ID: 1115217331

View in Genome Browser
Species Human (GRCh38)
Location 14:31026249-31026271
Sequence GGGTGGCCCCGCGCTGGCTG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 311
Summary {0: 1, 1: 0, 2: 5, 3: 20, 4: 285}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1115217324_1115217331 3 Left 1115217324 14:31026223-31026245 CCGACAGCTGGGGGAAGGGCCGG 0: 1
1: 0
2: 3
3: 28
4: 315
Right 1115217331 14:31026249-31026271 GGGTGGCCCCGCGCTGGCTGCGG 0: 1
1: 0
2: 5
3: 20
4: 285
1115217317_1115217331 23 Left 1115217317 14:31026203-31026225 CCGGGGCGCAGGGCGAGACGCCG 0: 1
1: 0
2: 4
3: 86
4: 538
Right 1115217331 14:31026249-31026271 GGGTGGCCCCGCGCTGGCTGCGG 0: 1
1: 0
2: 5
3: 20
4: 285
1115217314_1115217331 29 Left 1115217314 14:31026197-31026219 CCCCGGCCGGGGCGCAGGGCGAG 0: 1
1: 0
2: 4
3: 41
4: 242
Right 1115217331 14:31026249-31026271 GGGTGGCCCCGCGCTGGCTGCGG 0: 1
1: 0
2: 5
3: 20
4: 285
1115217315_1115217331 28 Left 1115217315 14:31026198-31026220 CCCGGCCGGGGCGCAGGGCGAGA 0: 1
1: 0
2: 3
3: 27
4: 594
Right 1115217331 14:31026249-31026271 GGGTGGCCCCGCGCTGGCTGCGG 0: 1
1: 0
2: 5
3: 20
4: 285
1115217316_1115217331 27 Left 1115217316 14:31026199-31026221 CCGGCCGGGGCGCAGGGCGAGAC 0: 1
1: 0
2: 13
3: 151
4: 1124
Right 1115217331 14:31026249-31026271 GGGTGGCCCCGCGCTGGCTGCGG 0: 1
1: 0
2: 5
3: 20
4: 285

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1115217331 Original CRISPR GGGTGGCCCCGCGCTGGCTG CGG Exonic
900091998 1:924650-924672 GGGCGGCCTCGTGCAGGCTGAGG - Intergenic
900399586 1:2467518-2467540 GGGTGCCCCTGCTCGGGCTGGGG + Intronic
900503698 1:3018790-3018812 AGGTGGCCCTGGGCGGGCTGGGG - Intergenic
900526006 1:3128981-3129003 GGGTGGCCCTGGGGAGGCTGGGG + Intronic
900586673 1:3435929-3435951 GGGTGGCCCCGCCGGGGCAGCGG + Exonic
900599257 1:3496129-3496151 GGCTGGCCCCACCCTGTCTGGGG - Intronic
901373062 1:8817235-8817257 GGGAGGCCGCGCGGAGGCTGCGG + Exonic
902878662 1:19356396-19356418 GGGAGGCCGGGTGCTGGCTGTGG - Intronic
903189601 1:21649323-21649345 GGGTGGCCCCTCGCTGGGCTGGG - Intronic
903822015 1:26110797-26110819 AAGTGACCCCGGGCTGGCTGTGG + Intergenic
904062989 1:27725932-27725954 GGGCGGACCCGGGCGGGCTGGGG - Intergenic
904783037 1:32964747-32964769 CGGCGGCCGGGCGCTGGCTGAGG - Intergenic
905891644 1:41521922-41521944 GGGTGGCCCTGTGGTGGCTGGGG - Intronic
907020342 1:51060576-51060598 GGGTGTCACAGCCCTGGCTGGGG - Intergenic
907294091 1:53438770-53438792 GCGTGGCGCCGCTGTGGCTGAGG - Intergenic
907502138 1:54888311-54888333 AGGTGGCCCTGAGCTGGCTTCGG - Intergenic
910258777 1:85276400-85276422 GCGCCGCCCCGCCCTGGCTGGGG + Exonic
914679236 1:149927560-149927582 GGGTGGCCGGGTGCTGGCTGAGG - Intronic
915325591 1:155079981-155080003 CGGTGGCCGGGTGCTGGCTGCGG + Intronic
920002060 1:202807435-202807457 GGGGCGGCCAGCGCTGGCTGGGG - Intronic
921761177 1:218916839-218916861 GGGTTTACCCTCGCTGGCTGAGG - Intergenic
