ID: 1115194291

View in Genome Browser
Species Human (GRCh38)
Location 14:30779228-30779250
Sequence TAGAAACCTGAAAATGGACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115194291_1115194294 20 Left 1115194291 14:30779228-30779250 CCTTGTCCATTTTCAGGTTTCTA No data
Right 1115194294 14:30779271-30779293 CTCTCCTTTTATCTACACCAGGG No data
1115194291_1115194293 19 Left 1115194291 14:30779228-30779250 CCTTGTCCATTTTCAGGTTTCTA No data
Right 1115194293 14:30779270-30779292 TCTCTCCTTTTATCTACACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115194291 Original CRISPR TAGAAACCTGAAAATGGACA AGG (reversed) Intergenic
No off target data available for this crispr