intronic
952209552 3:31215696-31215718 CCTTATAAGAGGAGATGTGAAGG + Intergenic
954801167 3:53187717-53187739 ACTTATTAGATGAGACTTTATGG - Intronic
955482535 3:59404186-59404208 CCTTATAGGCAGAGGCATGAGGG - Intergenic
955825221 3:62938973-62938995 CCTTATAAGAAGAGACACAGAGG - Intergenic
956013305 3:64854600-64854622 ACTTATGAGAATACACATGCAGG - Intergenic
956228455 3:66986363-66986385 CCTCATAAGAAGAGATATCAAGG - Intergenic
956705968 3:71999323-71999345 ACTTACAAGATGACACATGGAGG + Intergenic
956745038 3:72304505-72304527 ACTTATAGGCAAGGACATGATGG + Intergenic
958470551 3:94512502-94512524 CCTTATAAGAAGAGACACCGAGG + Intergenic
959608112 3:108264132-108264154 CCTTATAAGAAGAGACACAGAGG + Intergenic
959784189 3:110273839-110273861 CCTTATAAGAAGAGACACCAGGG - Intergenic
961948545 3:130720485-130720507 ACTTATCAGAAGACAAATGTGGG + Intronic
962301033 3:134243257-134243279 ACTTAGTAGAAGAGACTTTAGGG - Intronic
963515919 3:146307549-146307571 ACTTATAAGAAGAGAAAATTTGG - Intergenic
964623585 3:158738587-158738609 CCTTATAAGAAGAGACACAGAGG - Intronic
964676271 3:159284168-159284190 ATTTATAAGAAAAGACATTGTGG - Intronic
965394161 3:168141988-168142010 CCTTATAATATGTGACATGAGGG + Intergenic
965483440 3:169248719-169248741 ACTTCTAAGAAGAGAAATGTTGG + Intronic
966430616 3:179828116-179828138 ATTACTAAGAAGAGACATCAGGG - Intronic
966467597 3:180248482-180248504 ACTTAGAAGTAGAAACATGTAGG + Intergenic
966502796 3:180664299-180664321 TCTTTTAAGAAAAGACAAGAGGG - Intronic
966535861 3:181032985-181033007 CCTTATAAGAAGAGACTACAGGG - Intergenic
966998500 3:185309013-185309035 CCTTATAAGAAGAGAAAACACGG - Intronic
967485040 3:190020556-190020578 ACTTTTAAGATGAGACCTGGAGG - Intronic
970134810 4:12910648-12910670 TCCAATAAGAAGAGAAATGAAGG + Intergenic
970352780 4:15221153-15221175 ACTGATAAGAAGATATAAGATGG + Intergenic
970846292 4:20542142-20542164 ACAGATATGAAGAGACATAAGGG - Intronic
970887205 4:21000243-21000265 ACTTATTAGAGGAGTCATGAAGG - Intronic
971742931 4:30543000-30543022 ACATATAAAAACAAACATGAAGG + Intergenic
972088323 4:35248665-35248687 ACATTTGAGCAGAGACATGAAGG + Intergenic
973924323 4:55722117-55722139 AATTATAATATGAGGCATGATGG - Intergenic
974409254 4:61517595-61517617 ACTTACAAGAAGACACATTTCGG - Intronic
976106646 4:81625954-81625976 ACATTTAAGCAGAGACCTGAAGG - Intronic
976411558 4:84719064-84719086 ACTTACAAAAAAAGACATGGAGG - Intronic
976890884 4:90046271-90046293 GCTTGTAGGAAGATACATGAAGG + Intergenic
977530031 4:98190043-98190065 ATTCATTAGAAGAGGCATGAGGG - Intergenic
978082691 4:104613922-104613944 AACTATAAGAAGAGACAAAAAGG - Intergenic
978265223 4:106815777-106815799 CCTCATAAGAAGAGACACCAGGG + Intergenic
978877306 4:113657053-113657075 ATTTTTAAGAGGAGACATCAAGG - Intronic
