ID: 1115214764

View in Genome Browser
Species Human (GRCh38)
Location 14:31003499-31003521
Sequence TAGATTAATGCCTTCTATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 1, 1: 0, 2: 9, 3: 56, 4: 188}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115214757_1115214764 18 Left 1115214757 14:31003458-31003480 CCTAATGATATTTGGGTCATGGA 0: 1
1: 0
2: 1
3: 13
4: 135
Right 1115214764 14:31003499-31003521 TAGATTAATGCCTTCTATGGAGG 0: 1
1: 0
2: 9
3: 56
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115214764 Original CRISPR TAGATTAATGCCTTCTATGG AGG Intronic
900028331 1:350473-350495 TAGATTAATGTCCTCCATGGGGG + Intergenic
900132941 1:1097024-1097046 TAGACTATTGCCATCTCTGGTGG - Intronic
903002863 1:20278867-20278889 TAGATTAACGCCTTCTCTCCGGG - Intergenic
908499689 1:64730676-64730698 TAGATTAATGCCCTCCCTTGAGG - Intergenic
911296529 1:96124072-96124094 TTGATTAATTTCTTTTATGGTGG - Intergenic
913116129 1:115699034-115699056 TAGATGAATGCCCTCTCTGGAGG + Intergenic
913573230 1:120142449-120142471 TAGATTCCTGACTTCAATGGAGG - Intergenic
914294489 1:146307246-146307268 TAGATTCCTGACTTCAATGGAGG - Intergenic
914456719 1:147843396-147843418 TAGATTAATGCCCTCTGTGGGGG - Intergenic
914555533 1:148758029-148758051 TAGATTCCTGACTTCAATGGAGG - Intergenic
914731506 1:150374861-150374883 TAGATTTATTACTTCTTTGGGGG - Intronic
915884168 1:159705074-159705096 GAGATTAATGCCATCTATGTTGG - Intergenic
917658513 1:177153146-177153168 TAGATTAATGCCTTCCTTGGAGG + Intronic
918054220 1:181004737-181004759 TAAATTAATTCGATCTATGGAGG + Intronic
919352479 1:196475893-196475915 AACATTAATGGCTTCGATGGAGG - Intronic
920124564 1:203683332-203683354 CAGATTAATGTCCACTATGGAGG + Exonic
920998496 1:211017942-211017964 TATATTAATGTCCTCTCTGGGGG + Intronic
921912585 1:220566314-220566336 TAGGTTTATGCCTTAAATGGTGG - Intronic
922394307 1:225180608-225180630 TAGATTAATGCCTTCCCTCAGGG - Intronic
924294440 1:242570993-242571015 TAGATTAATGCCCTCCCTTGGGG - Intergenic
924956516 1:248933532-248933554 TAGATTAATGTCCTCCATGGGGG - Intergenic
1064335180 10:14433927-14433949 TAGATTAATGCCTTCCCTATAGG + Intronic
1065205275 10:23351507-23351529 TAGCTTGATTCCTTCTTTGGGGG + Intergenic
1065842261 10:29712303-29712325 TAGATTAATGCTCTTTCTGGGGG + Intronic
1065976865 10:30849391-30849413 TGCATTAAAGCCTTCTGTGGTGG + Exonic
1066206519 10:33194714-33194736 TAGATCAATGCCTTTTGTTGGGG + Intronic
1068427672 10:56888759-56888781 TAGATGAATGACTTACATGGTGG - Intergenic
1069138375 10:64793924-64793946 TAGATTAATCCCCTCCCTGGTGG + Intergenic
1070580733 10:77717214-77717236 TAGATTAATGCCCTCCCTGGGGG + Intergenic
