ID: 1115179115

View in Genome Browser
Species Human (GRCh38)
Location 14:30601694-30601716
Sequence GGCCCTGTGGACATTGCTAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 119}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115179109_1115179115 29 Left 1115179109 14:30601642-30601664 CCTTTAGTAAATCGATTGGGCGG 0: 1
1: 0
2: 0
3: 0
4: 13
Right 1115179115 14:30601694-30601716 GGCCCTGTGGACATTGCTAGTGG 0: 1
1: 0
2: 1
3: 7
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115179115 Original CRISPR GGCCCTGTGGACATTGCTAG TGG Intronic
900180801 1:1310165-1310187 GGCCCTCGGGACAGTGCTGGGGG - Intronic
900803974 1:4755431-4755453 GGCTCTGTTGACACTGCCAGTGG + Intronic
905010899 1:34746500-34746522 GGCCCTGGTGACATGGCCAGTGG + Intronic
905709884 1:40092905-40092927 GACCCCTTGGACATTGCTGGTGG + Intronic
905961946 1:42050312-42050334 AGCTCTGTGGATCTTGCTAGAGG - Intergenic
907456215 1:54577772-54577794 GGACCTGTGTACATTACTGGTGG - Intronic
915534867 1:156529243-156529265 GGCCCTGAGGACATGCCTTGAGG - Intronic
917855919 1:179099610-179099632 GGCACTGTGTGCATTGCTAAGGG - Exonic
923447565 1:234086848-234086870 TGCTCTGTGGACACAGCTAGGGG - Intronic
924490704 1:244535170-244535192 GCCCCTGTGGACACTGCCACTGG + Intronic
1063164583 10:3448736-3448758 AAACCTGTGTACATTGCTAGTGG - Intergenic
1064395443 10:14978164-14978186 TTCCCTGTGGATATTGCGAGTGG - Intronic
1067401523 10:45978666-45978688 GGACCTCTGTACATTGCTGGTGG + Intronic
1067869874 10:49948246-49948268 GGACCTCTGTACATTGCTGGTGG + Intronic
1072057661 10:91776401-91776423 TGCCAGGTGGAGATTGCTAGGGG - Intergenic
1075451080 10:122552442-122552464 GGACCTGTGGCCCTAGCTAGAGG + Intergenic
1075539266 10:123298804-123298826 GGCCCTGATTACATAGCTAGCGG + Intergenic
1076427762 10:130379725-130379747 GGCCCTGTATACATTTCTTGTGG + Intergenic
1077222756 11:1424753-1424775 GGCCCTGTGGAGCCTGCTGGGGG + Intronic
1077300406 11:1844086-1844108 GGCCCTGTGGAAATTCCGAGGGG + Intergenic
1077376811 11:2209117-2209139 GGCCCGGTGGACAGTGCAGGTGG + Intergenic
1077380877 11:2236831-2236853 GGCCCTGTGGACAGGGGTGGAGG - Intergenic
1081916297 11:46732948-46732970 TGGCGTGTGCACATTGCTAGTGG + Intronic
1084499148 11:69524671-69524693 GGCCCTGAGGACACAGCTATCGG + Intergenic
1091921086 12:4305521-4305543 GTCATTGTTGACATTGCTAGGGG + Intergenic
1093996549 12:25649094-25649116 GGCACTGTGCTCAGTGCTAGGGG + Intergenic
1097829379 12:64207600-64207622 TGCACTTTGGACATTGCTACTGG + Intronic
1102212981 12:111140293-111140315 GGTCCTGTGGCCATTGATGGGGG + Intronic
1103916895 12:124380430-124380452 GGCCCTGTGGGCACTGGCAGGGG - Intronic
1105680047 13:22716903-22716925 GGTCATGCAGACATTGCTAGTGG + Intergenic
1107166605 13:37289400-37289422 GGCTCTTTGCACATTGCTGGCGG + Intergenic
1108418759 13:50227797-50227819 GGGCCTGTGGAAACTGCTGGTGG + Intronic
1115179115 14:30601694-30601716 GGCCCTGTGGACATTGCTAGTGG + Intronic
1122663995 14:103316342-103316364 GGCCCTGGGGACAGTGCTCTGGG - Intergenic
1122940964 14:104981200-104981222 GGCCCAGTGGACACAGCTAGGGG - Intergenic
1124239775 15:28019712-28019734 AGCCCTGAGGACATTGCTGTGGG + Intronic
1124612060 15:31215714-31215736 GGCCTTGGGGACATCGCTCGGGG + Intergenic