979261545 4:118653050-118653072 ACATTTAAGAATAGACTTGAAGG + Intergenic
979963067 4:127044590-127044612 ACTTATAAGAAGAAAAACTAAGG - Intergenic
980098136 4:128514279-128514301 CCTTATAAGAAGAGACACCCGGG + Intergenic
980796771 4:137695697-137695719 ACTTCTAAGTTGAGTCATGAAGG + Intergenic
981170454 4:141616624-141616646 AATTAACAGAAGAGACTTGATGG - Intergenic
981186005 4:141804207-141804229 ACTTATGAAAAGAGAAAAGAAGG + Intergenic
981499704 4:145436874-145436896 ACTTATGGGCAGAGACAAGAGGG + Intergenic
981530512 4:145749151-145749173 AATTATAAGAAGAGACAAAGAGG - Intronic
982346092 4:154361590-154361612 ACTAAGAATAAGAGAAATGAAGG + Intronic
983150286 4:164270283-164270305 ACATTTAAGAATAGACTTGAAGG - Intronic
983273284 4:165588465-165588487 AATGATAATAAGAGACAGGAGGG - Intergenic
984167782 4:176322727-176322749 CCTTATAAAAAGAGTTATGACGG - Intronic
984426273 4:179590928-179590950 CCTTATAAGAAGAGAAAAGGAGG - Intergenic
984851508 4:184157193-184157215 ACTACTAAGAAGAAACATCAAGG - Intronic
985275633 4:188234796-188234818 AGTTATAAGAAGATACAGAATGG - Intergenic
985786762 5:1899630-1899652 ACTGATGAAAAGAGACAGGAAGG + Intergenic
985787060 5:1901992-1902014 ACTGATAAAAAGAGACAGGAAGG + Intergenic
987280370 5:16407647-16407669 ACTTAAAATAAGAGACTTCAAGG + Intergenic
987549109 5:19355588-19355610 AATTATAATAAGAGACAAAAAGG + Intergenic
988088183 5:26498810-26498832 CCTTATAAGAAGAGACACAAAGG + Intergenic
988653704 5:33183254-33183276 CGTTATAAGAAGAGATATGGTGG - Intergenic
990716157 5:58639534-58639556 CCTTAAAAGAAGAGAGATCAGGG - Intronic
990863473 5:60353965-60353987 ACTTATAAGAATGAACATCATGG + Intronic
990998459 5:61757548-61757570 ACTAAGAAGAAGAGACAAAATGG - Intergenic
991552446 5:67855343-67855365 AGATATATGAAGAAACATGACGG - Intergenic
992024440 5:72656722-72656744 ACTTAAAAGAAGAGGCAGCAGGG - Intergenic
992512903 5:77457409-77457431 TCTTATAAGAAAATACATTATGG - Intronic
993168706 5:84387876-84387898 CCTTATAAGAAGAGACACCAAGG + Intergenic
993476024 5:88365551-88365573 ACTTCTAACAAAAGACATCAGGG - Intergenic
993535485 5:89080019-89080041 TCTTTGAAGAGGAGACATGAAGG + Intergenic
994545497 5:101162108-101162130 TCTTAAAAGAAGATACATGCAGG - Intergenic
994815826 5:104586734-104586756 TTTTAGAAGAAGAGACATGAAGG + Intergenic
995832159 5:116365102-116365124 ATTTATCAGAAGAGACCAGATGG + Intronic
996603933 5:125298497-125298519 ACCTTTCAGAAGTGACATGAAGG + Intergenic
997122081 5:131185060-131185082 TGTTATAACAAGAGAGATGATGG - Intronic
997901006 5:137764255-137764277 CCTTATAAGAAGAGCCCAGAGGG + Intergenic
998285818 5:140859897-140859919 ACTTATAATATAAGACATTAAGG - Intronic
998695988 5:144640199-144640221 ACTTTTAAGCAGAGATTTGAAGG + Intergenic
999035189 5:148341236-148341258 ACTTATAAGCAGAAACCTGAAGG + Intergenic
