ID: 1115175668

View in Genome Browser
Species Human (GRCh38)
Location 14:30559106-30559128
Sequence GCGGTCGGCCCCGCCCTCGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 71
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 63}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115175668_1115175678 24 Left 1115175668 14:30559106-30559128 CCCTCGAGGGCGGGGCCGACCGC 0: 1
1: 0
2: 0
3: 7
4: 63
Right 1115175678 14:30559153-30559175 TGGACGAATTTGAATCCTGTGGG 0: 1
1: 0
2: 0
3: 3
4: 139
1115175668_1115175674 -2 Left 1115175668 14:30559106-30559128 CCCTCGAGGGCGGGGCCGACCGC 0: 1
1: 0
2: 0
3: 7
4: 63
Right 1115175674 14:30559127-30559149 GCTCTTTCCGGGTTTGCGAGCGG 0: 1
1: 0
2: 0
3: 2
4: 44
1115175668_1115175677 23 Left 1115175668 14:30559106-30559128 CCCTCGAGGGCGGGGCCGACCGC 0: 1
1: 0
2: 0
3: 7
4: 63
Right 1115175677 14:30559152-30559174 GTGGACGAATTTGAATCCTGTGG 0: 1
1: 0
2: 1
3: 27
4: 671
1115175668_1115175675 4 Left 1115175668 14:30559106-30559128 CCCTCGAGGGCGGGGCCGACCGC 0: 1
1: 0
2: 0
3: 7
4: 63
Right 1115175675 14:30559133-30559155 TCCGGGTTTGCGAGCGGAAGTGG 0: 1
1: 0
2: 0
3: 1
4: 42

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115175668 Original CRISPR GCGGTCGGCCCCGCCCTCGA GGG (reversed) Exonic
900094933 1:936428-936450 CCGGTCGGTCCCGCCTTCTAGGG + Intronic
904029979 1:27527877-27527899 GCCGTCGCCCTCGCCCTCGCCGG + Intergenic
914689192 1:150010537-150010559 CCGGCCGGCCCCTCCCCCGACGG + Exonic
1067560245 10:47300282-47300304 GCGGCCGGCTGCGCCCTCGAGGG - Intergenic
1071086616 10:81874500-81874522 GCGGTCTGACCCGCCTCCGAGGG - Intergenic
1075139390 10:119818156-119818178 GAGGTCGGCCCTGGCCACGATGG - Intronic
1100858176 12:98776758-98776780 ACTGTTGGCCCCGCCCTGGAGGG - Intronic
1105619499 13:22053225-22053247 GAGGACGGCCCCTCCCTCCAGGG + Intergenic
1107946032 13:45418383-45418405 TGGGTCTGCCCCGCCCGCGACGG - Intronic
1113981621 13:114281527-114281549 GCGGTCGGGGCCGCCCACGAAGG - Intergenic
1115175668 14:30559106-30559128 GCGGTCGGCCCCGCCCTCGAGGG - Exonic
1124999422 15:34754945-34754967 GCGCTCGGCCCTGGCCTCGCAGG - Exonic
1139484303 16:67247390-67247412 GCGGTCTTCCCCGCCCGCCATGG + Exonic
1139505106 16:67394708-67394730 GCTGTCGGCCCCGGCCCCGCGGG + Exonic
1140221564 16:73047983-73048005 GCGGTCGGCCCGTCCCCGGAGGG + Exonic
1143150838 17:4807079-4807101 GGGGGCCGCCCCGCCCCCGAGGG + Exonic
1145876067 17:28319124-28319146 GCGGTCTGCCTAGCCCTCGCGGG + Exonic
1146271321 17:31487832-31487854 GCGGCCGGCCCCGCCTCCGGAGG - Intronic
1152721952 17:81927645-81927667 GCGCTCGGCCCGGCCCGCGCAGG - Exonic
1152823781 17:82450742-82450764 GCGCGCGGCCCCGCCCCCGCCGG - Intronic
1152924418 17:83080638-83080660 GCGGTCGGCGCCGCTCTCGGCGG - Intronic
1157279191 18:46334487-46334509 GCGGCCGCCCCCACCCTCGGGGG - Intronic
1162118288 19:8445337-8445359 GGGGTTGGCCCCGGCCTGGAGGG - Intronic
1163311775 19:16519279-16519301 CCGGACGTCCCCGCCCTTGATGG + Exonic
1165928678 19:39342655-39342677 GCGGGCGGCCCCGCCCCCTCAGG + Intronic
1166219363 19:41354790-41354812 GCGGTCGGCCCCACTGTAGATGG + Exonic