922794773 1:228334631-228334653 GGGTGGCCATGGGCTGGCTCAGG + Intronic
923007997 1:230067358-230067380 GGGCGGCTCTGCGCTGGCCGGGG + Exonic
923171647 1:231422230-231422252 GGGCGGCCCGGCCCAGGCTGTGG + Exonic
923333951 1:232950783-232950805 GGGTGGGGGCGCGCGGGCTGCGG + Intronic
1065092929 10:22252777-22252799 GAGTGGCCCCGCGCAGGTGGAGG - Intergenic
1067167918 10:43879962-43879984 TGGAGGCTCCCCGCTGGCTGTGG - Intergenic
1069589991 10:69635625-69635647 GGGTGGCCCCGCAGAGGCAGTGG - Intergenic
1069870013 10:71527334-71527356 TGCTGGCCTCCCGCTGGCTGTGG - Intronic
1070326861 10:75395427-75395449 GGCTGCCCGCGCGCTGGCCGGGG + Intergenic
1071532633 10:86401186-86401208 GGGGGCGCCCGTGCTGGCTGGGG + Intergenic
1071819269 10:89264050-89264072 GGGTGGCACAGCCCTGGCTTGGG + Intronic
1072853743 10:98924903-98924925 GGGTGACCCCCCTCTGGCTAGGG + Intronic
1073302689 10:102480572-102480594 AGGTGGCCTCTGGCTGGCTGTGG - Exonic
1073325913 10:102643985-102644007 GGCTGGCCGGGCGCGGGCTGCGG - Intergenic
1073465611 10:103693124-103693146 GGGCGCCCTCGGGCTGGCTGCGG + Intronic
1073523246 10:104155050-104155072 AGGTGGCCCAGCCTTGGCTGGGG + Intronic
1075214345 10:120519163-120519185 GGGAGGCCCTGGGCTGGCAGGGG - Intronic
1075411472 10:122231683-122231705 GAGAGGCCCCTCGCTGGGTGTGG + Intronic
1075785704 10:125048639-125048661 GGGTGGCCCCTGGCTCCCTGGGG - Intronic
1076189198 10:128470755-128470777 GGGCTGCCAGGCGCTGGCTGCGG + Intergenic
1076528274 10:131126452-131126474 TGGTGGCCTCGTTCTGGCTGGGG + Intronic
1076647558 10:131963675-131963697 GGGTGTCAGCGCGCTGCCTGGGG - Intergenic
1076714071 10:132354476-132354498 GGGGGGCACCACCCTGGCTGGGG + Intronic
1076837562 10:133028748-133028770 GGGTGGCCATGCTCTAGCTGAGG + Intergenic
1077010276 11:376521-376543 GGGTGGCTCCGGGCTGGGCGGGG - Exonic
1077105822 11:842300-842322 GGGAGGCGCAGCGCTGCCTGAGG - Intronic
1077112221 11:866834-866856 GGGTGGCCACGTGCTGGCTGCGG + Exonic
1078091576 11:8267794-8267816 GGGAGGTGCCACGCTGGCTGGGG - Intronic
1082004060 11:47410101-47410123 GGATGTCCCTGCCCTGGCTGTGG + Exonic
1082076662 11:47980617-47980639 GGGTAGCCGCGCGCTGGGGGTGG + Exonic
1082997213 11:59263754-59263776 GGGAGGCCAGGCGCAGGCTGTGG - Intergenic
1083333138 11:61908280-61908302 GGGAGGCCCTGGTCTGGCTGGGG + Exonic
1083849530 11:65356777-65356799 GGATGGCACCTCGCTGGCCGAGG + Exonic
1084365241 11:68693281-68693303 GGGTGGCACCGCACATGCTGGGG - Intergenic
1084709351 11:70834472-70834494 GGCTTGGCCCCCGCTGGCTGAGG - Intronic
1084957504 11:72699139-72699161 GGGTGGGCCCGTGCTGGATGAGG - Intronic
1085311450 11:75519323-75519345 GGGTTGCCCGGCGCTGGGTGGGG - Intronic
1090385556 11:126355920-126355942 GGGAGGCGCGGCGCCGGCTGGGG - Intronic
1093629563 12:21392303-21392325 GGGTAACCCATCGCTGGCTGGGG + Intronic
1096192023 12:49625631-49625653 GGGTGGCCCCTCACTGGCCCAGG + Intronic
1096561299 12:52437760-52437782 TGGTGGCCCCGCCCTGGCCCTGG - Intergenic
