ID: 1115154540

View in Genome Browser
Species Human (GRCh38)
Location 14:30323052-30323074
Sequence CAGAGGAAGGAGAGGCAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115154540_1115154548 10 Left 1115154540 14:30323052-30323074 CCTGCCTGCCTCTCCTTCCTCTG No data
Right 1115154548 14:30323085-30323107 CCCACGCAAGCAGGCTAGTATGG No data
1115154540_1115154546 1 Left 1115154540 14:30323052-30323074 CCTGCCTGCCTCTCCTTCCTCTG No data
Right 1115154546 14:30323076-30323098 CAAGCAGGTCCCACGCAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115154540 Original CRISPR CAGAGGAAGGAGAGGCAGGC AGG (reversed) Intergenic
No off target data available for this crispr