ID: 1115203036

View in Genome Browser
Species Human (GRCh38)
Location 14:30874326-30874348
Sequence GGGACCTTCGTGCCCCTCTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115203028_1115203036 5 Left 1115203028 14:30874298-30874320 CCTCCACACTCGTTGAGACGCCG No data
Right 1115203036 14:30874326-30874348 GGGACCTTCGTGCCCCTCTAGGG No data
1115203025_1115203036 13 Left 1115203025 14:30874290-30874312 CCGCCGGCCCTCCACACTCGTTG No data
Right 1115203036 14:30874326-30874348 GGGACCTTCGTGCCCCTCTAGGG No data
1115203026_1115203036 10 Left 1115203026 14:30874293-30874315 CCGGCCCTCCACACTCGTTGAGA No data
Right 1115203036 14:30874326-30874348 GGGACCTTCGTGCCCCTCTAGGG No data
1115203027_1115203036 6 Left 1115203027 14:30874297-30874319 CCCTCCACACTCGTTGAGACGCC No data
Right 1115203036 14:30874326-30874348 GGGACCTTCGTGCCCCTCTAGGG No data
1115203023_1115203036 25 Left 1115203023 14:30874278-30874300 CCGCCGTCGGGGCCGCCGGCCCT No data
Right 1115203036 14:30874326-30874348 GGGACCTTCGTGCCCCTCTAGGG No data
1115203030_1115203036 2 Left 1115203030 14:30874301-30874323 CCACACTCGTTGAGACGCCGGCA No data
Right 1115203036 14:30874326-30874348 GGGACCTTCGTGCCCCTCTAGGG No data
1115203024_1115203036 22 Left 1115203024 14:30874281-30874303 CCGTCGGGGCCGCCGGCCCTCCA No data
Right 1115203036 14:30874326-30874348 GGGACCTTCGTGCCCCTCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115203036 Original CRISPR GGGACCTTCGTGCCCCTCTA GGG Intergenic