1071344078 10:84674739-84674761 TAGATTAATGCCCTCCCTGGGGG - Intergenic
1071832590 10:89386552-89386574 TAGATTAATTCCATGAATGGAGG - Intronic
1072927497 10:99629147-99629169 TAGATTAATGCCCTCTGTGGGGG + Intergenic
1075608710 10:123834785-123834807 TAGAGTAATGCCCTCCTTGGTGG + Intronic
1076962317 10:133774419-133774441 TAGATTAATGTCCTCCATGGGGG - Intergenic
1077378904 11:2218889-2218911 TGGATTAATGCCCTCCCTGGAGG - Intergenic
1078806259 11:14708125-14708147 TAGATTAATGACTTCCATTGGGG + Intronic
1080401759 11:31942679-31942701 AAGTTTAGTGCCATCTATGGAGG + Intronic
1081123121 11:39290564-39290586 TATAGTAATGCCTTCCATGGGGG - Intergenic
1085506113 11:77060626-77060648 TAGATTAATGCCTTCCCTGGGGG + Intergenic
1086922888 11:92607153-92607175 TAGATTTAAGTCTTCTATGATGG + Intronic
1087225817 11:95596887-95596909 TACATTAGTGAGTTCTATGGTGG - Intergenic
1090040863 11:123290038-123290060 TAGATTAATGCCTTCCCTCAGGG - Intergenic
1091014406 11:132037157-132037179 TAGATTAATGCTTCCTCTTGGGG + Intronic
1091042281 11:132292929-132292951 TAAATTAATGCCTTCAGAGGTGG + Intronic
1091060551 11:132457508-132457530 GGGATTCCTGCCTTCTATGGAGG + Intronic
1094783305 12:33818145-33818167 TACATTAATGCCAGCAATGGTGG + Intergenic
1095201380 12:39388164-39388186 TAGATTAATACCCTCCATGGCGG + Intronic
1096257479 12:50072288-50072310 CAGATTAATGCTTTCTCTGCAGG - Intronic
1099126965 12:78773212-78773234 TAGATGATAGCCTTCTATGTTGG + Intergenic
1099359637 12:81683987-81684009 TAGATTAATGCCCTCCCTTGGGG - Intronic
1099457971 12:82887389-82887411 TGAATTATTCCCTTCTATGGGGG - Intronic
1100019311 12:90050287-90050309 TAGATTAATGCCATTCCTGGGGG + Intergenic
1102709814 12:114915973-114915995 AATATTAATACCTTCTGTGGAGG - Intergenic
1103287358 12:119813675-119813697 TAAATTAATGCCTTTTTTGGGGG - Intronic
1103391071 12:120573990-120574012 CAGATTAATGCCCTCCCTGGGGG - Intronic
1109422291 13:62129929-62129951 TAGACTAATGCCTGCTCTGGAGG - Intergenic
1109786388 13:67181116-67181138 TATGTTAATGCCTTTTATAGAGG - Intronic
1109819704 13:67637382-67637404 TAGATTAATTCCCTCCCTGGAGG + Intergenic
1109893569 13:68652387-68652409 AAGATTAAAGCCTTCTAGAGAGG - Intergenic
1110027546 13:70560295-70560317 TAGATTAATGCCTTCCAGAGTGG + Intergenic
1111677202 13:91401164-91401186 TATATGAATGCCTTTTTTGGGGG - Intronic
1112553518 13:100445186-100445208 TAGATTAATGCCCTCTTTGAGGG - Intronic
1113165815 13:107440838-107440860 TAGATTAAGGCCATCTCTGAAGG - Intronic
1114623985 14:24116522-24116544 TAGAATATTGTCTTCTGTGGTGG + Intronic
1115214764 14:31003499-31003521 TAGATTAATGCCTTCTATGGAGG + Intronic
1115809928 14:37095595-37095617 TATATAAATGCCTGGTATGGTGG + Intronic