999063935 5:148664660-148664682 GCTTATAAGAAAAGACAAAAAGG - Intronic
999644727 5:153706472-153706494 ATTTGTAAAAAGAGACATGATGG - Intronic
1001830830 5:174788032-174788054 TCTTATAAGAAGAGATGTGAGGG - Intergenic
1001853136 5:174986876-174986898 CCTGATAAGAAGAGACACCAGGG + Intergenic
1001918763 5:175583994-175584016 ACTTCTAAGAAGGAAAATGATGG - Intergenic
1002167391 5:177356839-177356861 CCTTATAAAAAGAGACAGGAGGG + Intergenic
1002635531 5:180606179-180606201 AGTCAGAAGAAGACACATGATGG - Intronic
1002732107 5:181346167-181346189 ACATTTAAGAATAGACTTGAAGG + Intergenic
1002752425 6:127938-127960 ACATTTAAGAATAGACTTGAAGG - Intergenic
1003175001 6:3747617-3747639 ACTTTTGAAGAGAGACATGAAGG - Intronic
1003549405 6:7089072-7089094 ACATATAAGAAGAGAGATGAAGG - Intergenic
1003723694 6:8734737-8734759 ACTCATAAGAATACACATGCAGG + Intergenic
1003768869 6:9274471-9274493 CCTCATAAGAAGAGACACCAGGG - Intergenic
1004528244 6:16429141-16429163 ACTGAAGAGAGGAGACATGAGGG + Intronic
1005206204 6:23408141-23408163 AGTTATAGGCAGAGACATTACGG - Intergenic
1005561828 6:27048384-27048406 AGTATTAAGAATAGACATGAGGG - Intergenic
1005765231 6:29004904-29004926 ACCTATAAGAAAACACTTGAAGG - Intronic
1008205088 6:48645589-48645611 TCTTATAAGAAGGAACATCAGGG - Intergenic
1008279884 6:49584361-49584383 CCTTATAAGAAGAGACAATTAGG - Intergenic
1008890634 6:56485712-56485734 ATTTTTATGAAGAAACATGAAGG - Intronic
1009643330 6:66364839-66364861 ATTTATGAGAAGAGACAAAAAGG - Intergenic
1009907033 6:69883056-69883078 ACATTTAAGCAGAGGCATGAAGG + Intronic
1010320185 6:74497934-74497956 ACTTATAAAAACAGATATCAAGG - Intergenic
1010367113 6:75063852-75063874 ACTAATAAGATGAGACATTTGGG + Intergenic
1010611333 6:77957330-77957352 ACATTTGAGAAGAGACTTGAAGG + Intergenic
1011487706 6:87860174-87860196 CCTTATAATAAGAGACACCAGGG - Intergenic
1011489491 6:87875631-87875653 AGTTATCAGAAGAGGCAGGAGGG - Intergenic
1012020325 6:93909743-93909765 CATTTTAAGAAGAGACAAGATGG - Intergenic
1012291596 6:97462230-97462252 ACTAAAAACAAGAGAGATGAAGG - Intergenic
1012346180 6:98189780-98189802 ATTACTAAGAAGAGACATCAGGG - Intergenic
1013532322 6:111031352-111031374 AATTATAAGAAGAATCATGTAGG + Intergenic
1013906101 6:115222062-115222084 TCTTATAAAAAGTGACTTGAGGG + Intergenic
1013943314 6:115692153-115692175 ACTTTCAAGATGAGACTTGATGG + Intergenic
1015231282 6:130917544-130917566 ACTAATAAGAGGAAACATCAGGG - Intronic
1016177017 6:141092250-141092272 ATTAATAAGAGGAAACATGAGGG - Intergenic
1017525658 6:155239664-155239686 ACATAGATGAAGAGACAAGAAGG - Intronic
1017645221 6:156533970-156533992 CCTTATAAGAAGAGAAACCAGGG - Intergenic
1019236359 6:170618480-170618502 ACATTTAAGAATAGACTTGAAGG + Intergenic
1019954604 7:4403478-4403500 CCTTATAAGAAGAGACATCAGGG - Intergenic
