ID: 1115157518

View in Genome Browser
Species Human (GRCh38)
Location 14:30357865-30357887
Sequence GGATGTTCACCACTTTGTAG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115157516_1115157518 -4 Left 1115157516 14:30357846-30357868 CCCTGGATGATGAAGCGCAGGAT No data
Right 1115157518 14:30357865-30357887 GGATGTTCACCACTTTGTAGCGG No data
1115157508_1115157518 30 Left 1115157508 14:30357812-30357834 CCTCTCTCCCTCCTCCTACTTTG No data
Right 1115157518 14:30357865-30357887 GGATGTTCACCACTTTGTAGCGG No data
1115157517_1115157518 -5 Left 1115157517 14:30357847-30357869 CCTGGATGATGAAGCGCAGGATG No data
Right 1115157518 14:30357865-30357887 GGATGTTCACCACTTTGTAGCGG No data
1115157513_1115157518 16 Left 1115157513 14:30357826-30357848 CCTACTTTGGAACAATTTCTCCC No data
Right 1115157518 14:30357865-30357887 GGATGTTCACCACTTTGTAGCGG No data
1115157512_1115157518 19 Left 1115157512 14:30357823-30357845 CCTCCTACTTTGGAACAATTTCT No data
Right 1115157518 14:30357865-30357887 GGATGTTCACCACTTTGTAGCGG No data
1115157510_1115157518 23 Left 1115157510 14:30357819-30357841 CCCTCCTCCTACTTTGGAACAAT No data
Right 1115157518 14:30357865-30357887 GGATGTTCACCACTTTGTAGCGG No data
1115157511_1115157518 22 Left 1115157511 14:30357820-30357842 CCTCCTCCTACTTTGGAACAATT No data
Right 1115157518 14:30357865-30357887 GGATGTTCACCACTTTGTAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115157518 Original CRISPR GGATGTTCACCACTTTGTAG CGG Intergenic
No off target data available for this crispr