1118038043 14:61889479-61889501 TCCATTAATGCCCTCTCTGGAGG + Intergenic
1119637666 14:76289954-76289976 TAGATTACTGCCTTCTAACGGGG - Intergenic
1120021528 14:79536513-79536535 TAGGTAAATGCATTCCATGGTGG + Intronic
1120428774 14:84387101-84387123 TAGATTAATGCCCTCTCTCGGGG + Intergenic
1122755864 14:103979567-103979589 TAGATTAATGCCCTCCCTTGGGG - Intronic
1124429336 15:29592748-29592770 TAGATTAATGCTGTCCCTGGTGG + Intergenic
1126831470 15:52611643-52611665 TAGATCAATTCCCTCTGTGGTGG + Exonic
1128364039 15:66984355-66984377 TAGATTAATGCCATCTTGTGAGG - Intergenic
1128946694 15:71828096-71828118 TAGATTCCTGACTTCCATGGAGG - Intronic
1130670108 15:85904465-85904487 TGGATAAATGCATTCTATGAGGG + Intergenic
1135885044 16:26298121-26298143 TAGATTAATGCACTCTCTTGGGG - Intergenic
1138264450 16:55650539-55650561 TGGATAAATGCATTCTTTGGTGG - Intergenic
1138786422 16:59851970-59851992 TAGATTAATGCCCTCCCTGGAGG + Intergenic
1140159817 16:72477405-72477427 TAGATTCATCCCTTCTCTGATGG + Intergenic
1140741973 16:77949536-77949558 TAGATTAATGCCCTCCCTGCAGG + Intronic
1140846537 16:78893995-78894017 TAGAGTAATGTCTTTTATTGAGG + Intronic
1142456430 16:90228310-90228332 TAGATTAATGTCCTCCATGGGGG - Intergenic
1144060570 17:11580445-11580467 TAGATTCAGGCTTTCTCTGGAGG + Intergenic
1145833035 17:27932783-27932805 TAGATTAATGCCTTCCCTGGAGG - Intergenic
1146759464 17:35464082-35464104 TAGATTAATGCCCTTTCTTGGGG - Intergenic
1147434830 17:40404380-40404402 GAGATCTATCCCTTCTATGGTGG - Exonic
1150450797 17:65266063-65266085 TAGATTAATGCCCTCCCTGGGGG + Intergenic
1152951431 17:83236085-83236107 TAGATTAATGTCCTCCATGGGGG - Intergenic
1153990029 18:10388385-10388407 GAAATTAATGACTTCTTTGGGGG + Intergenic
1154039715 18:10842392-10842414 TAGATTAATGCCCTCCATGAAGG + Intronic
1155338521 18:24790577-24790599 TAGATTAATGCTCTCCATGTGGG + Intergenic
1157390761 18:47301436-47301458 TAGAAAAATCTCTTCTATGGTGG - Intergenic
1157737981 18:50067574-50067596 TAGATTAATGCCCTCCAGGGTGG + Intronic
1159408952 18:68044166-68044188 CAGATTAAGGCATTCTATTGGGG - Intergenic
1159795167 18:72833760-72833782 AAAATTAATGCCTTCTTTGGGGG + Intronic
1165581872 19:36872402-36872424 CAGATTAATGCCCTCCCTGGGGG + Intronic
1166680357 19:44762427-44762449 TAGATTAATGTCCTCCCTGGCGG - Intergenic
1168727461 19:58595123-58595145 TAGATTAATGTCCTCCATGGGGG - Intergenic
925951053 2:8911586-8911608 TAGATGAATGCCTTCCCTGGGGG + Intronic
927816279 2:26220325-26220347 TAGAGTAAGGGCTACTATGGTGG + Intronic
928014434 2:27642065-27642087 AAGAGTAATGCTTTCTATGTAGG + Intronic
928929791 2:36612215-36612237 TAGATTAATTACTGCTATGGTGG - Intronic
928977630 2:37105326-37105348 TACATTAATGCCGTCCCTGGGGG + Exonic
