ID: 1115203029

View in Genome Browser
Species Human (GRCh38)
Location 14:30874299-30874321
Sequence CTCCACACTCGTTGAGACGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115203024_1115203029 -5 Left 1115203024 14:30874281-30874303 CCGTCGGGGCCGCCGGCCCTCCA No data
Right 1115203029 14:30874299-30874321 CTCCACACTCGTTGAGACGCCGG No data
1115203016_1115203029 30 Left 1115203016 14:30874246-30874268 CCGGCAGAGCAGGGCTGGCGAGG No data
Right 1115203029 14:30874299-30874321 CTCCACACTCGTTGAGACGCCGG No data
1115203023_1115203029 -2 Left 1115203023 14:30874278-30874300 CCGCCGTCGGGGCCGCCGGCCCT No data
Right 1115203029 14:30874299-30874321 CTCCACACTCGTTGAGACGCCGG No data
1115203021_1115203029 7 Left 1115203021 14:30874269-30874291 CCGCTGCTGCCGCCGTCGGGGCC No data
Right 1115203029 14:30874299-30874321 CTCCACACTCGTTGAGACGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115203029 Original CRISPR CTCCACACTCGTTGAGACGC CGG Intergenic