ID: 1115199899

View in Genome Browser
Species Human (GRCh38)
Location 14:30841652-30841674
Sequence GTGTACATTAAGAAGCTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115199899_1115199902 -1 Left 1115199899 14:30841652-30841674 CCACCCAGCTTCTTAATGTACAC No data
Right 1115199902 14:30841674-30841696 CTTTCTAACAAAAGCTTTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115199899 Original CRISPR GTGTACATTAAGAAGCTGGG TGG (reversed) Intergenic
No off target data available for this crispr