930162847 2:48176004-48176026 TAGATTAATGCCCTCTCTGGAGG - Intergenic
930995934 2:57718018-57718040 TAGATTAATGCCTTCCCTCGGGG - Intergenic
931126760 2:59286593-59286615 GAGATGAGTGTCTTCTATGGTGG + Intergenic
931944672 2:67292392-67292414 TAGATAAATGTGTGCTATGGTGG - Intergenic
935553459 2:104482193-104482215 TAAATTGATGGCTTCTGTGGAGG - Intergenic
935750022 2:106223663-106223685 TGGATTAATGCCCTCCCTGGCGG - Intergenic
936042691 2:109161785-109161807 TAGATTAATGCCCTCCCTGGGGG - Intronic
936121188 2:109746761-109746783 TAGGTTAATGCCCTCCCTGGCGG + Intergenic
936223508 2:110624710-110624732 TAGATTAATGCCCTCCCTGGCGG - Intergenic
936571090 2:113616071-113616093 TAGATTAATGTCCTCCATGGGGG + Intergenic
936694231 2:114927988-114928010 TACCTTAATGCCTTCCCTGGTGG - Intronic
936820817 2:116518471-116518493 TAGATTAATGCCCTCCCTTGGGG + Intergenic
937398294 2:121558264-121558286 TAGATTAGTGGTTTCTATGAGGG - Intronic
937818776 2:126284690-126284712 TAGATTAATGCCTTTTCTCCAGG + Intergenic
939077556 2:137622039-137622061 TGGATTAATGCCCTCCCTGGGGG - Intronic
939335869 2:140827081-140827103 TAGATTGATGGCTTTTTTGGGGG - Intronic
939408186 2:141787666-141787688 TTGATAAATGCCTACTATTGTGG - Intronic
939638328 2:144609862-144609884 TACATAATTGCCTTCTAGGGTGG + Intergenic
939747374 2:145992557-145992579 TAGATTAATGCCCTCCTTGGGGG - Intergenic
939839839 2:147173594-147173616 TAGATTATTCCCTTCTCTAGGGG + Intergenic
940156094 2:150658809-150658831 TAGATTAATGCCCTCCCTGGGGG - Intergenic
940156342 2:150660835-150660857 TAGATTAATGTCCTCCCTGGAGG + Intergenic
940507446 2:154574256-154574278 TAGATTAAAGACTTCTTTGCTGG + Intergenic
942906311 2:181184801-181184823 TAGATAGATGCCTTCTATTTTGG - Intergenic
943203821 2:184864330-184864352 TAGATTAACACCCTCCATGGAGG - Intronic
945145420 2:206733231-206733253 TAGATTAATGCCCTCCCTTGGGG - Intergenic
945778374 2:214135605-214135627 TAGATTAATGCCTTCCCTGAGGG + Intronic
949087923 2:242173104-242173126 TAGATTAATGTCCTCCATGGGGG - Intergenic
1169224767 20:3849030-3849052 TACATTAAAGACTTCTCTGGTGG - Intronic
1169399057 20:5264340-5264362 CAGATTAATGCCCTCCCTGGGGG - Intergenic
1169751289 20:8997319-8997341 TAGATTAATGCCCTCCCTGGGGG + Intergenic
1170092970 20:12612840-12612862 TATATTAAAGCCCTTTATGGAGG - Intergenic
1170241161 20:14168055-14168077 TAGATTAATGTCCTCTCTGAAGG - Intronic
1172613618 20:36268909-36268931 TAGATTCAGCCCCTCTATGGAGG + Intronic
1173584084 20:44168897-44168919 TAGATTAATGCCCTCCCTTGGGG + Intronic
1173887884 20:46477774-46477796 TAGAATAATTCCCTCTAGGGTGG + Intergenic
1174994899 20:55555362-55555384 TTGCCAAATGCCTTCTATGGGGG - Intergenic
