ID: 1115179115

View in Genome Browser
Species Human (GRCh38)
Location 14:30601694-30601716
Sequence GGCCCTGTGGACATTGCTAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 119}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115179109_1115179115 29 Left 1115179109 14:30601642-30601664 CCTTTAGTAAATCGATTGGGCGG 0: 1
1: 0
2: 0
3: 0
4: 13
Right 1115179115 14:30601694-30601716 GGCCCTGTGGACATTGCTAGTGG 0: 1
1: 0
2: 1
3: 7
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115179115 Original CRISPR GGCCCTGTGGACATTGCTAG TGG Intronic