ID: 1115203038

View in Genome Browser
Species Human (GRCh38)
Location 14:30874331-30874353
Sequence CTTCGTGCCCCTCTAGGGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115203025_1115203038 18 Left 1115203025 14:30874290-30874312 CCGCCGGCCCTCCACACTCGTTG No data
Right 1115203038 14:30874331-30874353 CTTCGTGCCCCTCTAGGGACTGG No data
1115203028_1115203038 10 Left 1115203028 14:30874298-30874320 CCTCCACACTCGTTGAGACGCCG No data
Right 1115203038 14:30874331-30874353 CTTCGTGCCCCTCTAGGGACTGG No data
1115203026_1115203038 15 Left 1115203026 14:30874293-30874315 CCGGCCCTCCACACTCGTTGAGA No data
Right 1115203038 14:30874331-30874353 CTTCGTGCCCCTCTAGGGACTGG No data
1115203023_1115203038 30 Left 1115203023 14:30874278-30874300 CCGCCGTCGGGGCCGCCGGCCCT No data
Right 1115203038 14:30874331-30874353 CTTCGTGCCCCTCTAGGGACTGG No data
1115203030_1115203038 7 Left 1115203030 14:30874301-30874323 CCACACTCGTTGAGACGCCGGCA No data
Right 1115203038 14:30874331-30874353 CTTCGTGCCCCTCTAGGGACTGG No data
1115203024_1115203038 27 Left 1115203024 14:30874281-30874303 CCGTCGGGGCCGCCGGCCCTCCA No data
Right 1115203038 14:30874331-30874353 CTTCGTGCCCCTCTAGGGACTGG No data
1115203027_1115203038 11 Left 1115203027 14:30874297-30874319 CCCTCCACACTCGTTGAGACGCC No data
Right 1115203038 14:30874331-30874353 CTTCGTGCCCCTCTAGGGACTGG No data
1115203034_1115203038 -10 Left 1115203034 14:30874318-30874340 CCGGCACGGGGACCTTCGTGCCC No data
Right 1115203038 14:30874331-30874353 CTTCGTGCCCCTCTAGGGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115203038 Original CRISPR CTTCGTGCCCCTCTAGGGAC TGG Intergenic