1100260585 12:92929103-92929125 GAGTGGCCCCGCGCAGGGTCTGG - Exonic
1101131835 12:101697884-101697906 GGTCCGCGCCGCGCTGGCTGAGG + Exonic
1101284073 12:103291492-103291514 GGGTAGCCCTGCTCTGTCTGTGG - Intronic
1103066547 12:117903266-117903288 GGCTGGCCCACAGCTGGCTGTGG + Intronic
1103586443 12:121959718-121959740 AGGTGCCCCCTCGCTGTCTGTGG - Intronic
1105058870 12:133129981-133130003 GAGGGGTCCCGGGCTGGCTGCGG - Intronic
1105508616 13:21032829-21032851 GGGTGGACCACGGCTGGCTGGGG + Intronic
1105809210 13:23979751-23979773 GGGAGGTCCCGCCCTGGCCGAGG + Exonic
1105812103 13:24004585-24004607 GGGTGTCCTGGAGCTGGCTGTGG + Intronic
1108844239 13:54659073-54659095 GGGTGTCACCGCCCTGGCTCGGG + Intergenic
1111597372 13:90428463-90428485 GGGTTTCCCAGCCCTGGCTGGGG - Intergenic
1113994885 14:16057136-16057158 GCGTGGCCCCCGGCTGGCCGGGG - Intergenic
1114553924 14:23550886-23550908 CGGCGGCCCCCCGCCGGCTGTGG - Intronic
1115119886 14:29927213-29927235 GGGAGGCGCCGGGCTGGCAGCGG + Intronic
1115217331 14:31026249-31026271 GGGTGGCCCCGCGCTGGCTGCGG + Exonic
1117734099 14:58751817-58751839 GGGTGTCACAGCCCTGGCTGGGG - Intergenic
1117913823 14:60657199-60657221 GGCTGGCCCGGCGCTCTCTGGGG + Intronic
1121288809 14:92757832-92757854 GGGTGGTCCAGAGCTGCCTGGGG - Intergenic
1121533069 14:94672095-94672117 GGGTGGCCCAGCCCTAGCTGGGG - Intergenic
1122177142 14:99929216-99929238 GGTTGGCCCGGCCCTGGCTTAGG - Intronic
1122829604 14:104389353-104389375 GGCTGGCCATGTGCTGGCTGAGG - Intergenic
1122920416 14:104877677-104877699 GGGTGCCCCTGCCATGGCTGTGG + Intronic
1123405626 15:20018134-20018156 GGGAGGCCCCGTGGTGGCAGGGG - Intergenic
1123514956 15:21024782-21024804 GGGAGGCCCCGTGGTGGCAGGGG - Intergenic
1123943950 15:25229924-25229946 GGGTGGCCCCCAGCGGGATGCGG - Intergenic
1124169504 15:27360258-27360280 AGGTGGCCCCACTCTGCCTGAGG + Intronic
1125720701 15:41843833-41843855 GGGTGTCCCCGGGCTTGCTTGGG + Intronic
1127997666 15:64163032-64163054 GGGTGGGGCCGCGGTGGCTAGGG + Exonic
1130517019 15:84633535-84633557 GGGCGGCCCGGCCCAGGCTGCGG - Intergenic
1131839120 15:96417175-96417197 GGGTGGCCGCGCGCTGGGGGAGG - Intergenic
1132613089 16:827405-827427 GGGCGGCCCCTTGCAGGCTGTGG + Intergenic
1133278677 16:4652840-4652862 GGCTGGCACCGGCCTGGCTGGGG + Intronic
1135078292 16:19412656-19412678 GGGTGGGCTCGGGCTGGGTGCGG - Intronic
1135986876 16:27190364-27190386 GGGTGTCGCAGCTCTGGCTGAGG - Intergenic
1136518778 16:30783478-30783500 GGGTGGCCTGGTGCTGGATGAGG + Exonic
1136683719 16:31982230-31982252 GGGTGGCCTCTCACCGGCTGTGG + Intergenic
1136784348 16:32925786-32925808 GGGTGGCCTCTCACCGGCTGTGG + Intergenic
1136885437 16:33928020-33928042 GGGTGGCCTCTCACCGGCTGTGG - Intergenic
1139138609 16:64234125-64234147 GGGTGGCACAGCCCTGGCTCAGG - Intergenic
1139469423 16:67170401-67170423 CGGAGGCCGCGCGCTGGCTGGGG - Intronic
1139549790 16:67666889-67666911 TGGTGGCCCCGCGCTGACCCCGG - Exonic
