ID: 1115188544

View in Genome Browser
Species Human (GRCh38)
Location 14:30720900-30720922
Sequence ACCATGCATAAACTACATTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 86}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115188544 Original CRISPR ACCATGCATAAACTACATTA AGG (reversed) Intronic
904065887 1:27750488-27750510 ACCCTGCAAAAACTACTTCAAGG + Intronic
911026699 1:93443800-93443822 ACCAAGCTAAAACTACCTTAAGG - Intergenic
912933953 1:113986654-113986676 ACCACACATAAAGTACACTAAGG + Intergenic
919301669 1:195776777-195776799 ACAATGCAATAAGTACATTATGG - Intergenic
919364899 1:196646999-196647021 ACCATGCAGAAACGTTATTAAGG + Intergenic
919377459 1:196812387-196812409 ACCATTCATAAATTACTTTCAGG + Intergenic
921061840 1:211591838-211591860 ACCATACATAAGCTATAATAAGG - Intergenic
1063057278 10:2519593-2519615 ACAATGCATACAATACATCAGGG - Intergenic
1063630507 10:7729334-7729356 ACCATGATTAAACCAAATTATGG - Intronic
1063894468 10:10665344-10665366 AATATGCATAAAGTATATTATGG + Intergenic
1068978833 10:63039254-63039276 ACCATGCAAACACTAATTTAAGG + Intergenic
1081018375 11:37910668-37910690 AACATGAATAAAATACATTTAGG + Intergenic
1085285921 11:75360854-75360876 ACCATATAAAAACTGCATTAAGG + Intergenic
1086174436 11:83873055-83873077 ACAATTCATAAACCACATTCAGG - Intronic
1086957740 11:92950964-92950986 ACCATGCTGACATTACATTATGG - Intergenic
1090956610 11:131518515-131518537 AGCATGCTTCAGCTACATTATGG - Intronic
1093925350 12:24903382-24903404 ACCTCGGAGAAACTACATTAGGG + Intronic
1100412903 12:94340179-94340201 GCCATGCAAAAAATAAATTAAGG + Intronic
1108302415 13:49091857-49091879 GCCATGCATAAACCACTTTATGG + Intronic
1108423958 13:50279079-50279101 ACCTTGTATAACCTACATTCTGG + Intronic
1109292316 13:60491540-60491562 ACAATGCAGAAAATACATTATGG + Intronic
1109525716 13:63572087-63572109 ATAAAGCATAAACTGCATTAAGG + Intergenic
1111163743 13:84429829-84429851 ACAATGCATAAAATACATTCAGG + Intergenic
1115188544 14:30720900-30720922 ACCATGCATAAACTACATTAAGG - Intronic
1115501738 14:34055942-34055964 ACCATGTATACACTATTTTATGG - Intronic
1121402398 14:93691437-93691459 CCCATCCCTAAACTAGATTAGGG - Intronic
1125144843 15:36455106-36455128 TCCATTCATAAACTACATAGTGG + Intergenic
1126335327 15:47581224-47581246 AACATGCAAAAACTTCATCAGGG - Intronic
1128040074 15:64564135-64564157 AACATGCATATACTAGATAAAGG - Intronic
1129446470 15:75622407-75622429 AACTTCCATAAAGTACATTAGGG + Intronic
1136653699 16:31695977-31695999 ACCCAGCCCAAACTACATTAAGG - Intergenic
1137478686 16:48832977-48832999 AGCATGCAGAAAATACATTGGGG - Intergenic
1153441906 18:5129601-5129623 ACACTGCATAAACAAAATTAAGG + Intergenic
1153687488 18:7560959-7560981 ACCATGCACAAACTCCATGCTGG - Intergenic
1155703164 18:28775012-28775034 ATCATTCATAAACTTCATCATGG - Intergenic
1157061587 18:44297356-44297378 ACCATGCTTATACCAGATTATGG - Intergenic
1158321950 18:56273259-56273281 GTGATGCATAAAGTACATTAGGG - Intergenic
1159778671 18:72635205-72635227 ACAGTGAATAAACTGCATTAGGG - Intronic
1159998598 18:74993327-74993349 ACTATGGATGCACTACATTATGG + Intronic
926656266 2:15410359-15410381 AGCAAGAATAAACTACTTTAAGG + Intronic
930645282 2:53899865-53899887 ACCATTCATCAATTACCTTAGGG + Exonic
933293183 2:80460507-80460529 ACCTTGCATATAGTACATAAAGG - Intronic
936347253 2:111684504-111684526 ACCAGGCACAAATTACTTTAAGG + Intergenic
941005614 2:160244119-160244141 ACCAAGCATACACAACATGAGGG + Intronic
942376698 2:175344869-175344891 ACCATACATAGTCTACACTAGGG + Intergenic