1167461181 19:49625468-49625490 GTCCTCGGCGCCGCCCTCGATGG - Exonic
1168153418 19:54460810-54460832 GCAGGCGGCCTCGCCCTCGAAGG - Exonic
925125997 2:1456218-1456240 GCAGTCAGCCCCTCCCCCGAAGG - Exonic
927606742 2:24492107-24492129 TCCGTCGGCGCAGCCCTCGACGG + Exonic
932400652 2:71478933-71478955 GGGGTCGGCCCCGCCCTGCCAGG - Intronic
936512249 2:113157577-113157599 CCGGCCGTCGCCGCCCTCGACGG + Intronic
937183101 2:120013346-120013368 GCGGCCGGCCCCTCTCTCGTCGG + Intronic
937906940 2:127057037-127057059 GCCGCTGCCCCCGCCCTCGAGGG + Intronic
946865591 2:224039045-224039067 GCGGCCGGCGCTGCCCTCGGCGG - Intronic
1171217343 20:23362084-23362106 GCGGCCGGCCCCGCCCCTGGCGG - Intergenic
1172543538 20:35741693-35741715 GCGGCCGGCCCAGGCCTCGAAGG + Intronic
1173279922 20:41618662-41618684 GCGCTCGGCCCCGCCCCCCCGGG + Intergenic
1176380615 21:6110772-6110794 GCGGGCGGCCCCACCGCCGAGGG - Intergenic
1179742857 21:43427468-43427490 GCGGGCGGCCCCACCGCCGAGGG + Intergenic
1183201387 22:36387672-36387694 GCGTTCGCCCCCGCCCGCGCGGG + Intronic
1183509999 22:38229143-38229165 GCAGCAGGCCCCGCCCTCCAGGG + Intronic
1184758997 22:46534360-46534382 GCCGTCGTCCCCACCCTGGAAGG + Exonic
1184759377 22:46536334-46536356 GCGCTCCTCCTCGCCCTCGATGG + Exonic
1185388548 22:50547358-50547380 GCTGTCAGCCCCGGCCTCGCCGG - Intergenic
956179071 3:66500869-66500891 GCGGCCGGCCCCGCGCTGGGAGG + Exonic
962750939 3:138434529-138434551 GCGGGCGGCCCGCCCCTCTAGGG + Intergenic
968454253 4:689111-689133 TCCGTCGGCCCCGCCATCGTCGG + Exonic
968775488 4:2537138-2537160 GCGGGCGGCGCCGCCCCCGGAGG + Intronic
969303171 4:6309287-6309309 CCGGTCGGCGCCGCCCGCCACGG - Intergenic
985539769 5:482499-482521 GGTCTCGGCCCCGCCCGCGAGGG - Intronic
992769701 5:80035498-80035520 GCCGTCGCCCCCGGCCTCGCGGG + Exonic
1002052870 5:176581478-176581500 GCCATCGACCCCGCCCTGGAGGG + Exonic
1002139699 5:177131778-177131800 GCTGAGGGCACCGCCCTCGAGGG - Intergenic
1002664260 5:180810893-180810915 GCGGCCGGGCCCGCCGTCGCCGG + Intronic
1002929356 6:1622702-1622724 CCGGGCGGCCTCGCCCTCGATGG - Intergenic
1014460266 6:121686672-121686694 GCGGCCGGCCCCGCCCACCCTGG - Intergenic
1016034943 6:139375034-139375056 GCGATCTGCCCCGCTCTCTACGG + Intergenic
1019334188 7:475277-475299 GGGGACGGCCCCGCCCTGGCTGG + Intergenic
1020281797 7:6653595-6653617 GCGTTCGGGCCCGCCATCGGGGG + Exonic
1035289364 7:157827779-157827801 GCTGCCGGCCCCGCCCTCGCCGG + Intronic
1036801359 8:11794902-11794924 GCGGCCGGCCCCGCCGGCCAGGG + Intergenic
1048881918 8:138878186-138878208 GCGGTCGGGGCCCACCTCGAAGG + Exonic
1049812289 8:144580879-144580901 GCGGGCCGCCCGGCCCTCGCTGG + Exonic
1058045524 9:100353017-100353039 GCGGTAGGCCCCGCCCACAGAGG + Intergenic
1060778840 9:126396944-126396966 GCTGTCAGCTCCGCCCTGGAGGG + Intronic
1061043348 9:128151864-128151886 GGGGTCAGCCCTGCCCTGGATGG - Intronic
1061457880 9:130712602-130712624 GGGCTCGGCCCCGCCCTCCTGGG - Intergenic
1061781156 9:132996751-132996773 GAGGGCGGCCCGGCCCTGGATGG + Intergenic
1062680525 9:137776811-137776833 GGTGTCGGCCCTGCCCTCCAGGG - Exonic
1200155386 X:153972224-153972246 GCGCTCGGCCCCGCCCCCTTGGG + Intergenic