1139705442 16:68737726-68737748 GGGTGGGCTCGCGCGGGCGGTGG + Intronic
1139754490 16:69132124-69132146 GGGTGGCCGAGCGCGGGCGGAGG - Intronic
1139949938 16:70663850-70663872 GGGTGCCCACGCACTGGGTGAGG - Exonic
1203087005 16_KI270728v1_random:1189792-1189814 GGGTGGCCTCTCACCGGCTGTGG + Intergenic
1203145534 16_KI270728v1_random:1795629-1795651 GGGTGGGGCCCCCCTGGCTGGGG + Intergenic
1145236897 17:21214577-21214599 GGGGGCCGCCGCGCTGTCTGCGG + Exonic
1146181525 17:30701326-30701348 GGGTGGCCCAGGGCTGGGGGAGG - Intergenic
1146654398 17:34626664-34626686 GGGTGGCGCAGCGGGGGCTGGGG - Intronic
1147144635 17:38477937-38477959 GGGTGGCCTCTCACCGGCTGTGG + Intronic
1147265487 17:39231946-39231968 AGGAGGCCCCACGCAGGCTGGGG + Intergenic
1147934709 17:44004990-44005012 GGCTGGCCCCGCACTGGTTCAGG - Exonic
1147943526 17:44066704-44066726 GCGTGGCCTGGCGCTGGTTGGGG + Exonic
1148467326 17:47872840-47872862 GGGAGGCTCCGGGCTGGCTGAGG - Intergenic
1150625195 17:66836779-66836801 AGGTGGCCCTGCTGTGGCTGGGG + Intronic
1151514317 17:74582350-74582372 GGATGGCCCAGCTCTGGCTGTGG + Intronic
1152153314 17:78616440-78616462 GGGTGGCCCTGCACTGCCAGTGG + Intergenic
1152262029 17:79272523-79272545 GCGTGGCCCCGCGTGGGCAGGGG - Intronic
1152552026 17:81034841-81034863 GGGAGGCGCGGCGCGGGCTGGGG - Intergenic
1152580052 17:81161901-81161923 GAGTGCCCCAGAGCTGGCTGGGG - Intronic
1152639114 17:81442389-81442411 GGGTGGCCCGGCGTAGGATGCGG - Exonic
1152713922 17:81889149-81889171 GGGTGGACCCACGCTGACTGTGG - Intronic
1152778388 17:82215776-82215798 GGGTGGCCGGGAGTTGGCTGAGG + Intergenic
1153900460 18:9614092-9614114 GGGCGGCCCCAGGCGGGCTGGGG - Intronic
1154086336 18:11309109-11309131 GGATGGCCCTGCTCTGTCTGTGG - Intergenic
1157388917 18:47284687-47284709 GGATGGCCCTGCTCTGTCTGTGG - Intergenic
1157856564 18:51110289-51110311 GGGTGCCCCCGCCCTGGCCAGGG + Intergenic
1158649796 18:59274335-59274357 AGATGGCCCAGAGCTGGCTGGGG + Intergenic
1160249089 18:77185698-77185720 GGCTGGCCCCGCCCTGGGTCCGG + Intergenic
1160325164 18:77939864-77939886 GGTTAGCCCCCAGCTGGCTGGGG + Intergenic
1160749613 19:727711-727733 GGGTGCCACCGGGCTGGGTGGGG + Intronic
1160832456 19:1110146-1110168 GGGTGACCCCAAGCAGGCTGTGG + Intronic
1160984006 19:1829074-1829096 GGGTGGGGCCGTGTTGGCTGAGG - Intronic
1161314918 19:3613295-3613317 GGGCGGCCCCGCGGAGGCCGAGG - Exonic
1161379706 19:3958607-3958629 GGGTGGCGCCGGGCTTGGTGGGG - Exonic
1161505221 19:4640051-4640073 GGGTGGGCCCGGGCTGGCCTAGG - Exonic
1161571107 19:5031271-5031293 GGGAGGCCCCGCGCAGTCAGAGG + Intronic
1161936077 19:7372922-7372944 GGGTCTCCCCAGGCTGGCTGTGG - Exonic
1162797965 19:13096336-13096358 CTGTGGCCCCGAGCTGGCGGAGG + Intronic
1163513937 19:17751705-17751727 GGGTGGCCCCATGCAGGCTTTGG - Intronic
1164733874 19:30526267-30526289 GGGTGGCTATGGGCTGGCTGTGG - Intronic
1166367172 19:42283827-42283849 GGTTGGCCCCGAGCCGGCCGGGG - Intronic
1166677475 19:44748622-44748644 GGGTGGCCCCGGGGGGGCCGGGG + Exonic
