ID: 1115143396

View in Genome Browser
Species Human (GRCh38)
Location 14:30199360-30199382
Sequence AGTTATCTCCAGAAGATAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115143396_1115143399 4 Left 1115143396 14:30199360-30199382 CCTGTTATCTTCTGGAGATAACT No data
Right 1115143399 14:30199387-30199409 TTCTTTTGAGAGGCAACTCTTGG No data
1115143396_1115143400 15 Left 1115143396 14:30199360-30199382 CCTGTTATCTTCTGGAGATAACT No data
Right 1115143400 14:30199398-30199420 GGCAACTCTTGGCCTGCTACTGG No data
1115143396_1115143401 16 Left 1115143396 14:30199360-30199382 CCTGTTATCTTCTGGAGATAACT No data
Right 1115143401 14:30199399-30199421 GCAACTCTTGGCCTGCTACTGGG No data
1115143396_1115143397 -6 Left 1115143396 14:30199360-30199382 CCTGTTATCTTCTGGAGATAACT No data
Right 1115143397 14:30199377-30199399 ATAACTCCTCTTCTTTTGAGAGG No data
1115143396_1115143402 22 Left 1115143396 14:30199360-30199382 CCTGTTATCTTCTGGAGATAACT No data
Right 1115143402 14:30199405-30199427 CTTGGCCTGCTACTGGGCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115143396 Original CRISPR AGTTATCTCCAGAAGATAAC AGG (reversed) Intergenic
No off target data available for this crispr