ID: 1115197533

View in Genome Browser
Species Human (GRCh38)
Location 14:30817463-30817485
Sequence CAATCGCAACAGCCTTCCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115197531_1115197533 4 Left 1115197531 14:30817436-30817458 CCTAAATCTGTGCTACTACTACA No data
Right 1115197533 14:30817463-30817485 CAATCGCAACAGCCTTCCCCTGG No data
1115197530_1115197533 5 Left 1115197530 14:30817435-30817457 CCCTAAATCTGTGCTACTACTAC No data
Right 1115197533 14:30817463-30817485 CAATCGCAACAGCCTTCCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115197533 Original CRISPR CAATCGCAACAGCCTTCCCC TGG Intergenic
No off target data available for this crispr