1166744629 19:45135329-45135351 GGCTGGCCCAGAGCTGGCTGTGG - Intronic
1166832153 19:45645347-45645369 GGGGGGGCCGGCGGTGGCTGTGG - Exonic
1167291874 19:48629152-48629174 TGGGGGCCCAGAGCTGGCTGGGG + Exonic
1168404162 19:56102319-56102341 CGCTGGCCCCACGCTGGCCGGGG - Intronic
925867755 2:8244031-8244053 GGCTGGCCCCGCCAGGGCTGTGG + Intergenic
926154738 2:10447796-10447818 CGGCGGCCGCGCGCTGGCCGGGG - Intronic
926341948 2:11910866-11910888 GGGTGACCCCTGGCTGGCTGGGG + Intergenic
928225050 2:29441387-29441409 GGCAGGGCCCGCCCTGGCTGGGG + Intronic
929587430 2:43125359-43125381 GGGTGGCCCCACTTTGGTTGGGG - Intergenic
932144607 2:69306774-69306796 GGGCGGCCCCGCGCTGAGGGTGG + Intergenic
934727988 2:96637619-96637641 GGGTGCCCACGCTCTAGCTGCGG - Intronic
934736888 2:96694132-96694154 GAGTTGGCCCCCGCTGGCTGGGG - Intergenic
935224052 2:101038118-101038140 AGGTGGTCCCGGGGTGGCTGGGG - Intronic
935359765 2:102237423-102237445 GGGTGGCTGCGGGCTGGCTGAGG - Intronic
941388050 2:164877507-164877529 GGGTGGCCCAGTGATTGCTGGGG + Intergenic
942241234 2:173965086-173965108 CAGCGGCCCCGGGCTGGCTGTGG + Intronic
944665481 2:201955731-201955753 CGGTGGCCCAGAGCTGGCAGTGG + Intergenic
944760255 2:202807425-202807447 GGGTGGTTCCCCTCTGGCTGGGG - Intronic
945879643 2:215312303-215312325 GGCGGGCCCCACGCAGGCTGCGG - Intronic
947054739 2:226087502-226087524 GGGTGGCACAGCCCTGGCTTGGG + Intergenic
947800641 2:232927319-232927341 GGGAGGGGCGGCGCTGGCTGCGG - Intronic
948482376 2:238258283-238258305 GTGTGGCCCTGGGCTGACTGTGG + Exonic
948739408 2:240033159-240033181 GGCTGGCCCCTGCCTGGCTGAGG + Intergenic
948781160 2:240322779-240322801 GGCTGGGCCCGCGATGGCTCAGG + Intergenic
1169023750 20:2349866-2349888 GGTTGTCCCTGCCCTGGCTGGGG - Intergenic
1169164086 20:3407619-3407641 GGGCGGCTCCACGCTAGCTGCGG + Exonic
1170569953 20:17627097-17627119 GGGTGCTCCCACCCTGGCTGAGG + Intronic
1172764958 20:37346289-37346311 GGGCTCCCCCGCGCTGGCCGGGG - Intronic
1173553345 20:43948613-43948635 GGGAGGCCCCGGGCCTGCTGGGG + Intronic
1173819029 20:46008986-46009008 GGGTGGACTGGCGCTGTCTGGGG - Exonic
1175333463 20:58179890-58179912 GGCTGGCCTGGCGCAGGCTGAGG + Intergenic
1175413103 20:58784470-58784492 GCATAGCCCCACGCTGGCTGGGG - Intergenic
1175490393 20:59376523-59376545 GGGTGGCCCCCCTGTGGCTCAGG - Intergenic
1175912328 20:62410838-62410860 GGGCTGCCCCGGGCTCGCTGTGG + Exonic
1175936975 20:62518421-62518443 GGGGGGCCCAGCCCTGGATGCGG - Intergenic
1176028163 20:62996796-62996818 GGGTGACCCCACCCTGGGTGAGG + Intergenic
1176270722 20:64234606-64234628 GGGTGACCCTGGGCTGGCCGTGG + Intronic
1176270731 20:64234630-64234652 GGGTGACCCTGGGCTGGCCGTGG + Intronic
1176270740 20:64234654-64234676 GGGTGACCCTGGGCTGGCTGTGG + Intronic
1176270787 20:64234817-64234839 GGGTGACCCCGAGCTGGCTGTGG + Intronic
1176270796 20:64234841-64234863 GGGTGACCCTGGGCTGGCCGTGG + Intronic
