ID: 1115157731

View in Genome Browser
Species Human (GRCh38)
Location 14:30359769-30359791
Sequence GACTCACGGTTCCACGTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 21420
Summary {0: 11, 1: 635, 2: 4748, 3: 7908, 4: 8118}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115157731 Original CRISPR GACTCACGGTTCCACGTGGC TGG Intergenic
Too many off-targets to display for this crispr