1177107140 21:16973635-16973657 CAGATTAATGCCCTCCCTGGGGG - Intergenic
1180262903 21:46686925-46686947 TAGATTAATGTCCTCCATGGGGG - Intergenic
1181405110 22:22678908-22678930 TAGATTAATGCCCTCACTTGGGG - Intergenic
1181408265 22:22700552-22700574 TAGATTAATGCCCTCACTTGGGG - Intergenic
1182905536 22:33932592-33932614 TTGATAAATGCCTTCTAAGAGGG + Intergenic
1185429103 22:50794799-50794821 TAGATTAATGTCCTCCATGGGGG - Intergenic
951383768 3:22019722-22019744 TAGATGTATGCCCTCTATGCAGG + Intronic
951991091 3:28676996-28677018 TAGATTTAGGCTTTTTATGGAGG + Intergenic
954528433 3:51295390-51295412 TAGATAAATGCCTTCCCTTGGGG - Intronic
955337974 3:58102855-58102877 TAGATAAATGCCATTTGTGGAGG + Intronic
955532287 3:59886659-59886681 TAGATTAATGACCTCTCTGTTGG - Intronic
955551321 3:60088191-60088213 TAGATTAATGCCTGCCTTTGGGG - Intronic
957079972 3:75628971-75628993 TAGATTAATGTCCTCCATGGGGG + Intergenic
957222407 3:77401059-77401081 TATGTTCATGGCTTCTATGGAGG - Intronic
958515282 3:95107548-95107570 TAGGTAAATGCATGCTATGGTGG + Intergenic
960164709 3:114388410-114388432 TACATAAATGCCTTGCATGGCGG + Intronic
961927487 3:130496407-130496429 TAGAATAATGCCTTATCTGAAGG - Intergenic
962303137 3:134261192-134261214 TAGATTGATGCCCTCCCTGGGGG - Intergenic
962492098 3:135904228-135904250 TAGATTAATGCCCTCCCTGGTGG - Intergenic
962712471 3:138099650-138099672 TAGATTAATGCCCTCCCTTGGGG + Intronic
963407083 3:144879721-144879743 TAGATTAAGGCCCTATCTGGGGG + Intergenic
964608518 3:158585194-158585216 TAGATTAATGCCCTCCCTGGAGG + Intronic
966620262 3:181955695-181955717 GTGGTTAATGACTTCTATGGTGG + Intergenic
966970380 3:185040106-185040128 TAGATTAGTGCCTTCCCTGAGGG - Intronic
967208139 3:187142615-187142637 TATATTAATGCCCTCTCTGGGGG - Intronic
970502437 4:16691682-16691704 TAGTTTCAGGCCTTCTTTGGGGG + Intronic
972878321 4:43393370-43393392 TAGATGAATGCCTTCCCTGAGGG - Intergenic
976958465 4:90935255-90935277 TAGATTAATGCCCACCCTGGGGG + Intronic
977437015 4:97011110-97011132 TAGATTAATGCACTCCAGGGTGG - Intergenic
977687445 4:99864365-99864387 TATATTAATAACTGCTATGGAGG - Intronic
978133112 4:105223696-105223718 GAGAATAATGCCATCTATGCAGG + Intronic
979804902 4:124959582-124959604 TAGCTTTAGGCCTTGTATGGAGG + Intergenic
981907807 4:149942761-149942783 TAGTTTAAGGACTTTTATGGAGG - Intergenic
982660425 4:158200167-158200189 TAGATTAATGCTCTCCCTGGGGG + Intergenic
983031256 4:162804686-162804708 TAGATTAAAGCCTGCTCTGAAGG + Intergenic
984502444 4:180573315-180573337 TAGATTAAGGCTTTTGATGGGGG - Intergenic
985149780 4:186934899-186934921 TAGATCAGTGCCTGCCATGGAGG + Intergenic
985465550 4:190191899-190191921 TAGATTAATGTCCTCCATGGGGG - Intergenic