1020587619 7:10089117-10089139 ATTACTAAGAAGAGACATCAAGG + Intergenic
1021255110 7:18382695-18382717 AATTATTAGAAATGACATGAAGG + Intronic
1021434353 7:20597498-20597520 AGTGATGAGAATAGACATGATGG + Intergenic
1022656993 7:32328682-32328704 ACTTGTAAGTTGAGACCTGAAGG - Intergenic
1023134633 7:37038875-37038897 CCTTATCAGAAGAGACACCAGGG - Intronic
1024097468 7:45994551-45994573 AATAATGAGATGAGACATGAGGG - Intergenic
1024670494 7:51589548-51589570 CCTTATAAGAAGAGACATGAGGG + Intergenic
1025707617 7:63881939-63881961 CCTTATTAGAAGAGGCATTAAGG + Intergenic
1026082454 7:67234044-67234066 CTTTATAAGAAGAGACATCAGGG + Intronic
1026694614 7:72579949-72579971 TTTTGTAAGAAGAGACATCAGGG - Intronic
1027856780 7:83521770-83521792 CCTTATATGAAGAGACAGGAGGG - Intronic
1027879329 7:83813550-83813572 AGTTATAACAAGAGAAATTAGGG - Intergenic
1028538024 7:91910980-91911002 ACTTTTAAGTAAAGACCTGAAGG + Intergenic
1029090746 7:98046200-98046222 CCTTATAAGAAGAGGAATGAGGG + Intergenic
1029116293 7:98239170-98239192 ATGTATAAGAAGAGCCCTGATGG - Intronic
1029374268 7:100168475-100168497 ATTTATGGGAGGAGACATGAGGG - Intronic
1030472702 7:109986732-109986754 TCTTATAAGAAAAGACATCAGGG + Intergenic
1030734977 7:113037418-113037440 AGCTATAAGCAGAGACCTGAGGG + Intergenic
1030825908 7:114157640-114157662 ACTTGTAAGAAGAGGCACCAGGG + Intronic
1030833782 7:114257761-114257783 ATTTTTAAGCAGAGGCATGAAGG + Intronic
1031191685 7:118561088-118561110 ACTTATAAGAAGAGATACCAGGG + Intergenic
1031431831 7:121680986-121681008 ACTAAAAAGGAGAGACATTATGG + Intergenic
1032969413 7:137142654-137142676 CCTTATAAGAAAACACATGGGGG - Intergenic
1033433734 7:141313364-141313386 ACTTCCAAGGAGAGCCATGAGGG - Intronic
1034062361 7:148104624-148104646 AATTATATGAAGAGAGATGGAGG + Intronic
1034190161 7:149207633-149207655 ACTTATAGGAAGAGATCTCAGGG + Intronic
1035511414 8:188117-188139 ACATTTAAGAATAGACTTGAAGG - Intergenic
1035962100 8:4148670-4148692 CCTTACTAGAAGAGACACGAGGG - Intronic
1035987261 8:4448174-4448196 ACTTTTAAAAATAGACATTATGG - Intronic
1036608687 8:10330993-10331015 CCTTATACGAAGAGACACCAGGG + Intronic
1036759220 8:11495672-11495694 ACAGATCAGAGGAGACATGATGG + Intronic
1037341710 8:17852635-17852657 ACTTGTAAGACGAGACGAGATGG - Intergenic
1037396576 8:18449955-18449977 CCTTTTAAGAAGAGACACCAGGG - Intergenic
1038656551 8:29457839-29457861 ACTTGTAACAAGAGACACCATGG + Intergenic
1039117301 8:34105986-34106008 ACATATAAGCAGAAATATGAAGG + Intergenic
1039321520 8:36437018-36437040 ACTTTTAAGAAGGGAAATGAGGG + Intergenic
1040452323 8:47560486-47560508 ACTTATAAGCAGAAACTGGAAGG - Intronic
1040586590 8:48749197-48749219 ACATATAAGAAGTGAGAAGAGGG + Intergenic