1126320896 15:47421830-47421852 CACACTATGGACATTGCTAGAGG - Intronic
1128620526 15:69145620-69145642 GGCCCTGTGGATATTGATGAAGG - Intergenic
1129876537 15:78979125-78979147 GCCCCTGTGGACTGTGCTTGTGG - Intronic
1131721264 15:95171100-95171122 GGCCCTGTGCACACTGCTGGAGG + Intergenic
1132590518 16:724449-724471 GGCCCTCCGGACATTCCTGGAGG - Exonic
1132975285 16:2708024-2708046 AGCCCTGTGGGCATTTCCAGAGG - Exonic
1138280436 16:55768751-55768773 GAACCTGTGGCCATTCCTAGAGG - Intergenic
1138513451 16:57522088-57522110 AGCCCACTGGACATTGCTCGGGG + Intronic
1139551705 16:67676824-67676846 AGCCCTGAGGAGAGTGCTAGAGG + Intronic
1140476496 16:75241822-75241844 GGCCCTGTGGACTTGGGAAGCGG + Intronic
1144637252 17:16918208-16918230 GGCCCTGAGAACATTGCAAGTGG + Intergenic
1145752793 17:27367377-27367399 GGCCCTGCAGGCCTTGCTAGTGG - Intergenic
1151973625 17:77471770-77471792 GCCACTGTGGACATGGCTGGAGG + Intronic
1152405515 17:80095945-80095967 GGCCCAGTGGACATGGCCTGGGG - Intronic
1152569736 17:81116413-81116435 GGCCCTTGTGACATTGCCAGTGG - Exonic
1155110802 18:22712516-22712538 GGCCCTGTGGGCCTTGGTGGTGG - Intergenic
1159031582 18:63237541-63237563 GGCACTGAGGATATTGCTAAGGG - Intronic
1160682863 19:419884-419906 GGCCCTGTGCACATTTCACGTGG + Intronic
1160695788 19:483673-483695 GGCCCTGTGGACATCCCAGGTGG - Intergenic
1160802546 19:977025-977047 GGCCCTGTGGACCTTGCGGTTGG - Intergenic
1161216620 19:3097797-3097819 GGCCCTGTGCACATTGGTCCGGG + Intronic
1161993842 19:7700466-7700488 TGCCCTGGGGACATTGGCAGAGG - Intronic
1161993975 19:7701290-7701312 GGCCCTTTTGACATTGTGAGAGG + Intronic
1163491633 19:17620316-17620338 GGCCATCTGGTCATTCCTAGAGG + Intronic
925806011 2:7648840-7648862 GGCACTGTGCACATTGTTGGTGG + Intergenic
929392735 2:41489982-41490004 TGCCATGTGGACCTTTCTAGAGG + Intergenic
929607323 2:43243407-43243429 GGCACTGTGGACATTAATTGGGG - Intronic
932775193 2:74524304-74524326 GAACCTGTTGACATTGGTAGTGG + Exonic
932894219 2:75623081-75623103 AGCACTGTGGACATGGCCAGAGG + Intergenic
937240344 2:120456801-120456823 GGCCCCTTGGCCTTTGCTAGAGG - Intergenic
941234588 2:162954489-162954511 GGCCATGTGTACATTGATTGGGG + Intergenic
943848823 2:192689337-192689359 GGCACTGTGCTCATTGCTACTGG + Intergenic
1169265848 20:4167003-4167025 GGGCCAGGGGACATTGCTGGGGG + Intronic
1174521099 20:51131410-51131432 GGCCCTCTGGCCAGTGCTACTGG + Intergenic
1179639693 21:42739113-42739135 GGCCCACTGGACCCTGCTAGGGG - Intronic
1180161290 21:45999701-45999723 GGCTCTGTGAACATTGCTGGGGG + Intronic
950450301 3:13061548-13061570 GGCTCTGTGGACCTTGGTGGGGG - Intronic
950469088 3:13173577-13173599 GGCTCTGTGGACAATCCCAGAGG + Intergenic
953246736 3:41199890-41199912 GGCCCTGGGGGCATCGCTTGCGG + Intronic
954548229 3:51456816-51456838 GGTCTTGTGGAGTTTGCTAGAGG - Intronic
955554741 3:60124907-60124929 GCCCCTGAGGATCTTGCTAGGGG + Intronic
960145854 3:114201370-114201392 GGGCCTGGGGACAGTACTAGAGG - Intergenic
960972022 3:123146642-123146664 TGCCCTGTGGACATTACTGGAGG - Intronic
962235502 3:133703803-133703825 GGCACTGAGTACAGTGCTAGTGG + Intergenic
971914678 4:32852056-32852078 TGCCATGTGGCCATTGCTGGGGG + Intergenic
975343325 4:73265666-73265688 GGGCCTGTGGACCATGCTAAGGG + Intergenic
