ID: 1115179413

View in Genome Browser
Species Human (GRCh38)
Location 14:30605055-30605077
Sequence CTGAAAATACAAAATAAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 47428
Summary {0: 3, 1: 353, 2: 9351, 3: 22909, 4: 14812}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115179413_1115179419 11 Left 1115179413 14:30605055-30605077 CCCAGCTTATTTTGTATTTTCAG 0: 3
1: 353
2: 9351
3: 22909
4: 14812
Right 1115179419 14:30605089-30605111 TTTCTCCCTGTGGGTCACACTGG 0: 1
1: 0
2: 39
3: 1168
4: 23401
1115179413_1115179417 1 Left 1115179413 14:30605055-30605077 CCCAGCTTATTTTGTATTTTCAG 0: 3
1: 353
2: 9351
3: 22909
4: 14812
Right 1115179417 14:30605079-30605101 AGAGACAGGGTTTCTCCCTGTGG 0: 1
1: 45
2: 405
3: 1106
4: 2417
1115179413_1115179418 2 Left 1115179413 14:30605055-30605077 CCCAGCTTATTTTGTATTTTCAG 0: 3
1: 353
2: 9351
3: 22909
4: 14812
Right 1115179418 14:30605080-30605102 GAGACAGGGTTTCTCCCTGTGGG 0: 46
1: 5983
2: 51005
3: 107740
4: 139526

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115179413 Original CRISPR CTGAAAATACAAAATAAGCT GGG (reversed) Intronic
Too many off-targets to display for this crispr