1041194636 8:55388594-55388616 CCTTATACAAAGAGACATGAGGG - Intronic
1041195298 8:55396016-55396038 CCTTATAAAAAGAGACAGGAGGG - Intronic
1041882708 8:62770549-62770571 CCTCATAAGAAGAGACATGAGGG - Intronic
1041959032 8:63590726-63590748 ACTCAAAAGATCAGACATGAAGG - Intergenic
1042468252 8:69153382-69153404 ACTTATAAGAAAAGATATTTTGG - Intergenic
1042471524 8:69194903-69194925 AGAGATAAAAAGAGACATGAAGG - Intergenic
1043804791 8:84658182-84658204 ATTTATAAGTAGAGAAATGTGGG - Intronic
1043952185 8:86321619-86321641 ATTTGTAAGAACAGACATGTTGG - Intergenic
1044194808 8:89362412-89362434 AATGAAAAGAAGACACATGAAGG + Intergenic
1044254376 8:90043312-90043334 ACTTATAATCAGAGACATGTGGG - Intronic
1044348217 8:91131568-91131590 ACATATAACAAAAGACATGAGGG - Intronic
1044475477 8:92620226-92620248 ACTTATAATAATAAACATGATGG - Intergenic
1044739849 8:95314974-95314996 TCTTATAAGAAGAGACATCGGGG - Intergenic
1045947708 8:107815067-107815089 ATATATAAGAAGAGACATTATGG - Intergenic
1046279370 8:112005444-112005466 ATTTTTAAGAACAGACATGCAGG + Intergenic
1046519238 8:115303049-115303071 CCTTATAATAAGAGACACCAGGG + Intergenic
1047604770 8:126464301-126464323 ACTTATAATCAGAGAAATAAAGG - Intergenic
1047768889 8:128014442-128014464 AATTATGAGAAGAGAAGTGAAGG + Intergenic
1050262586 9:3856195-3856217 AATTATAAAAGGAAACATGAGGG + Intronic
1050444160 9:5701030-5701052 AATTTTGAGAAGAAACATGAAGG - Intronic
1051389260 9:16546225-16546247 ACTCAAAGGTAGAGACATGAAGG + Intronic
1051866334 9:21687377-21687399 ACATTTAATAAAAGACATGAAGG + Intergenic
1052457384 9:28717707-28717729 ACTAGTAAGAAGAGACAGGAGGG - Intergenic
1052519839 9:29532292-29532314 ACATATAAGTAGAGAGAGGAAGG - Intergenic
1053186254 9:36019111-36019133 TCTTGTAAGAAGAAAGATGAGGG - Intergenic
1054884002 9:70175882-70175904 ACTTACAAGAAGATACATATCGG - Intronic
1054887665 9:70216446-70216468 CCTTATAAGAAGAGACAGCAGGG - Intronic
1054894988 9:70299586-70299608 ACTTCTAAGAAGAGATATTTAGG + Intronic
1055243516 9:74214386-74214408 AAATATAAGAAGAGACAAAAAGG - Intergenic
1056330016 9:85513289-85513311 ATTTATATGAAGATACATGGGGG - Intergenic
1056488037 9:87078490-87078512 TCTTATATGAAGAGACAAGAGGG + Intergenic
1057551175 9:96051771-96051793 CCTTATAAGAAGAGAGAGGAGGG + Intergenic
1057938711 9:99261912-99261934 AGTTCTAATAAGAGGCATGAAGG + Intergenic
1058946970 9:109866317-109866339 ACTTATTAGATAAGACATAATGG - Intronic
1059472322 9:114515052-114515074 ACTTATAAGAAGAGAAAATTTGG - Intergenic
1059895522 9:118860043-118860065 ACAGCTAAAAAGAGACATGAGGG + Intergenic
1060523251 9:124306247-124306269 ACTCACAAGCAGAGACATAAAGG - Intronic
1061313478 9:129779087-129779109 CCTTATAAAAAGAGACACCAGGG - Intergenic
1062508389 9:136890370-136890392 ACGTATCATAAGAGACGTGAGGG - Intronic
