ID: 1115155191

View in Genome Browser
Species Human (GRCh38)
Location 14:30331079-30331101
Sequence CTGAATATACAAATGGACAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115155189_1115155191 24 Left 1115155189 14:30331032-30331054 CCTCTCACAATGTGAACTTTCAT No data
Right 1115155191 14:30331079-30331101 CTGAATATACAAATGGACAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115155191 Original CRISPR CTGAATATACAAATGGACAG TGG Intergenic
No off target data available for this crispr