ID: 1115203033

View in Genome Browser
Species Human (GRCh38)
Location 14:30874306-30874328
Sequence CTCGTTGAGACGCCGGCACG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115203024_1115203033 2 Left 1115203024 14:30874281-30874303 CCGTCGGGGCCGCCGGCCCTCCA No data
Right 1115203033 14:30874306-30874328 CTCGTTGAGACGCCGGCACGGGG No data
1115203026_1115203033 -10 Left 1115203026 14:30874293-30874315 CCGGCCCTCCACACTCGTTGAGA No data
Right 1115203033 14:30874306-30874328 CTCGTTGAGACGCCGGCACGGGG No data
1115203023_1115203033 5 Left 1115203023 14:30874278-30874300 CCGCCGTCGGGGCCGCCGGCCCT No data
Right 1115203033 14:30874306-30874328 CTCGTTGAGACGCCGGCACGGGG No data
1115203021_1115203033 14 Left 1115203021 14:30874269-30874291 CCGCTGCTGCCGCCGTCGGGGCC No data
Right 1115203033 14:30874306-30874328 CTCGTTGAGACGCCGGCACGGGG No data
1115203025_1115203033 -7 Left 1115203025 14:30874290-30874312 CCGCCGGCCCTCCACACTCGTTG No data
Right 1115203033 14:30874306-30874328 CTCGTTGAGACGCCGGCACGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115203033 Original CRISPR CTCGTTGAGACGCCGGCACG GGG Intergenic