1062756507 9:138298502-138298524 ACATTTAAGAATAGACTTGAAGG + Intergenic
1203458880 Un_GL000220v1:15198-15220 CCTTATTAGAAGAGGCAGGAAGG - Intergenic
1185713316 X:2321533-2321555 CCTTGTAAGAAGAGACACCAGGG + Intronic
1185872358 X:3674530-3674552 TCTTATAAGAAGAGACACACAGG + Intronic
1185936258 X:4260786-4260808 CCTTATAAGAAGAGACACAGGGG - Intergenic
1186307233 X:8275347-8275369 AATTATAAGAAAACACATGGTGG - Intergenic
1186682193 X:11886878-11886900 ACATGTAAGCAGAGACATGTGGG - Intergenic
1187220837 X:17324353-17324375 ATTACTAAGAAGAGACATCAAGG - Intergenic
1188189104 X:27152409-27152431 CCATATAAGAAGAGACACCAGGG - Intergenic
1188360780 X:29250562-29250584 ACATTTAGGAAGAGACCTGAAGG - Intronic
1188411592 X:29878739-29878761 ACTTCTAAGAAATGGCATGAAGG + Intronic
1188531437 X:31145609-31145631 AATTGTAAGAAGAGGAATGAAGG - Intronic
1189882973 X:45511181-45511203 ACTAAGTAGAAGAGATATGAGGG + Intergenic
1190243165 X:48673539-48673561 CCTTATAAGAAGAGACGTGATGG - Intergenic
1192186179 X:68948260-68948282 AGTTACAAGAGGAGACATAAAGG + Intergenic
1192577221 X:72252690-72252712 TCTTATAAGAAAAGACCTGGAGG - Intronic
1192670070 X:73130596-73130618 ATTACTAAGAAGAGACATAAAGG - Intergenic
1193013117 X:76699950-76699972 AACTATAAGAAGAGACAGGAAGG + Intergenic
1193194594 X:78617030-78617052 AACTATAAGAAGAGACAAAAAGG - Intergenic
1193596184 X:83448906-83448928 AACTATAAGAAGAGACAAAAAGG - Intergenic
1193650609 X:84126230-84126252 AATTATAAGAAGGGAAATGGAGG + Intronic
1193771374 X:85592042-85592064 AGTTATAAGGAGAGCCTTGAGGG - Intergenic
1194011460 X:88567420-88567442 AGTTATAAGAAAAGAGGTGAGGG - Intergenic
1195356775 X:104046823-104046845 ACATATAAAAAGACACATCATGG + Intergenic
1195558546 X:106255978-106256000 AAGTATAAGAAGAGACAAAACGG - Intergenic
1197307899 X:124865895-124865917 AACTATAAGAAGAGAAAAGAAGG + Intronic
1197670011 X:129266289-129266311 ACATAGAGGAAGTGACATGAAGG + Intergenic
1197673677 X:129307318-129307340 ACATATAAGCTGAGACTTGAAGG + Intergenic
1197777899 X:130131796-130131818 ACTCCTAAGAAGAGAGAAGAGGG + Exonic
1197786940 X:130207814-130207836 ACTTACAAGAAGAGGCACAAGGG - Intronic
1198208791 X:134496638-134496660 ATTTATTGGAAGAGTCATGAGGG + Intronic
1199124528 X:144100306-144100328 AATTTTAAGAAGAGAGATGGTGG + Intergenic
1200791548 Y:7304151-7304173 TCTTATAAGAAGAGACACACAGG - Intergenic
1201223418 Y:11792680-11792702 CCTTATAAGGAGAGACAGCAAGG + Intergenic
1201406439 Y:13654639-13654661 ACCTATAAGGAGAGAGATGTGGG - Intergenic
1201451732 Y:14122957-14122979 ACATATAAAAAATGACATGAAGG + Intergenic
1201720611 Y:17093013-17093035 CCTTATAAGAAGAGACACAGGGG - Intergenic
1202383631 Y:24301511-24301533 ACATTTAAGAATAGACTTGAAGG + Intergenic
1202487152 Y:25368609-25368631 ACATTTAAGAATAGACTTGAAGG - Intergenic