1176270829 20:64234937-64234959 GGGTGACCCTGGGATGGCTGTGG + Intronic
1176270837 20:64234961-64234983 GGGTGACCCTGGGATGGCTGTGG + Intronic
1176270845 20:64234985-64235007 GGGTGACACTGGGCTGGCTGTGG + Intronic
1176270939 20:64235292-64235314 GGGTGACCCCGAGCTGGCTGTGG + Intronic
1176270948 20:64235316-64235338 GGGTGACCCTGGGCTGGCCGTGG + Intronic
1176271036 20:64235599-64235621 GGGTGACCCCGAGCTGGCTGTGG + Intronic
1176271045 20:64235623-64235645 GGGTGACCCTGGGCTGGCCGTGG + Intronic
1176271077 20:64235719-64235741 GGGTGACCCTTGGCTGGCTGTGG + Intronic
1176271092 20:64235767-64235789 GGGTGACCCTGGGATGGCTGTGG + Intronic
1176271100 20:64235791-64235813 GGGTGACACTGGGCTGGCTGTGG + Intronic
1176271106 20:64235815-64235837 GGGTGACACTGGGCTGGCTGTGG + Intronic
1176271112 20:64235839-64235861 GGGTGACCCTGGGCTGGCCGTGG + Intronic
1176271136 20:64235911-64235933 GGGTGACCCTGGGCTGGCCGCGG + Intronic
1176271162 20:64235983-64236005 GGGTGACCCTGGGCTGGCCGCGG + Intronic
1176271171 20:64236007-64236029 GGGTGACCCTGGGCTGGCCGCGG + Intronic
1176271188 20:64236055-64236077 GGGTGACCCTGGGCTGGCCGTGG + Intronic
1176271206 20:64236103-64236125 GGGTGACCCTGGGCTGGCTGTGG + Intronic
1176271222 20:64236151-64236173 GGGTGACCCTGGGCTGGCCGTGG + Intronic
1176271240 20:64236199-64236221 GGGTGACCCTGGGCTGGCTGTGG + Intronic
1176271248 20:64236223-64236245 GGGTGACCCTGGGATGGCTGTGG + Intronic
1176271266 20:64236271-64236293 GGGTGACCCGGGGCTGGCCGCGG + Intronic
1176271284 20:64236319-64236341 GGGTGACCCTGGGCTGGCCGCGG + Intronic
1176271311 20:64236391-64236413 GGGTGACCCTGGGCTGGCCGTGG + Intronic
1176271329 20:64236439-64236461 GGGTGACCCGGGGCTGGCCGTGG + Intronic
1176284726 21:5013329-5013351 GGTCGGGCCCCCGCTGGCTGTGG - Intergenic
1176655029 21:9580095-9580117 GCGTGGCGCAGCCCTGGCTGAGG - Intergenic
1178626261 21:34221364-34221386 GGGTGGCCCCAAGTGGGCTGGGG - Intergenic
1179167301 21:38944939-38944961 GGGTGGGCCGGCACTGACTGTGG - Intergenic
1179658333 21:42859548-42859570 CGCTGGCCCCTGGCTGGCTGTGG - Intronic
1179819173 21:43926456-43926478 GGGTGGCCCAGCGTTGGCTCGGG + Intronic
1179872455 21:44250146-44250168 GGTCGGGCCCCCGCTGGCTGTGG + Intronic
1180312207 22:11250273-11250295 GCGTGGCCCCCGGCTGGCCGGGG + Intergenic
1181595165 22:23909507-23909529 GGGTAGCCCTGCTCTGTCTGTGG - Intergenic
1185081234 22:48710487-48710509 GGGTGGCCCTGGTCTGGCTCTGG - Intronic
949966711 3:9362999-9363021 CGGTGGCTCCGCGCTGGCGGCGG - Intronic
950425322 3:12922098-12922120 GGTGGGGCCCGGGCTGGCTGGGG - Exonic
950560524 3:13718777-13718799 GGGAGACGCCGGGCTGGCTGGGG - Intergenic
953939625 3:47081316-47081338 TGGTGGCCCCCGGTTGGCTGGGG + Intronic
954238811 3:49277333-49277355 GGCTGGCCCCGCGGTGGGAGTGG + Exonic
954293595 3:49662379-49662401 GGGAGGCCCCGCCCTGCCGGAGG + Exonic
954714116 3:52518659-52518681 TGGTGGCCCTGCGTGGGCTGAGG + Intronic
954878664 3:53819612-53819634 GGGGGACCCCAGGCTGGCTGCGG + Exonic
