ID: 1115203024

View in Genome Browser
Species Human (GRCh38)
Location 14:30874281-30874303
Sequence TGGAGGGCCGGCGGCCCCGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115203024_1115203036 22 Left 1115203024 14:30874281-30874303 CCGTCGGGGCCGCCGGCCCTCCA No data
Right 1115203036 14:30874326-30874348 GGGACCTTCGTGCCCCTCTAGGG No data
1115203024_1115203038 27 Left 1115203024 14:30874281-30874303 CCGTCGGGGCCGCCGGCCCTCCA No data
Right 1115203038 14:30874331-30874353 CTTCGTGCCCCTCTAGGGACTGG No data
1115203024_1115203029 -5 Left 1115203024 14:30874281-30874303 CCGTCGGGGCCGCCGGCCCTCCA No data
Right 1115203029 14:30874299-30874321 CTCCACACTCGTTGAGACGCCGG No data
1115203024_1115203033 2 Left 1115203024 14:30874281-30874303 CCGTCGGGGCCGCCGGCCCTCCA No data
Right 1115203033 14:30874306-30874328 CTCGTTGAGACGCCGGCACGGGG No data
1115203024_1115203031 0 Left 1115203024 14:30874281-30874303 CCGTCGGGGCCGCCGGCCCTCCA No data
Right 1115203031 14:30874304-30874326 CACTCGTTGAGACGCCGGCACGG No data
1115203024_1115203032 1 Left 1115203024 14:30874281-30874303 CCGTCGGGGCCGCCGGCCCTCCA No data
Right 1115203032 14:30874305-30874327 ACTCGTTGAGACGCCGGCACGGG No data
1115203024_1115203035 21 Left 1115203024 14:30874281-30874303 CCGTCGGGGCCGCCGGCCCTCCA No data
Right 1115203035 14:30874325-30874347 GGGGACCTTCGTGCCCCTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115203024 Original CRISPR TGGAGGGCCGGCGGCCCCGA CGG (reversed) Intergenic