ID: 1115151661

View in Genome Browser
Species Human (GRCh38)
Location 14:30293263-30293285
Sequence TGGCGAACAGCAGTGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115151661_1115151664 -9 Left 1115151661 14:30293263-30293285 CCTTCCACCACTGCTGTTCGCCA No data
Right 1115151664 14:30293277-30293299 TGTTCGCCACTGTCACAGACAGG No data
1115151661_1115151666 23 Left 1115151661 14:30293263-30293285 CCTTCCACCACTGCTGTTCGCCA No data
Right 1115151666 14:30293309-30293331 TCCACCCCTCCAGATCCAGCAGG 0: 15
1: 48
2: 81
3: 158
4: 318
1115151661_1115151668 24 Left 1115151661 14:30293263-30293285 CCTTCCACCACTGCTGTTCGCCA No data
Right 1115151668 14:30293310-30293332 CCACCCCTCCAGATCCAGCAGGG 0: 16
1: 50
2: 105
3: 152
4: 348

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115151661 Original CRISPR TGGCGAACAGCAGTGGTGGA AGG (reversed) Intergenic
No off target data available for this crispr