959591861 3:108090773-108090795 GGGCGCCGCCGGGCTGGCTGGGG + Intronic
961448512 3:126992101-126992123 GGCTGGCCCCACGGTGGCAGGGG + Intronic
963121266 3:141778659-141778681 TGGTGGCCACGGCCTGGCTGAGG - Exonic
967123705 3:186406331-186406353 GGGAGGCCCAGCACTGGCAGGGG - Intergenic
968519836 4:1030306-1030328 GGGTGGAGCCACGCTGGGTGAGG + Intergenic
968830575 4:2931350-2931372 GAGTGGCCCTGCCCTGGCAGGGG - Intronic
968845983 4:3041792-3041814 GGCCGGCCCGGCGCTGGCTGCGG + Intergenic
968909742 4:3471578-3471600 GGGTGGCTCCGCGCAGGACGGGG - Intronic
969274644 4:6127244-6127266 GGCTGCCCCCGGGCTTGCTGTGG - Intronic
969436338 4:7191642-7191664 GGGTGGCCCTGGCCTGGCAGAGG + Intergenic
969787988 4:9473868-9473890 GGGGGGCGCCCCGCTTGCTGCGG + Intergenic
976597007 4:86904194-86904216 GGCTGGCCCCGCACTGGGCGCGG - Intronic
980923935 4:139115430-139115452 GGGACGCCCCCGGCTGGCTGGGG + Intronic
980966307 4:139524618-139524640 GGGAGGCCACTGGCTGGCTGGGG - Intronic
982198280 4:152936874-152936896 GCGTGGCCCCCGGCTGGCTAGGG - Intronic
984198345 4:176687338-176687360 GGTTGGCCCCACATTGGCTGGGG + Exonic
988797979 5:34669552-34669574 GGGTGGCAGGCCGCTGGCTGTGG + Intronic
992693036 5:79258765-79258787 GGGTGTCACCGCTCTGGCTTGGG + Intronic
1000240332 5:159402965-159402987 GGGTGGCCCAGGGCTGGTTTGGG + Intergenic
1002193997 5:177492483-177492505 GGGTGCGCCCGCGCTGGCAGTGG - Intronic
1002347375 5:178557439-178557461 GGGGGGCCCTGAGCTGGCTCTGG - Intronic
1002441223 5:179265485-179265507 GGGGGGCCCAGCCCTCGCTGGGG + Intronic
1004044475 6:12011847-12011869 GGGCGTCCCCGCGGGGGCTGGGG - Intronic
1006396889 6:33793440-33793462 GGGGAGCCCAGCACTGGCTGGGG - Intergenic
1006665062 6:35688198-35688220 GGGTGGCCGCGCTCCGGGTGTGG - Intronic
1007337403 6:41163355-41163377 GGGTGGCCCCCAGATGGTTGGGG + Intergenic
1007341051 6:41191821-41191843 GGATGGCCCTGCCCTGACTGGGG - Exonic
1008308340 6:49933754-49933776 TGGTGGCCCCGCACTAGCAGGGG + Intergenic
1012399508 6:98832647-98832669 GAGTGGCCCCGCGCTTGCGCTGG + Intergenic
1013099525 6:106974983-106975005 TGGTATCCCCGCGCCGGCTGCGG + Intronic
1016937331 6:149456957-149456979 GGGTGGCCTCGCGTTGGGGGTGG - Intronic
1018770935 6:166970991-166971013 GGGTGGCCCCGGGCAGGCATGGG + Intergenic
1018901502 6:168054066-168054088 GGGTGGCCCTGGGCAGGGTGTGG - Intergenic
1018940671 6:168307537-168307559 GAGTGGCCCCGAGCTGACCGGGG + Exonic
1019727434 7:2610945-2610967 GGGTGGCCCCACACAGGCTAAGG - Exonic
1020026989 7:4906256-4906278 GGCTGGCCCCGCCCTGACGGGGG + Exonic
1020113636 7:5462487-5462509 GGGAGGCCCCGGGCTGGGTCAGG + Intronic
1021677753 7:23097990-23098012 GGGTGTCACAGCCCTGGCTGGGG - Intergenic
1029977632 7:104849457-104849479 GGGTGGCCCTGCACTGTGTGGGG + Intronic
1031886604 7:127251705-127251727 GGGCGGCCCCGCGCGGGGCGTGG - Intronic
1032223331 7:130010596-130010618 GGGTGGCCCAGCCCTGAGTGCGG + Intergenic
1032344294 7:131105738-131105760 GGGTGCCCCGGCGCTGGCTGAGG - Intergenic