944614369 2:201445136-201445158 AGCATGAATAAACCACAATACGG + Intronic
945034699 2:205694657-205694679 ACCATGTATAAAGTTCATTGTGG + Intronic
1174943435 20:54957742-54957764 ACACTTCATAAACTACAGTATGG - Intergenic
1178973267 21:37199941-37199963 ACCATACCTAAAGTACAGTATGG - Intronic
949693939 3:6672250-6672272 ACACTTCATTAACTACATTATGG + Intergenic
950985470 3:17359754-17359776 ACCATACATAAATTACCATATGG + Intronic
956251977 3:67244050-67244072 ATCATGTATAAATAACATTAGGG - Intergenic
959363902 3:105431682-105431704 ACCATGCATTAACTATACAAAGG + Intronic
960444456 3:117730626-117730648 ACTATGCATAAGCTTCATGAAGG - Intergenic
960660040 3:120047700-120047722 ACCAAGTTTAAACTCCATTAGGG + Intronic
963749346 3:149159586-149159608 ACTATGTATAAAATACATGAGGG - Intronic
964537001 3:157733653-157733675 ATCATGCATAGCTTACATTAAGG - Intergenic
968159164 3:196411018-196411040 AGCATGCATGAACTAGATGAGGG - Intronic
971934095 4:33124865-33124887 ACCATGCATACAATAAAATAAGG + Intergenic
972536962 4:40007854-40007876 ACCATCCATTAACTACAAAATGG - Intergenic
975993007 4:80280136-80280158 ACCATGCATGAGCTAGATCAAGG + Intronic
976554297 4:86432642-86432664 TCCATGCAGGAACTTCATTAGGG + Intronic
979787720 4:124737307-124737329 ACATTGTATTAACTACATTATGG - Intergenic
980602322 4:135040854-135040876 CCCATGCATAACCTCCATGATGG - Intergenic
982621536 4:157713433-157713455 ACCATGCACAGCCTACATTATGG - Intergenic
983166671 4:164486256-164486278 ACAATGCAATAACAACATTAAGG - Intergenic
983197972 4:164828799-164828821 ACCATGAATAAAATAAATTATGG + Intergenic
986515011 5:8552013-8552035 CCCAAGCATAACCTACTTTAAGG - Intergenic
986982361 5:13463669-13463691 ACACTGTATAGACTACATTAAGG - Intergenic
992519151 5:77531703-77531725 ACCATGTATAGACCACATTTAGG - Intronic
995146761 5:108795870-108795892 TCCATACACAAACTAAATTAAGG - Intronic
1005413967 6:25581991-25582013 CACATGGGTAAACTACATTAAGG - Intronic
1008872252 6:56286134-56286156 ACCTTGCATAAACTGTATCATGG - Intronic
1009327165 6:62366022-62366044 ACCAGGCATACACTAAATTTTGG + Intergenic
1010508717 6:76691230-76691252 AGCATGCAGAAATTATATTAGGG + Intergenic
1011072241 6:83398597-83398619 ACCAAGTATAAAGTACATTTAGG + Intronic
1011321523 6:86098982-86099004 ACCATGGATATATTACATAATGG + Intergenic
1012838839 6:104303838-104303860 ACCATTCTTAAACCAAATTAAGG + Intergenic
1019846032 7:3502573-3502595 ATCATGCTTTAAATACATTAGGG - Intronic
1020286621 7:6686716-6686738 AGCATGCATAATCGACATGAAGG - Intergenic
1020552789 7:9627868-9627890 AGCATGAATAAACTTTATTAGGG + Intergenic
1021586505 7:22214481-22214503 ACAAAGCATAAACTACATTTCGG + Intronic
1022692453 7:32670165-32670187 ACAATGCATAAAATAAAGTAAGG + Intergenic
1023601849 7:41888234-41888256 ACCAAGAGTAAACTACAATATGG + Intergenic
1024781436 7:52855307-52855329 ACCATGCATCATCTACTTAAAGG + Intergenic
1032846532 7:135756283-135756305 ACCATGCACAAACCACAGTAGGG + Intergenic
1035881675 8:3249778-3249800 TCCATGTCTAAACTTCATTAGGG + Intronic
1044911033 8:97059032-97059054 ACCCTGCATAAATGACACTACGG - Intronic
1050406047 9:5309603-5309625 ATCAAGCATCAACTACATGATGG + Intergenic
1050641655 9:7674777-7674799 AGAATGCATAAAATACATTATGG + Intergenic
1059718919 9:116939843-116939865 ACCATGGACAAAATACATGATGG + Intronic
1191090207 X:56612170-56612192 ACGATGCATAGTTTACATTAGGG - Intergenic
1198514007 X:137386010-137386032 TCCATGCATAATCTAGATTCAGG - Intergenic
1199232790 X:145458275-145458297 ACCATGCATGAACTAGGTTGAGG + Intergenic
1200976232 Y:9214871-9214893 ACCATTCAGAAACTTCATGAGGG - Intergenic