985468048 5:16155-16177 TAGATTAATGTCCTCCATGGGGG + Intergenic
985878935 5:2622799-2622821 TAGAACAATGCCTGCTGTGGAGG - Intergenic
987975939 5:25015111-25015133 TAGGTTAATGTATTCCATGGTGG - Intergenic
988423298 5:31032813-31032835 TAGATTAATGCCCTTTCTGGGGG + Intergenic
988527793 5:32001619-32001641 TATATTAATGCACTCTAGGGTGG - Intronic
989189251 5:38654303-38654325 AAGATAAATGTCTTCTAAGGAGG - Intergenic
990048688 5:51468150-51468172 TAGACTAATGTCTTCTATTTTGG + Intergenic
990962142 5:61405246-61405268 TTGATTAATCCCATCTTTGGTGG - Intronic
993239374 5:85360838-85360860 TAGATTAATGTCTTTTATGATGG + Intergenic
993580149 5:89651619-89651641 TAGATTAATGCCCTCCCTTGGGG + Intergenic
994692556 5:103035705-103035727 CAGATTAATGCCCTCTTTTGGGG - Intergenic
996402429 5:123076716-123076738 TAGATTAATGCCCTCTCTGGAGG - Intergenic
997391248 5:133518915-133518937 TAATTTAATGCATTCCATGGGGG - Intronic
997406311 5:133650166-133650188 TAGATTAATGCCCTCTCTTGGGG - Intergenic
998277323 5:140769213-140769235 TAGATTAATACCTTCCCTGCTGG - Intergenic
999469934 5:151845148-151845170 TAGATTAATGCCTTCTCTTAGGG - Intronic
999516478 5:152307004-152307026 TAGATTAATGCCATTAATGTGGG - Intergenic
1001172355 5:169431970-169431992 TAGATTAAAGCTGGCTATGGTGG + Intergenic
1002745659 5:181469898-181469920 TAGATTAATGTCCTCCATGGGGG - Intergenic
1003478701 6:6511351-6511373 TGGATTAATGCCTTGGATGAAGG - Intergenic
1004756872 6:18619627-18619649 CAGATTAATGCCTTCCCTGAGGG + Intergenic
1004772129 6:18795884-18795906 TAGATTAATGCCCTCCCTTGCGG - Intergenic
1005290335 6:24373342-24373364 TTTATTAATCCGTTCTATGGTGG - Intergenic
1008777487 6:55058807-55058829 TAGATTAATGCCCTCCCTTGGGG + Intergenic
1011435499 6:87332367-87332389 TAGATTAATGCCCTCCCTGAGGG + Intronic
1012305185 6:97647152-97647174 TATATTAATCCCTTCCCTGGGGG - Intergenic
1014021397 6:116594167-116594189 TAGATTAATGCCTTCCTGTGGGG - Exonic
1014687133 6:124515548-124515570 TAGATTAATGCCCTTCCTGGGGG - Intronic
1015680248 6:135799504-135799526 TAGATTAATGCCTTCCCTGGGGG + Intergenic
1016500835 6:144719023-144719045 GATAATAATGTCTTCTATGGGGG + Intronic
1016613179 6:146016644-146016666 TACATTAATACCTTCTGTGAAGG - Intergenic
1016951625 6:149586362-149586384 CAGATTAATGCCCTCTCTGGAGG - Intronic
1017035004 6:150259222-150259244 TTGATTAATGTGTTCTGTGGAGG - Intergenic
1018938502 6:168290700-168290722 AAGAGTGATGCCATCTATGGAGG + Intergenic
1019250576 6:170743453-170743475 TAGATTAATGTCCTCCATGGGGG - Intergenic
1020881169 7:13764791-13764813 TAGATTAAGGTCCTCTTTGGAGG + Intergenic
1021246903 7:18274471-18274493 TAGATTAATGCCTTCTCTTGGGG - Intronic
1022512702 7:30950954-30950976 TAGATCAATGCCCTCCCTGGTGG + Intronic