1034418961 7:150979137-150979159 GGCTGGCCCCGGGCTGCCGGGGG - Intergenic
1035253610 7:157612887-157612909 GGGGGGCCCTGCCCTGGCCGGGG - Intronic
1035638290 8:1163396-1163418 GGGCGGCCCCACGCTGGGCGAGG + Intergenic
1039610235 8:38913750-38913772 GAGTGGTCTGGCGCTGGCTGGGG - Intronic
1040501375 8:48008332-48008354 GGGTCGCCCCGCGCCCGCCGGGG + Intergenic
1041170825 8:55140714-55140736 GCTTGGCCCTGGGCTGGCTGTGG + Intronic
1043395016 8:79827599-79827621 GGGTGGGAGAGCGCTGGCTGAGG - Intergenic
1043734137 8:83723557-83723579 GGGTGTCACAGCTCTGGCTGAGG + Intergenic
1043968826 8:86508396-86508418 TGGCGGCCCCGCGCTGCCTAAGG - Intronic
1045111113 8:98940293-98940315 GGGTGGCCTTGCGCCGGCTCTGG + Intronic
1047760351 8:127949798-127949820 GGGAGGCCCAGTGCCGGCTGTGG + Intergenic
1049180186 8:141218208-141218230 TGGTGGCCCCGCTCTGGTTCCGG + Exonic
1049431345 8:142566732-142566754 TGGGTGCCCAGCGCTGGCTGCGG - Intergenic
1049497996 8:142945709-142945731 CTGTGGCCCTGCGCTGGCTCAGG + Intergenic
1049615906 8:143575754-143575776 GGGTGGCACTGCCCTGGGTGGGG + Intronic
1049656711 8:143802288-143802310 AGGGGCCCCCACGCTGGCTGTGG + Intronic
1053613892 9:39744055-39744077 GGCTGGCCCTGGGCTGACTGTGG - Intergenic
1053900823 9:42793965-42793987 GGCTGGCCCTGGGCTGACTGTGG + Intergenic
1054239624 9:62598342-62598364 GGCTGGCCCTGGGCTGACTGTGG + Intergenic
1054260827 9:62863581-62863603 GGCTGGCCCTGGGCTGACTGTGG - Intergenic
1054553757 9:66632869-66632891 GGCTGGCCCTGGGCTGACTGTGG + Intergenic
1057028546 9:91755918-91755940 GGGTGGCCACGTGCTTGCTTAGG - Intronic
1058937114 9:109779943-109779965 GCGTGGACACGCGCTTGCTGGGG - Intronic
1059263776 9:113006415-113006437 GGGTGGCCCTGCTCTGCCTATGG + Intergenic
1060826809 9:126692345-126692367 GGGAGGCCCAGTGGTGGCTGGGG + Intronic
1061389818 9:130311243-130311265 GGCTGGGCCAGGGCTGGCTGGGG + Intronic
1061832828 9:133306619-133306641 GGGGGGCCCCGGGCTGGTTCAGG - Intergenic
1062426372 9:136507987-136508009 AGGTGGCCCCGTTCTGGCAGGGG + Exonic
1062551159 9:137087223-137087245 GGGTCGCGCCGGGCTGACTGGGG + Intronic
1203632754 Un_KI270750v1:83548-83570 GCGTGGCGCAGCCCTGGCTGAGG - Intergenic
1185736591 X:2500755-2500777 GGGTGGGCGCGGGCTGGCTCGGG - Intronic
1185835870 X:3345804-3345826 GGGTCGCGTCGAGCTGGCTGCGG + Intronic
1186496564 X:10015949-10015971 CGGCGGCCCCGCGCTGGGCGGGG - Intronic
1187163797 X:16786751-16786773 GGGTGGGACCGCGATGGATGGGG + Intronic
1190265764 X:48826590-48826612 GGGTATCCCCGCGCCGGCTTTGG + Intergenic
1190579070 X:51872968-51872990 GGGTGGCCCTGCTCTGTCTATGG + Intronic
1194016159 X:88624423-88624445 GGGTGACTCCTCCCTGGCTGGGG - Intergenic
1195348689 X:103976437-103976459 GGGTGGCACCGTTCTGGCTTGGG + Intergenic
1195358753 X:104062403-104062425 GGGTGGCACCGTTCTGGCTTGGG - Intergenic
1198833479 X:140776533-140776555 GGGTGGTCACGCGCGGGCTTGGG - Intergenic
1201240789 Y:11955037-11955059 GGGTTGCGTCGAGCTGGCTGCGG - Intergenic