978419184 4:108511861-108511883 GGTCCTTTGAACTTTGCTAGGGG + Intergenic
979438804 4:120726704-120726726 GGCCCTTTGGAGATTGTTTGTGG - Intronic
982722870 4:158877392-158877414 GGACCTTGGGACATTGCTAAGGG - Intronic
984600264 4:181718754-181718776 GGCCCTCTGGACATTCCTGAAGG + Intergenic
984748326 4:183245674-183245696 GGCCCTGTGGAGATTGTTGCAGG + Intronic
984841301 4:184070137-184070159 TGCCCTGAGGACAGTGCTAAGGG - Intergenic
984988263 4:185352255-185352277 GGTCCTGTGCAATTTGCTAGAGG - Intronic
988491084 5:31706216-31706238 GGTCCTGTGTACATTGCTAGTGG + Intronic
991540958 5:67727681-67727703 AGCGCTGAGGACACTGCTAGTGG + Intergenic
994072375 5:95617518-95617540 GACCTTGTGGAAATTGCTTGGGG + Intergenic
994144119 5:96373571-96373593 AGCCCTGTGGACATTTCGATAGG + Intergenic
998008671 5:138675411-138675433 AGCAATGTGGCCATTGCTAGAGG - Intronic
1001866135 5:175107111-175107133 GGCCCTGTGGACATCACTATAGG - Intergenic
1003105519 6:3212023-3212045 AGACCTGTCAACATTGCTAGGGG + Intergenic
1006143589 6:31945351-31945373 GGCTCAGTGGCCATGGCTAGAGG - Exonic
1007790574 6:44306078-44306100 GGCACTGTGGACATGGGGAGAGG + Intronic
1007995498 6:46303487-46303509 GGCCTTGGAGACTTTGCTAGTGG + Intronic
1013188486 6:107782493-107782515 GGCACTGTGGAGATTGCACGTGG + Intronic
1017666980 6:156729332-156729354 GAACCTGTGTACATTGCTGGTGG - Intergenic
1018642322 6:165916086-165916108 GGCCGTGTTAACATTGCTATGGG + Intronic
1019647613 7:2139430-2139452 GGCCCTGGGGGCATGGCTGGGGG - Intronic
1022860880 7:34365292-34365314 GGTTCTGTGGAAATTCCTAGAGG - Intergenic
1022862282 7:34379969-34379991 GGCCATTTGAACATTTCTAGAGG - Intergenic
1028344808 7:89766378-89766400 GGCCCCTTGCACATTGCTGGTGG + Intergenic
1028934516 7:96450279-96450301 GGCCCTGTGTACAATCCTAATGG + Intergenic
1034126273 7:148674775-148674797 TGCCCTGTGGCCACTGCCAGGGG - Intergenic
1034265182 7:149777292-149777314 GGCCCTGGGGACAAAGCTGGTGG + Intergenic
1035226981 7:157439101-157439123 GGCACTGAGGACAGTGTTAGGGG + Intergenic
1036824267 8:11964033-11964055 AGCCCTGAGGACATTTCTATGGG - Intergenic
1039447710 8:37646070-37646092 GGCCATGAGGACAGTGCTGGAGG + Intergenic
1047971868 8:130091514-130091536 GGCCCTGTGGGCCTTGATATAGG + Intronic
1048986087 8:139735839-139735861 GTCCCTGTGAACACTGCTGGTGG + Intronic
1050217557 9:3344735-3344757 GGCTTTGTAGACACTGCTAGAGG - Intronic
1053333753 9:37243653-37243675 TGCACTGTGGACTATGCTAGAGG + Intronic
1053366182 9:37524100-37524122 GGCCGAGTGGACATCGCTTGTGG - Intronic
1055573272 9:77638627-77638649 GACCCTGTGTACATTCCGAGAGG + Intronic
1059967290 9:119627725-119627747 GGCCATGTGCACAGTCCTAGGGG - Intergenic
1060203126 9:121663763-121663785 GGCCCTGGGGACATAGAGAGAGG + Intronic
1061152873 9:128838730-128838752 GGCCCTGTGGCAAATGCTGGTGG - Intronic
1061183836 9:129040559-129040581 GGCCCTGAGGACTTTGCCTGGGG + Exonic
1185515343 X:695239-695261 AGCCCTGTGGCCATAGCTAATGG + Intergenic
1196216122 X:113053851-113053873 GGACCTTTGTACACTGCTAGTGG + Intergenic
1198269928 X:135047219-135047241 GGACCTGTGGCCTTTGATAGAGG - Intergenic
1198663299 X:138995119-138995141 TGCCATGTGACCATTGCTAGGGG - Intronic
1200140968 X:153902779-153902801 GGGCCTGGCCACATTGCTAGGGG + Intronic