1032985529 7:137333070-137333092 TAGATTAATGCCCTCCCTGGTGG + Intronic
1033104224 7:138505263-138505285 TAGAATAATGGTTTCTCTGGAGG - Intronic
1033858093 7:145589961-145589983 TATATTTATGACTTCTATGAAGG + Intergenic
1035513984 8:215851-215873 TACATTAATGTCCTCCATGGGGG + Intergenic
1036055644 8:5250751-5250773 TTGATTATTGACTTCTGTGGGGG + Intergenic
1037313717 8:17581586-17581608 GAGATTAATGCCTTCCCTTGGGG + Intronic
1038447889 8:27616381-27616403 TAGATTTATGCCTTCTGTTCCGG - Intergenic
1038464994 8:27753681-27753703 CAGATTAATGTCTTCTTTGGGGG - Intronic
1038659555 8:29485448-29485470 TATATTCATTCCTTTTATGGTGG + Intergenic
1039508446 8:38069660-38069682 TAGATAGATGCCATCTATGGAGG - Intergenic
1039830377 8:41208833-41208855 TAGATTAATGCCCTCCCTCGGGG - Intergenic
1040660026 8:49561981-49562003 TATATGAATGCCATATATGGGGG + Intergenic
1040769089 8:50951258-50951280 TAGATAAATGTGTTCCATGGTGG + Intergenic
1043652537 8:82614349-82614371 TAGATGAATACGTTCTCTGGAGG + Intergenic
1044036836 8:87315590-87315612 TAGATTAATGCCATCCTTCGGGG - Intronic
1045547748 8:103143082-103143104 TAAATCAAGGCCTTCTTTGGGGG + Intronic
1045594832 8:103641662-103641684 TAGATTAATGCCATTCTTGGGGG + Intronic
1045931540 8:107633035-107633057 TAGATTATTGCCTTCAGTGATGG + Intergenic
1047171719 8:122500243-122500265 GATATTAATGCCTACTATGTTGG + Intergenic
1047533864 8:125701399-125701421 TAGATTAATGCCCTCCCTCGAGG - Intergenic
1048025621 8:130584092-130584114 TAGATTAATGCTTCCCTTGGAGG - Intergenic
1048428330 8:134343209-134343231 TTGATAAATGCCTTCAATGTAGG - Intergenic
1052180362 9:25518918-25518940 TAGGTTAATGGTTTTTATGGTGG - Intergenic
1055369540 9:75582430-75582452 TAGATGAATGCCGTCCCTGGGGG + Intergenic
1055705772 9:79001048-79001070 TAAATTTATTCCTTTTATGGAGG + Intergenic
1056908069 9:90671787-90671809 TAGATTAATGCCCTCCCTGTGGG + Intergenic
1058231798 9:102435443-102435465 CAGATTAATGCCCTCTCTGGGGG + Intergenic
1203580131 Un_KI270745v1:36050-36072 TAGATTAATGTCCTCCATGGGGG - Intergenic
1187827739 X:23349280-23349302 TAGATTAATATCTACCATGGTGG - Intronic
1189560076 X:42183337-42183359 TAGATTAATGCCCTCCCTGGAGG - Intergenic
1189569550 X:42281271-42281293 TAGATTAATGCCTTTATTGTAGG + Intergenic
1190439937 X:50467477-50467499 TAGTTTCATGCTTGCTATGGAGG + Intronic
1191586510 X:62833226-62833248 TAGATTAATGCCTTCCCTCAGGG - Intergenic
1192124884 X:68492837-68492859 TAGATTAATACCCTCTCTTGGGG - Intergenic
1193272773 X:79548117-79548139 TTGTTTTTTGCCTTCTATGGTGG - Intergenic
1193942629 X:87694899-87694921 TAGGTTAATGCCCTCTTTTGGGG - Intergenic
1194044162 X:88981719-88981741 TACCTTAATGGCTTCTATGCAGG + Intergenic